ID: 951607329

View in Genome Browser
Species Human (GRCh38)
Location 3:24450738-24450760
Sequence TTTTTTTGAGAGAGAGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 920
Summary {0: 1, 1: 0, 2: 13, 3: 98, 4: 808}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951607328_951607329 -1 Left 951607328 3:24450716-24450738 CCAATCTATAGTAGGCTCAGCTT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 951607329 3:24450738-24450760 TTTTTTTGAGAGAGAGATTAAGG 0: 1
1: 0
2: 13
3: 98
4: 808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951607329 Original CRISPR TTTTTTTGAGAGAGAGATTA AGG Intronic
900283546 1:1888352-1888374 TTTTTTTGAGATTGAGAGTTTGG - Intronic
901291885 1:8130599-8130621 TTTTTTTGAGAGAGAGAGAGGGG - Intergenic
901549526 1:9985390-9985412 TTTTACAGAAAGAGAGATTAGGG - Exonic
902057459 1:13613884-13613906 TTTTTTTTAAAGAGAGAAAAGGG + Intronic
902921765 1:19670273-19670295 TACTCTTGAGAGAGGGATTAGGG - Intronic
903062073 1:20676012-20676034 TTTTTTTGAGACAGAGTCTCAGG - Intronic
903150791 1:21406949-21406971 TTTTTGAGAGAGAGAGAGTCTGG + Intergenic
903556493 1:24197375-24197397 TTTTTCTGAGGGAGATAATAAGG + Intergenic
904234448 1:29105758-29105780 TTTTTTTTTGAGACAGAGTATGG + Intronic
904499381 1:30905335-30905357 TTTGTGAGAGAGAGAGAGTACGG - Intronic
904636447 1:31885154-31885176 TTTTTTTCAGAGATAGGTTCTGG - Intergenic
904776725 1:32913437-32913459 TTTTTTTTTGAGAGAGAGTCTGG + Intergenic
905132995 1:35775526-35775548 GTTTTTTAAGTGGGAGATTATGG + Intergenic
905795231 1:40812266-40812288 TTTTTTTGAGATACAGAGTCTGG + Intronic
905996226 1:42382868-42382890 TTTTTTTGAGACAGAGTTTTGGG + Intronic
907025232 1:51111543-51111565 TTTTTTTGAGACAGAGTCTCAGG + Intronic
907080313 1:51616024-51616046 TTTTTGTGTGAGAGAGAATTTGG + Intronic
907295666 1:53451081-53451103 TTATTTTAAGAGACAGTTTAAGG - Intergenic
907806094 1:57821807-57821829 TTTTTTTAAGAGAGTGAATTTGG + Intronic
908485744 1:64591127-64591149 TCTTTTTGAGAGTGACCTTATGG + Intronic
908693836 1:66814168-66814190 TTTTTTTCAGGGAGATATAATGG - Exonic
909017810 1:70398508-70398530 TTTTTTAAAGACAGAGATTGGGG + Intergenic
909636222 1:77819593-77819615 TTTTTTTGAGAGAGAGGGTCTGG + Intronic
910031768 1:82734507-82734529 TTTTTATGAGAAAGAAATTGAGG + Intergenic
910349552 1:86279814-86279836 TTTTTTTGAGGTAGGGATTTTGG + Intergenic
910885370 1:91958153-91958175 TTTTTTTGAGAACGACATTCAGG + Intronic
911371888 1:97003720-97003742 TTTTTCTGAAAGTGAGATTCTGG - Intergenic
911665313 1:100544548-100544570 TTCTTTGGAGACAGAGCTTATGG - Intergenic
911724067 1:101223055-101223077 ATTTGTTGAGTGAGAGATAAAGG + Intergenic
912065718 1:105739275-105739297 TTGTTTCATGAGAGAGATTATGG + Intergenic
912331737 1:108826424-108826446 TTTTTTTCAAAGATAGTTTAAGG - Intronic
