ID: 951607069

View in Genome Browser
Species Human (GRCh38)
Location 3:24447436-24447458
Sequence CCTTCTTTGCAGTAATGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951607062_951607069 16 Left 951607062 3:24447397-24447419 CCTGCAGTGAACCTAGGAGAGAA 0: 1
1: 0
2: 2
3: 10
4: 174
Right 951607069 3:24447436-24447458 CCTTCTTTGCAGTAATGGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 146
951607063_951607069 5 Left 951607063 3:24447408-24447430 CCTAGGAGAGAACTTTCTCATGC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 951607069 3:24447436-24447458 CCTTCTTTGCAGTAATGGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951607069 Original CRISPR CCTTCTTTGCAGTAATGGGA GGG Intronic
900430120 1:2597412-2597434 CCTTTGTTAGAGTAATGGGAGGG - Intronic
904473572 1:30750649-30750671 CCTTCCTGGCAGCCATGGGATGG - Intronic
906860684 1:49355904-49355926 CTTTCTGGGCAGTACTGGGAAGG - Intronic
911872918 1:103121824-103121846 CCTCTTTTGCAGAAATGGAAAGG + Intergenic
913231511 1:116744193-116744215 CCTTCTTAGCATTGATGGGTCGG - Intergenic
913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG + Intergenic
917479219 1:175396550-175396572 CCACCTTGGCAGTGATGGGAAGG + Exonic
917508216 1:175648323-175648345 GCTGCTTTGCTGGAATGGGAAGG + Intronic
917708292 1:177657268-177657290 CCTGCTTTGCAGAAATGTGTTGG - Intergenic
918303527 1:183225490-183225512 CCTTCTAAGCAGGACTGGGAAGG + Intronic
920307572 1:205029061-205029083 CCTGCTTTGAAGGATTGGGAGGG - Intergenic
921289152 1:213638870-213638892 CCTTTTTTGCAGAAATTGGTAGG - Intergenic
922222700 1:223620579-223620601 CCCTGTTTGCAGGAATGGGGAGG + Intronic
924061672 1:240181494-240181516 CCTTCTTTGTATGAATTGGAAGG + Intronic
1064238325 10:13599149-13599171 CCTTCTTGGTAGTAATGACATGG + Intronic
1071033794 10:81217453-81217475 CCATATTTGCAATAATTGGAAGG + Intergenic
1072255948 10:93620453-93620475 CATTCTATGCAGTCATAGGATGG + Intronic
1072401174 10:95102825-95102847 CCTTCTTTGCAGAAATTGACAGG + Intergenic
1072663865 10:97380247-97380269 CCTTTTTTCCAGCAATGGGAGGG + Intronic
1075084473 10:119405244-119405266 CCTTCTGTGGGGTACTGGGAAGG + Intronic
1075088520 10:119429993-119430015 CCTTCTGTGCAGGAAGGGGTGGG - Intronic
1075910660 10:126123074-126123096 AATTGTTTGCAGTAAAGGGAAGG - Intronic
1077523487 11:3050131-3050153 TCTTCTCTGCAGTAAAGGGGTGG + Intronic
1083579629 11:63816722-63816744 CCTTCTTTGCTGAACTGGAAAGG + Intronic
1088157614 11:106827854-106827876 ACTTCCCTGCAGTCATGGGAGGG + Intronic
1090501827 11:127268391-127268413 CCTGTCTGGCAGTAATGGGAGGG - Intergenic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1091118797 11:133039671-133039693 CCTTCTTGGCAGTCATGGGTGGG + Intronic
1093889177 12:24498972-24498994 CCTTCTTTGCATTCAAGTGATGG + Intergenic
1094522314 12:31205421-31205443 CCTTTTTTGTAGTAATGGTAAGG - Intergenic
1096320436 12:50607530-50607552 CCTTCTTTTCAGTAGTAGAAAGG - Intronic
1097508438 12:60505868-60505890 CCTTATACCCAGTAATGGGATGG - Intergenic
