ID: 951607328

View in Genome Browser
Species Human (GRCh38)
Location 3:24450716-24450738
Sequence AAGCTGAGCCTACTATAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951607328_951607329 -1 Left 951607328 3:24450716-24450738 CCAATCTATAGTAGGCTCAGCTT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 951607329 3:24450738-24450760 TTTTTTTGAGAGAGAGATTAAGG 0: 1
1: 0
2: 13
3: 98
4: 808
951607328_951607330 16 Left 951607328 3:24450716-24450738 CCAATCTATAGTAGGCTCAGCTT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 951607330 3:24450755-24450777 TTAAGGTGCATACAGTCAACTGG 0: 1
1: 0
2: 2
3: 21
4: 220
951607328_951607331 24 Left 951607328 3:24450716-24450738 CCAATCTATAGTAGGCTCAGCTT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 951607331 3:24450763-24450785 CATACAGTCAACTGGTGTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951607328 Original CRISPR AAGCTGAGCCTACTATAGAT TGG (reversed) Intronic
901749049 1:11394708-11394730 AAGGAGAGACTACTATAGATGGG - Intergenic
903398907 1:23024369-23024391 AAGCTGAGGCCAGTATAGATAGG + Intronic
904802459 1:33103513-33103535 GAGGTGAGCCTACTTTAGAGAGG - Intronic
905341340 1:37280037-37280059 AAGCAGAGCCAACAAGAGATTGG + Intergenic
908568912 1:65388174-65388196 AAGCTGAGCCTATTCTAACTGGG + Intronic
910485272 1:87706220-87706242 AGGCTGAGCCAACTCTAGATTGG - Intergenic
910581352 1:88828954-88828976 AAGAAAAGCCCACTATAGATTGG + Intronic
911062352 1:93759245-93759267 AAGCTAAGCATAGTATAGACAGG + Intronic
915253868 1:154610492-154610514 ATGCAGAGCATACTATAGTTTGG - Intronic
915682329 1:157593363-157593385 AAGCTGAGCCCACCAAAGTTAGG - Intronic
919604604 1:199666512-199666534 ATCCTGAGCCCACTATTGATTGG - Intergenic
1065942061 10:30573832-30573854 CAGCTGAGCCTTCTATTCATGGG + Intergenic
1076062356 10:127423312-127423334 GAGCTGAGCTTATTATATATCGG - Intronic
1079172557 11:18110243-18110265 TAGTTAAGCCCACTATAGATGGG + Intergenic
1086880602 11:92149172-92149194 AGACTGATCCTACTATAGGTGGG - Intergenic
1088844265 11:113651720-113651742 AAGGTGAGCCTATTAGAGAAGGG - Intergenic
1092276182 12:7062510-7062532 ATGCTGAGCCTACCATGTATGGG + Exonic
1093331884 12:17853649-17853671 AAGCTGAGCATGCTATCGGTTGG - Intergenic
1095320233 12:40818302-40818324 AAACTGAACCTACAATTGATTGG - Intronic
1097486060 12:60202691-60202713 AAGCTGAGCAGAATATAGACAGG - Intergenic
1100652541 12:96606149-96606171 GAGCTGAGCCTATTTTAGACGGG + Intronic
1102933597 12:116879909-116879931 AGGCTGAGCCCACCATAGATGGG - Intronic
1108705068 13:52977896-52977918 GAGCTGAGCCTCCAAGAGATTGG - Intergenic
1118673619 14:68158479-68158501 AAGCTGAACCAACTAAAGAGTGG + Intronic
1122837210 14:104436171-104436193 GAGCTGAGCCTCCTGCAGATGGG + Intergenic
1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG + Intergenic
1127076106 15:55327434-55327456 AAGCTGATCCAACTATCTATGGG - Intronic
1135606557 16:23831057-23831079 AAGGTGAGCCTACTAGACAATGG - Intergenic
1162686753 19:12393095-12393117 CATCTTAGCCTACTATTGATGGG - Intronic
1162691105 19:12432869-12432891 CATCTTAGCCTACTATTGATGGG - Intronic
1166497176 19:43312182-43312204 TAGCTGAGGCCTCTATAGATCGG - Intergenic
934810512 2:97272844-97272866 AATCTGAGGCTACTAGAGACTGG + Intergenic
934827180 2:97435095-97435117 AATCTGAGGCTACTAGAGACTGG - Intergenic
937679464 2:124628071-124628093 AGACTGAGCCTACTACTGATTGG + Intronic
941454545 2:165699834-165699856 AAGCTGATCCTGCAATAGATAGG + Intergenic