912536045 1:110372011-110372033 TTTTTTTAATATAGAGAATACGG - Intronic
912900784 1:113645736-113645758 TTGTTAGGAGAGGGAGATTATGG - Intronic
913970512 1:143411791-143411813 TTTTTTTGAGATGGAGTTTTAGG - Intergenic
914064886 1:144237402-144237424 TTTTTTTGAGATGGAGTTTTAGG - Intergenic
914114265 1:144728952-144728974 TTTTTTTGAGATGGAGTTTTAGG + Intergenic
914248676 1:145904369-145904391 TTTCTTAGAGAGAGAGAGAAAGG - Intronic
914385744 1:147168195-147168217 TTTTTTTAAGGGAGAGTCTAAGG - Intronic
914399266 1:147301199-147301221 TTTTTTTGATGGAGAGTTTAGGG - Intergenic
914941953 1:152030912-152030934 TTTTTTTAAGAGAGAGAGAATGG - Intergenic
915189183 1:154134435-154134457 TTTTTTTGAGATGGAGTTTCAGG + Intronic
915329269 1:155099744-155099766 TTTTTTTTAGAGACAGAGTTGGG - Intergenic
916093162 1:161325199-161325221 TTTTTTTAAAATAGAGATGAGGG - Intronic
916297917 1:163240525-163240547 ATTTTTTAAGAGAGAGATGGAGG + Intronic
916326999 1:163573602-163573624 TTTTTATGAGAGTCATATTAAGG + Intergenic
916726776 1:167530605-167530627 TTTTTTTTAGTGAGACACTAAGG + Intronic
916752024 1:167731736-167731758 TTTTTTTGAGACACAGTTTTAGG - Intronic
916782483 1:168050051-168050073 TTTTTTTCAGAGAGTAATTTAGG - Intronic
916909305 1:169328192-169328214 TTTTTTGGAGGGGGGGATTATGG + Intronic
917520118 1:175741329-175741351 TTTTTTTCAGAGAAAATTTAAGG + Intronic
917928069 1:179805529-179805551 TTTTTTTGAGACGGAGTTTTGGG - Intronic
918141649 1:181724922-181724944 TTTTGGTGGGAGAGAGATCAGGG + Intronic
918281608 1:183011496-183011518 TATTTGTGAGAGGGAGATTTTGG - Intergenic
918335776 1:183511123-183511145 TTTTTTTGAGAGAGAGAGACTGG - Intronic
918620323 1:186596272-186596294 ATTTTTTGAAAGAAAGATGATGG + Intergenic
918980490 1:191551772-191551794 TATTTTTAACAAAGAGATTATGG - Intergenic
919018809 1:192076681-192076703 TGTTTTTGAGAGATATATAAAGG - Intergenic
919249817 1:195039782-195039804 TTATTTTGAGACAGAGTTTTAGG + Intergenic
919390779 1:196982662-196982684 TTTTTTTGAGAGGGAGTTTCAGG - Intronic
919601114 1:199623632-199623654 TATTGTTGAGAGAAAGATTTAGG - Intergenic
920609962 1:207426361-207426383 TTTTTTTTAGAGACAGGTTTTGG - Intergenic
921105487 1:211972974-211972996 TTTTTTTGAGACAGAGTCTCAGG + Intronic
922135636 1:222822922-222822944 TTCCTTTGGGAGAGAGGTTAAGG - Intergenic
923576456 1:235163003-235163025 TTTTTTTTAAATAGAGATTGGGG + Intronic
923606063 1:235443886-235443908 TTCTTTTGAGTGAAAGTTTAAGG - Intronic
924257366 1:242195748-242195770 TTTCTTGGAGAGAGAGATGAAGG - Intronic
1062982155 10:1734229-1734251 TTTATTTGAGAGAGAAATACAGG + Intronic
1063332122 10:5170357-5170379 TTTTATTAAAAGACAGATTATGG + Intergenic
1063497644 10:6525157-6525179 TTTTTTTGAGGGTAAGAGTAGGG + Intronic
1063659674 10:8026042-8026064 TTTTTTTGAGACAGAGTCTCTGG + Intergenic