1100873008 12:98931907-98931929 CCTTCTCTGGATTACTGGGAAGG + Intronic
1101299782 12:103467308-103467330 CCTTCATTGTATTAATGGGGAGG + Intronic
1104370795 12:128222279-128222301 CCATCTTTGCAGTAATGAGTGGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106005857 13:25769709-25769731 CCTTCTCTGTAGTTATGAGAGGG + Intronic
1115484529 14:33897766-33897788 CGTTATTAGCAGTAATGGAATGG - Intergenic
1115799565 14:36977278-36977300 CCTTCATAGCAGGAAGGGGAAGG - Intronic
1120505407 14:85349112-85349134 CCTTCTTTCCAGTCATGGACAGG - Intergenic
1120668690 14:87338212-87338234 CCCTCTTTCCAGTACAGGGAGGG + Intergenic
1121421373 14:93818112-93818134 CTTTCCTTGCTGTAATAGGAGGG - Intergenic
1132056674 15:98656156-98656178 CATTCTTTGGAGTAGTGGGGCGG + Intronic
1134829918 16:17314614-17314636 CTTTCTTTCCTGGAATGGGAGGG - Intronic
1135155614 16:20050385-20050407 CATTCTTTGCAGGGATGGGTGGG + Intronic
1138218103 16:55223202-55223224 CTTTCTTTGCAGTAAAGTGAAGG - Intergenic
1138295907 16:55884979-55885001 CCTTCTCAGCAGTAGTAGGAGGG - Intronic
1138970671 16:62139298-62139320 CCTTCATTGCAATATTGTGAGGG - Intergenic
1140936401 16:79674621-79674643 CCTTCTGTGCTGTAATTGAATGG - Intergenic
1141052169 16:80779064-80779086 CCTTCCTTGGAGTGAGGGGAAGG - Intronic
1141690550 16:85594075-85594097 ACTTCTTTGCAGAAAAGGGAGGG + Intergenic
1143164338 17:4890351-4890373 GCTTCTTTGCTGGAACGGGATGG + Intronic
1145984011 17:29032176-29032198 CTTTCTTTGCAGGCATGGGTGGG + Intronic
1146986684 17:37226835-37226857 CCTTCTTTCCAAAAGTGGGAGGG - Intronic
1148792998 17:50184052-50184074 CCTTCTTTGGAGTTGGGGGAGGG - Exonic
1153815617 18:8787476-8787498 CCTGATCTGCAGTAGTGGGACGG + Intronic
1154502708 18:15004603-15004625 CCTGCTTCGCAGTGATGGGGAGG - Intergenic
1155595190 18:27477872-27477894 ACTTCTTTGCAGCAATTAGAAGG - Intergenic
1156384723 18:36594746-36594768 CCTTGTTGGCAGTGATGTGATGG + Intronic
1161378724 19:3953374-3953396 CAGGCTTTGCAGTAATGAGAGGG - Intergenic
1161719653 19:5895811-5895833 CCTTCTTTGCAGCCATCAGAGGG - Intronic
1166488835 19:43239745-43239767 TCTTCTTTGGAGAAATGGGAGGG + Intronic
926846078 2:17140516-17140538 CCTCCTTAGGAGAAATGGGAAGG - Intergenic
927328414 2:21833538-21833560 TCTTCTTTGCAGAAAAGGCAGGG - Intergenic
928403229 2:30994282-30994304 CATTCTACTCAGTAATGGGATGG - Intronic
931877655 2:66531126-66531148 CCTTATTTTTAGCAATGGGAAGG + Intronic
932685235 2:73863611-73863633 CCTTCTTTGCTGTTTTGGTATGG + Exonic
933593590 2:84260527-84260549 TCTTCTTTGCAGAAATAGAAAGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934925222 2:98377477-98377499 CCTTCCTTGCTGTAAAGGAAAGG + Intronic
935179870 2:100679726-100679748 CCTTCTTTGCAGGTAGGGGTGGG - Intergenic
935693639 2:105751672-105751694 TCTCCTGTGCAGTAATGGCAGGG + Intronic
938501876 2:131834773-131834795 CCTGCTTCGCAGTGATGGGGAGG - Intergenic
942713415 2:178864140-178864162 CCCTCTTTGCAGTGATGGTTGGG - Intronic