942688065 2:178555037-178555059 AACCTGCGCCTACTATTGAGTGG - Exonic
948950862 2:241250453-241250475 AATCTGAGCCAACAGTAGATGGG - Intronic
1171416218 20:24982468-24982490 AAGCAGAGCCTACTGGGGATTGG - Intronic
1171902987 20:30874211-30874233 AAGGAGAACCAACTATAGATGGG - Intergenic
1179314856 21:40234572-40234594 ATGCTGAGGCTACAATAGACAGG - Intronic
1180336383 22:11580181-11580203 AAGGAGAACCAACTATAGATGGG - Intergenic
1184512912 22:44943496-44943518 TAGCTGAGCCTGCTGGAGATCGG - Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
952746703 3:36788273-36788295 TAGCTGAGACTACTAGTGATGGG + Intergenic
953672453 3:44974988-44975010 ATTGGGAGCCTACTATAGATAGG - Intronic
956701667 3:71964531-71964553 AAGGTGAGCCTACTTTCAATGGG - Intergenic
957970674 3:87377891-87377913 GAGCTTAGCCAACCATAGATAGG + Intergenic
961154287 3:124665829-124665851 AAGTTGGGGGTACTATAGATAGG - Intronic
961365642 3:126397843-126397865 ATGCTGAGCCAAGTACAGATAGG + Intronic
971267468 4:25107966-25107988 CAGCTGAGCTTACTATTGAATGG + Intergenic
971619195 4:28832028-28832050 CAAGTGAGCCTACTACAGATCGG - Intergenic
973200628 4:47497571-47497593 AAGCTAAGACTTCTACAGATAGG - Intronic
978883696 4:113740822-113740844 AAGAGGAGACTACTATAGTTAGG - Intronic
980920202 4:139077116-139077138 AAGCTTATACTACTATAGGTTGG + Intronic
982742706 4:159074415-159074437 AAGTAGAGCCTTCTATAGAATGG - Intergenic
982827479 4:160019134-160019156 AAGCTGAGCCTGCTGGAAATGGG - Intergenic
992780695 5:80124437-80124459 AAACAAAGCCTACTATAGAGAGG - Intronic
993039373 5:82794845-82794867 AAGGTGAGCCTACTGTAGCCTGG - Intergenic
993830802 5:92755681-92755703 GAGCCTAGACTACTATAGATTGG + Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
997595340 5:135103487-135103509 AAGCTGGGCCTCCTCCAGATAGG - Intronic
998652408 5:144135612-144135634 AACCAGAGCCTATTATAGTTTGG - Intergenic
998899447 5:146837302-146837324 AAGCCTAGCCTACTTTAAATGGG - Intronic
999047897 5:148489482-148489504 AAGCTGAGCTTCCTAAAGAAGGG + Intronic
1008069696 6:47086763-47086785 AAGCTGAGGCTTCTATTGAGTGG + Intergenic
1011208433 6:84927656-84927678 AAGCTGTCCCTATTATAAATAGG - Intergenic
1014148889 6:118030510-118030532 AAGTAGAGCATACTACAGATTGG + Intronic
1017489840 6:154935304-154935326 AAGCTGAGCGGACTATAAATGGG + Intronic
1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG + Intronic
1030471369 7:109966654-109966676 AAGCAGAGCCTACTACCGCTGGG + Intergenic
1030895515 7:115054767-115054789 GAGCAGAGTCTACTATAGTTAGG - Intergenic
1033506503 7:142007879-142007901 AAGCTGAGGTTACTATAATTAGG + Intronic
1033987873 7:147248617-147248639 AAGTTGAGACTACTCTAGTTTGG + Intronic
1041108404 8:54463474-54463496 AACTTGAGCCTACTCCAGATGGG - Intergenic
1043727528 8:83629533-83629555 AATCTGAGGCAACTATGGATTGG - Intergenic
1046201598 8:110934791-110934813 AAGCTAAGCCCTCTCTAGATTGG - Intergenic
1048754085 8:137715787-137715809 AATTTGAGCCTTCTATTGATTGG + Intergenic
1049478240 8:142806804-142806826 AAGCTAAGCCTACCCTAGACAGG - Intergenic
1051983066 9:23047202-23047224 AGACTGAGCCTACAATTGATTGG + Intergenic
1052201040 9:25780521-25780543 AAGGTTAGCCTACTTTAGTTTGG - Intergenic
1062490132 9:136800983-136801005 AAGCAGAACCTACTCCAGATGGG + Intronic
1187645970 X:21347923-21347945 AAGCTAAGCATACTCTAAATAGG - Intergenic
1189215384 X:39318717-39318739 AAGCTGAGCCCAGACTAGATTGG + Intergenic
1195656091 X:107332806-107332828 AAGCTGAGGCAAAAATAGATAGG - Intergenic
1197635846 X:128914123-128914145 AAGGTGAGCTCACTATAGGTTGG + Intergenic