1064091167 10:12386457-12386479 TTTTTTTGAGACAGGGTTTTTGG - Intronic
1064827206 10:19418419-19418441 TTTTTTGGAGATTGAGATTAAGG + Intronic
1065063956 10:21939930-21939952 TTTTTTTTTGAGAGAGGTTTGGG - Intronic
1065106346 10:22390430-22390452 TGTTTTTCAGATAGAGATCAAGG + Intronic
1065425656 10:25600479-25600501 TTTTTTAAAGAGAAAAATTATGG + Exonic
1065541724 10:26776583-26776605 TTTTTTTGTGGGGGAGATTGGGG + Intronic
1066616229 10:37297675-37297697 TTTTTATGAGAGACAGAGTCTGG - Intronic
1067019437 10:42782189-42782211 TTTTTTTAAGAGAGAGAGGTAGG + Intergenic
1067415669 10:46099962-46099984 TTTTTTTGAGAAAGAGTCTTAGG - Intergenic
1068089859 10:52420367-52420389 TCTTTTTGAGAAAGGGATTATGG - Intergenic
1068093035 10:52456149-52456171 ATTTACTGAGAGAGAGATAAGGG + Intergenic
1068162544 10:53284326-53284348 TGTTTTAGAGAGAGAATTTAAGG + Intergenic
1068223332 10:54072478-54072500 TTTCTTTGAGAAAGAGAAAAGGG + Intronic
1068335962 10:55632183-55632205 TTTTTGAGAGAGAGAGAGTAAGG - Intergenic
1068431420 10:56936838-56936860 TTTTTTTGGAAGAGACATGAAGG + Intergenic
1068547854 10:58371456-58371478 TTTTTTAAATGGAGAGATTAAGG + Intergenic
1068684295 10:59853853-59853875 TTTTTTTCAGGGAGAGAGGAGGG - Intronic
1068785636 10:60969574-60969596 ATTTATAGAGAGACAGATTATGG + Intronic
1069038658 10:63671896-63671918 TTATTTTTAGGGAGTGATTATGG - Intergenic
1069289569 10:66760984-66761006 TTTTTTTGAGGGAAAGAAGAAGG + Intronic
1069868011 10:71515988-71516010 TTTGTTAGAGAAAGAGACTATGG + Intronic
1069954366 10:72040699-72040721 TTTTTTAAAGAGAGAAACTAAGG - Intergenic
1069998899 10:72361439-72361461 GTTTATTGAGGGAGAGATTTTGG - Intergenic
1070689769 10:78515978-78516000 TTTTCCTGATAGACAGATTAAGG + Intergenic
1070721796 10:78762004-78762026 TTTTCTTGAGAGAGAGTTTATGG - Intergenic
1071447779 10:85764706-85764728 GTTTTTTGAGAGTGACATGAAGG - Intronic
1071777008 10:88800232-88800254 CTTTTTTAGGAGAGAGTTTATGG - Intergenic
1072220614 10:93324789-93324811 TTTTTTTGTGAGACAGAGTCTGG + Intronic
1073224840 10:101909399-101909421 TTTTTTTGAGATAGGGTTTAGGG - Intronic
1073365136 10:102934019-102934041 TTTTTTGGAGAGACAGAGTCTGG + Intronic
1073504128 10:103968664-103968686 TTTTTATGAGACAGCGTTTAGGG + Intronic
1074210472 10:111328537-111328559 TTTTTTTGAGAGCGAGGGAAAGG - Intergenic
1074218079 10:111407651-111407673 TTCTTTTGTGTGACAGATTAGGG - Intergenic
1074739202 10:116468111-116468133 TTTTTTTGCGAGACAGAGTCTGG - Intronic
1074846331 10:117402013-117402035 TTTTTTTTTGAGATAGAGTATGG + Intergenic
1074890592 10:117733531-117733553 TTTTTTTAAGAAAGAGAAAAGGG - Intergenic
1075125705 10:119697350-119697372 TTTTTTTTTGAGACAGATTCTGG + Intergenic
1075266869 10:121008513-121008535 TTTTTTTGTGAGACAGAGTCTGG + Intergenic
1075903131 10:126059173-126059195 TTTTTTTGAAAGAGAAATGATGG + Intronic