945841327 2:214891169-214891191 CCCTCTTAGGAGTAATGGGAAGG - Intergenic
946917233 2:224536368-224536390 CTTTCTTTGAAGTAATTGGTTGG - Intronic
948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG + Intergenic
1171315822 20:24193862-24193884 CCTTCTTTTGAGTTATAGGAGGG - Intergenic
1173434348 20:43019274-43019296 CCCTTTTAGCAGAAATGGGATGG - Intronic
1176263096 20:64193568-64193590 ACTTCTCTGCAGTGAGGGGAGGG - Intronic
1178200040 21:30393096-30393118 CCTTCCCTGCACTAATGGGCTGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181770685 22:25123124-25123146 CCTTCTATGCTGTACTGGGTTGG + Intronic
1181983700 22:26784271-26784293 CCACCTTTGCAGCAATGGTAAGG - Intergenic
1183123032 22:35745985-35746007 TCTTCTTTCCAGTTATGGCAGGG - Exonic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949169426 3:980859-980881 CCATCCTTGCAGTAATGAGTGGG - Intergenic
950563946 3:13753391-13753413 CTTTCTCTGGAGTAATGGGCAGG + Intergenic
951354689 3:21650404-21650426 CTTTCTTTACAGTAATTGGCAGG - Intronic
951362317 3:21739768-21739790 TCTTCTTTTCAGTAATGGAAGGG + Intronic
951607069 3:24447436-24447458 CCTTCTTTGCAGTAATGGGAGGG + Intronic
955031785 3:55229047-55229069 TCTTCTTTGCAGTAAGGCGTTGG + Intergenic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
956895314 3:73653907-73653929 GCTTCTTTGCAGCACTGGTATGG + Intergenic
957989562 3:87611891-87611913 CCTTGTTTGCATTAATGAAAAGG + Intergenic
960266556 3:115626860-115626882 CTTTCCTTGCAGTGTTGGGAAGG + Intronic
962822397 3:139063245-139063267 CATGCTTTGCAGTTATTGGATGG + Intronic
963067607 3:141275663-141275685 CTTTCTTTCCAGTAGTTGGAAGG - Intronic
963082979 3:141411536-141411558 CCACCTTTGCTTTAATGGGAGGG + Intronic
963086720 3:141443853-141443875 ACTTTGTTGCAGTAATGGCAAGG - Exonic
970568517 4:17356170-17356192 ACTTTTAAGCAGTAATGGGAAGG - Intergenic
974458333 4:62156962-62156984 CCTTCTTTCCTGGATTGGGAAGG + Intergenic
977957193 4:103043308-103043330 CTTTCCTTGCAGGCATGGGATGG - Exonic
978342560 4:107734005-107734027 TTTTCTTTTTAGTAATGGGAGGG - Intergenic
979532859 4:121787604-121787626 CCATCTTTGCATTTATGGCATGG - Intergenic
980553180 4:134367165-134367187 CCTCCCTTTCAGTAATGGGTAGG + Intergenic
984166820 4:176312830-176312852 CATCCTTTTCTGTAATGGGAGGG - Intergenic
985981078 5:3464217-3464239 CTTTCTGTGCAGTGAGGGGAAGG - Intergenic
987523428 5:19017260-19017282 CCTTATACCCAGTAATGGGATGG - Intergenic
988418889 5:30981098-30981120 TCTGCTTTGAAGTAATGGGCAGG - Intergenic
988452959 5:31361715-31361737 ACCGCTTTCCAGTAATGGGAGGG - Intergenic
990931671 5:61098390-61098412 GATGCTTTGCAGCAATGGGAAGG - Intronic
998643753 5:144040407-144040429 CCTTCTTTGAAGTAATTGCCTGG + Intergenic
999011368 5:148044625-148044647 CCTTCTTTGCTGTATGAGGATGG - Intronic
1002864064 6:1105743-1105765 CCTTCTTTGCTGGCATGGGCTGG - Intergenic
1004263766 6:14131508-14131530 CCTTCTTCACAGTTATTGGAGGG + Exonic
1015808707 6:137140189-137140211 CCCTCTTTGCAGTAATGAATGGG - Intergenic