1075909956 10:126115760-126115782 TTTTTTTAAGAGTGAAATAAAGG + Intronic
1076047559 10:127306864-127306886 TCTTATCGAGAGAGAGATTATGG - Intronic
1076198589 10:128540061-128540083 TTTTTTTGAGACAGATAAAAGGG - Intergenic
1078964657 11:16324170-16324192 TTGTTTTGAGAGACAGAGTCTGG - Intronic
1079119793 11:17673686-17673708 TGTTTTTGAAAGACAGATTGGGG - Intergenic
1079453888 11:20620660-20620682 TTTTGTAGAGAGAGAGACTGAGG + Intronic
1079745006 11:24115228-24115250 TATTTTTGATAGAGAAAGTAAGG - Intergenic
1079826758 11:25205204-25205226 TTTTTTTGAGAGAGAGAGAAAGG + Intergenic
1080105280 11:28505192-28505214 TTTTTTTAACATAGAGATTCGGG + Intergenic
1080562368 11:33475678-33475700 TTTTTGAGAGAGCGAGATGAGGG - Intergenic
1081035486 11:38139374-38139396 TTTGTTTGAGAGAGAGTAGAGGG - Intergenic
1081289403 11:41306005-41306027 TTTTTTAGAGAAAGAAATAAGGG - Intronic
1081562743 11:44233465-44233487 TTTTTATTAGGGAGAGATTGGGG + Intronic
1082949911 11:58802881-58802903 TTTTTTTGACAGAGTCTTTAGGG - Intergenic
1083132245 11:60635567-60635589 TATTTTTGAGAGAATAATTAAGG + Intergenic
1084098543 11:66929687-66929709 TTTTTTTGAAACAGAGATGGAGG + Intronic
1084130925 11:67133717-67133739 TTTTTTTGAGACAGAGTCTCTGG + Intronic
1084202971 11:67574428-67574450 TTTTTTTAAGAGACAGAGTCTGG + Intergenic
1084300616 11:68248689-68248711 TTTTTTTGAGACAGACACTCAGG - Intergenic
1084782173 11:71417458-71417480 TTTTTTTGAGATAGAGTCTCAGG - Intergenic
1084861164 11:72019170-72019192 TTTTTCTGACAAAGAAATTAAGG - Intronic
1084895788 11:72267007-72267029 TCCTTTTGAGAGAGGGACTAGGG - Intergenic
1085004823 11:73077082-73077104 TTTTTTTGAGACAGAGTCTCAGG - Intronic
1085286408 11:75364585-75364607 TTTTTTTAAGAGAGGGGTTAAGG - Intergenic
1085520523 11:77136543-77136565 TTTTTTTTAGGCAGACATTAGGG - Intronic
1086008303 11:82067092-82067114 TTTTTTTGAGAATGACTTTATGG + Intergenic
1086032782 11:82380236-82380258 TTTTTTTTTGAGATAGATCAAGG - Intergenic
1086230072 11:84557668-84557690 TTTTTCTGAGAGAGATATTTGGG + Intronic
1086810181 11:91300336-91300358 TCTTTTTGATAGAGAGATTCTGG + Intergenic
1086922051 11:92598550-92598572 ATTTTATGAGTGAGAGAGTATGG + Intronic
1087037234 11:93767749-93767771 TTTTTTTTTGAGAGAGGGTATGG + Intronic
1087366430 11:97225603-97225625 TTTTTTTTAGAGAAAGAATCTGG - Intergenic
1087749065 11:101986006-101986028 TTTTTTTGAGACAGAGCTCCAGG + Intronic
1087990189 11:104739953-104739975 TTGTTTGGATAGAAAGATTAAGG + Intergenic
1088351765 11:108897692-108897714 TTTTTTTAAGAGACAGTCTAAGG + Intronic
1088572819 11:111239973-111239995 TTTTATTGAAATAGAGATTTTGG - Intergenic
1089960670 11:122614699-122614721 TTTTTTTGAAAGACAGAGTATGG + Intergenic
1090259935 11:125312292-125312314 TTTTTTTGATAGTGAGCTTCAGG - Intronic
1090652505 11:128819721-128819743 TGTGTGTGAGAGAGAGAATATGG - Intergenic
1090749576 11:129733992-129734014 TTTTGTTGAGTGAGAGATGGAGG - Intergenic
1090931999 11:131306059-131306081 ATTTTTTCAGAGGGAGAATAAGG - Intergenic
1092184737 12:6470531-6470553 TTTTTCTGACAGAGAGAGTGAGG + Exonic
1092186858 12:6486700-6486722 TTTTTTTTAGAGAGAGAGATAGG + Intergenic
1092219297 12:6701696-6701718 TACTTTTGATAGAGACATTAGGG - Intergenic
1092437237 12:8459731-8459753 TTTTTCTCAGGGAGAGATCAGGG + Intronic
1092895730 12:13008483-13008505 TTTTTTTTTGAGAGAGAATGTGG + Intergenic
1093304382 12:17495048-17495070 TATGTTTGAGAGAGAGAGGAAGG - Intergenic
1093366632 12:18308383-18308405 TTTTTTAGAGAGATAATTTATGG - Intronic
1093544378 12:20329037-20329059 TTTTTTTGAGAAACAGTTTCTGG + Intergenic
1093928163 12:24929174-24929196 GTTTATAGAGAGAGAGTTTAGGG - Intronic
1093935196 12:24993377-24993399 TTTTTTTGAGAGAGAGAGAAAGG - Intergenic
1094350909 12:29523715-29523737 TTTTTTTGAAAGAGAGTACAGGG + Intronic
1094633059 12:32197032-32197054 TTTTTTTGAGACAGAGTCTCAGG + Intronic
1095129934 12:38528762-38528784 TTCTAAAGAGAGAGAGATTATGG + Intergenic
1095536892 12:43259904-43259926 TTTATTTGAGAGTCAGATTCAGG + Intergenic
1096435583 12:51588809-51588831 TTTTTTTAAGAGACAGGTTCTGG + Intergenic
1096716940 12:53497318-53497340 TTGCTTTGAGAGAGAGAACAAGG - Intronic
1096986798 12:55764817-55764839 TTTTTTTGTGAGACAGAGTCTGG - Intronic
1097064858 12:56313475-56313497 TTTTTTTGAGATGGAGTTTAGGG - Intronic
1097306158 12:58071405-58071427 GTTTTTGGAGAGAGACATTCTGG + Intergenic
1097482020 12:60140159-60140181 TGTTTTGGAGAGAAAGATCACGG + Intergenic
1098019511 12:66138142-66138164 TTTTTTTTATAGTGAGATAATGG - Exonic
1098040828 12:66352705-66352727 TTTTTTTGAGACAGAGTCTCAGG - Intronic
1098111295 12:67124374-67124396 TTTTTTTTAGAGAGAGAGACAGG - Intergenic
1098278782 12:68841172-68841194 TATTTTGGAGAGAGAAACTAAGG - Exonic
1098429150 12:70400908-70400930 ATTTTCTAAGACAGAGATTATGG - Intronic
1099028870 12:77500065-77500087 TTTTTTTGACAAATAGAATATGG - Intergenic
1100137877 12:91576802-91576824 TGTCTTTGAGAGGGAAATTAAGG + Intergenic
1100664852 12:96739870-96739892 TTTTTTGGAGAAAGTGATTTAGG + Intronic
1100680924 12:96919791-96919813 TTTACGAGAGAGAGAGATTATGG - Intronic
1101254301 12:102962578-102962600 CTTTTTTGAGAGAAAGAGGAGGG + Intergenic
1101587180 12:106095154-106095176 TTTTTTTGAGAGAGAAAGAGTGG - Intronic
1101758980 12:107643767-107643789 TTTTGTTGAGAGAGAGAGAGAGG + Intronic
1102189869 12:110979487-110979509 TTTTTTTGAGAGACAGAGAGTGG - Intergenic
1103010023 12:117450963-117450985 GTTCTCTGAGAGAGAGATTGAGG + Intronic
1104173934 12:126310501-126310523 TTTTATGGACAGAGAGATTAAGG + Intergenic
1104215824 12:126732397-126732419 TTTTTTTCACAGAGAGACTGTGG - Intergenic