1016179827 6:141131647-141131669 CTATCTTGGCAGTAGTGGGAAGG + Intergenic
1018738775 6:166711225-166711247 CCTTCATTGCAGTAATGAGGTGG + Intronic
1019730923 7:2629149-2629171 CCTTCTTTGAAGAAAGGGGCCGG - Intergenic
1022918386 7:34985038-34985060 CCTTCTTTCCAGTGTTGGTAAGG - Intronic
1023314526 7:38921610-38921632 CCTTCTTTGCAAGATTTGGATGG + Intronic
1028147309 7:87332072-87332094 CCTTCTTTACTGTAATGCCATGG + Intergenic
1031077466 7:117226692-117226714 CCTTCCTTGCAGGTATGGGATGG + Intronic
1032260060 7:130328460-130328482 TCTTTTTTGCAGTAATGGAGAGG + Intergenic
1034999866 7:155604060-155604082 CCTCCCTTGCAGTATTTGGACGG - Intergenic
1035961418 8:4142670-4142692 GCTTCTTTGCAGTTATTGGGTGG + Intronic
1037858553 8:22388725-22388747 CCTTAACTTCAGTAATGGGATGG + Intronic
1038175745 8:25181208-25181230 CCTTCTGATCAATAATGGGATGG - Intergenic
1038406157 8:27324531-27324553 GTTTCTTTTCAGAAATGGGAAGG + Intronic
1041434415 8:57821995-57822017 CCGTTTTTGCAGTAATAAGATGG - Intergenic
1043428746 8:80173989-80174011 CCCTCTAAGCAGGAATGGGAAGG - Intronic
1043843069 8:85132206-85132228 CCTGCTCTACAGTAATAGGAGGG - Intronic
1044703398 8:94985047-94985069 CCTCCTTTGCAGCTAGGGGATGG + Intronic
1044996134 8:97839876-97839898 CCTCCCTTGCAATAATGGAAAGG - Intronic
1046086320 8:109440223-109440245 CTCTCATTGAAGTAATGGGAAGG + Intronic
1046333531 8:112753423-112753445 CATTCTTTCCAGAAATAGGAAGG - Intronic
1050157492 9:2683030-2683052 CTTTCTTTCAAGCAATGGGAAGG + Intergenic
1050681542 9:8117410-8117432 TCTTCTTTGCAGTATTGCCAAGG + Intergenic
1053466371 9:38311576-38311598 CCTCCTTTGCAGTGCTGGGCAGG + Intergenic
1055012344 9:71580588-71580610 CATTTTTTTCAGTAATGGGATGG + Intergenic
1056159701 9:83876536-83876558 CCTTTTTTGCAGAAATGGAAAGG + Intronic
1057456596 9:95218626-95218648 CCTACTTTTCATTACTGGGATGG - Intronic
1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG + Intergenic
1060876159 9:127085046-127085068 CATTGTTTTCAGTAATGTGAAGG + Intronic
1062497575 9:136838897-136838919 CCTGCTTTGCAGTGATGGGGAGG + Exonic
1188692222 X:33144088-33144110 CTTTATTGGCAGTAATGTGAAGG + Intronic
1189662755 X:43320242-43320264 AATTCTTTGCAGTAATGAGAAGG - Intergenic
1192005728 X:67210031-67210053 CCATCTTTGAAGGAATTGGAAGG + Intergenic
1192367245 X:70484198-70484220 CATTCTTTGCAGCCATAGGATGG + Intronic
1193386645 X:80880714-80880736 CCTTCTTAGCTGTAAGGGGGAGG - Intergenic
1194802025 X:98285817-98285839 CCTTTTTTTAAGTATTGGGAAGG + Intergenic
1196803038 X:119560683-119560705 CCTGAATTGCAGTATTGGGAAGG - Intronic
1198428659 X:136544470-136544492 CATTCTTTGCAATATTGGGGAGG + Intronic
1198617833 X:138478528-138478550 CCTTCTCTGCAGTTCTGTGAAGG + Intergenic
1199945135 X:152659188-152659210 CAATCTTTGTAGTAAGGGGAAGG + Intergenic
1200950689 Y:8896605-8896627 CCTTGTTAGCAGAAATAGGAGGG + Intergenic
1201861865 Y:18607005-18607027 CCTGCTTTGCAGAATTGTGAAGG + Intergenic
1201871458 Y:18713375-18713397 CCTGCTTTGCAGAATTGTGAAGG - Intergenic