1104281544 12:127382635-127382657 TTTTTTTGAGAGAGGGAGTTGGG + Intergenic
1105046054 12:133004495-133004517 TTTTTTTTAGAGACAGAGTCTGG + Intronic
1105260233 13:18773704-18773726 TTTGTTTGAGTGAAAGATGAGGG - Intergenic
1105748159 13:23396310-23396332 TTTTTTTTTGAGACAGATTCTGG - Intronic
1106049397 13:26176293-26176315 TTTTTTTTAGAGAGAGAGACAGG + Intronic
1106181412 13:27372604-27372626 TTGTTTTCAGAGAGAGAGGAAGG - Intergenic
1107035270 13:35895963-35895985 TTTTTGTTAGAGAGAGTTTTAGG - Intronic
1107241699 13:38242928-38242950 TTTTTTAGAGCGAGAGATGTGGG - Intergenic
1107425850 13:40291989-40292011 TGTGTTTGAGAGAGAGAATTTGG - Intergenic
1107620084 13:42218518-42218540 TTTTTTTGAGTCAGAGTTTCTGG + Intronic
1108112469 13:47090431-47090453 TTTTTTTGAGAGAAAGAGGAGGG + Intergenic
1108413127 13:50170403-50170425 TTTGTTTTGGACAGAGATTATGG + Intronic
1108531538 13:51331440-51331462 TCTGCTTGAGGGAGAGATTAGGG - Intergenic
1108723610 13:53157825-53157847 TTTTTTGGTGAGAGAGTTTGAGG + Intergenic
1108895831 13:55326911-55326933 TTTTTTTAAGAGAAAGAAAATGG + Intergenic
1109235137 13:59808879-59808901 TTTTTTGGATAGGAAGATTATGG + Intronic
1109401568 13:61836696-61836718 TTTTTTTAATAGAAAGATGAAGG + Intergenic
1109504207 13:63278172-63278194 TTTTTTTGAAAGAGTCTTTAGGG - Intergenic
1109521433 13:63516026-63516048 TTTTTTACTGAGAGAAATTAGGG + Intergenic
1109769824 13:66956070-66956092 TTTTTTTGAGATGGAGTTTCTGG - Intronic
1109770483 13:66964826-66964848 TTTTTTTGACTGAGAGATCTGGG + Intronic
1109856437 13:68134309-68134331 TTTTTTTAACTGAGTGATTAGGG + Intergenic
1110093265 13:71482132-71482154 TTTTTCTGAGTGAGACATAATGG + Intronic
1110377172 13:74806469-74806491 TTTTTTTGAGAGACAGCTCTTGG + Intergenic
1110557672 13:76878533-76878555 GATTTTTGAGAGATAGTTTAGGG - Intergenic
1110735974 13:78937007-78937029 TTTTTTTAAGAGATAAATAAGGG - Intergenic
1110835478 13:80077201-80077223 TTTTTTTGAGAAAGTTATCAGGG + Intergenic
1110913565 13:80993592-80993614 TAGTTTTGAGAGAGACCTTATGG + Intergenic
1110998727 13:82149183-82149205 TTTGTTTGATAGAGAAATTAAGG + Intergenic
1111229297 13:85321303-85321325 TTTTTTTCAGAAAGCTATTATGG + Intergenic
1111457146 13:88499708-88499730 TTTTTTTTTGAGAGAGAGTCTGG - Intergenic
1111562512 13:89969588-89969610 TTTGGTTGAGACAGAAATTATGG - Intergenic
1111740124 13:92194345-92194367 TTTTTATGAGGGAGAGCCTATGG - Intronic
1111760179 13:92453671-92453693 TTTTTTCGTAAGAGAGATTAGGG - Intronic
1112299748 13:98219175-98219197 TTTTTCTGAGATGGAGCTTATGG - Intronic
1112412394 13:99175768-99175790 ATTTTTTTTGAGAGAGATTCGGG - Intergenic
1112757858 13:102659154-102659176 TGTTTTTGAGAGAGCCCTTAAGG - Intronic
1114239581 14:20854087-20854109 TTCTTCCGAGAGAGAGATTTTGG - Intergenic
1114346491 14:21801091-21801113 TTATTTTGAGAGAGGGATGAAGG - Intergenic
1114514858 14:23292306-23292328 TTTTTTTGAGAGAGAGAGACAGG - Intronic
1114748381 14:25175281-25175303 ATTTGTTTAAAGAGAGATTAAGG - Intergenic
1114774611 14:25466913-25466935 TTTTTTTGGGTAAGAGATAATGG + Intergenic
1114844391 14:26303495-26303517 ATATTTTGAGAGAGAGATTATGG - Intergenic
1115184535 14:30670426-30670448 ATTTTTTTAAAGAGAAATTAAGG + Intronic
1115811273 14:37110896-37110918 TTTTTTAGAGCGATAGAATAAGG - Intronic
1115991899 14:39158527-39158549 TTTTTTTTTGAGACAGATTCTGG + Intronic
1116004569 14:39278584-39278606 ATTATTTGAGAGAGAGGTTAAGG + Intronic
1116125335 14:40776929-40776951 TTTTATTAAGTGAGAGATGAGGG + Intergenic
1116247993 14:42442291-42442313 TTTTTTTTGGAGTGAGAATATGG - Intergenic
1116800971 14:49442797-49442819 TTTTTTTGAGACAGACATTTTGG - Intergenic
1116913169 14:50493006-50493028 TTTTTTTGAGACAGAGTCTCAGG - Intronic
1116940724 14:50788429-50788451 TTTTCTTGAGTGGGAGATGAAGG + Intronic
1117087740 14:52218980-52219002 TTTTTTTGAGAGAGGGTCTTAGG - Intergenic
1117262376 14:54049054-54049076 TTTTTTTCAAAGAAAGACTATGG + Intergenic
1117332090 14:54723060-54723082 TTTCGTTCAGAGAGACATTATGG + Intronic
1117423054 14:55566620-55566642 TTTTTTTTTGAGACAGACTAGGG + Intronic
1117577247 14:57111779-57111801 TTTTTTTTAATGAAAGATTAAGG + Intergenic
1117926418 14:60784349-60784371 TTTTTTTTAAATAGAGATGAGGG + Intronic
1117992229 14:61445342-61445364 TCTTTATGTGAGAGAGAATAAGG + Intronic
1118174792 14:63427605-63427627 TTTTTTTAATAGAGAGATGGGGG - Intronic
1118253911 14:64188477-64188499 TTTTTTTGAGGGAGAGAAGGGGG + Intronic
1118411494 14:65483727-65483749 TTTTTTTGAGACAGAGTTATTGG + Intronic
1118781240 14:69009306-69009328 TTTTTTTGAGACAGAGTCTCCGG - Intergenic
1119507431 14:75185120-75185142 TTTTTTTGAGAGGGACTTTCAGG - Intergenic
1120226155 14:81793287-81793309 TTTTTTTTAGAGAGAGAGATAGG + Intergenic
1120264991 14:82237242-82237264 TTTTTTTTTGAGACAGATTCTGG - Intergenic
1120595743 14:86433087-86433109 GTTTTCTGAGAGGGAGATAAAGG - Intergenic
1120623108 14:86790715-86790737 TTTTCTGGAGGGAGAGATGAGGG - Intergenic
1120740227 14:88100508-88100530 TTTTTTTTTGAGAGAGAGTCTGG - Intergenic
1121170518 14:91850167-91850189 TTTTTTTAGGAAAGAGATTGAGG - Intronic
1121373506 14:93383176-93383198 TAATTTTGTGAGAGAGATTGTGG + Intronic
1122079839 14:99258898-99258920 TTTTTGTGGGGGAGAGAGTAGGG + Intronic
1122294232 14:100696142-100696164 TTTTGTTCAGAGAGAGTTGAGGG - Intergenic
1124402709 15:29364052-29364074 TTTTTTTGAGAGAAGAAATATGG + Intronic
1125247096 15:37653077-37653099 TTATATTCACAGAGAGATTATGG - Intergenic
1125620514 15:41057446-41057468 TTTTTTTGAGACAGGGGATAGGG - Intronic
1125694481 15:41623785-41623807 TTTTTTTGAGAGGGAGTTTCGGG + Intronic
1125915274 15:43481513-43481535 TTTTTTTAAGAGACAGAGTCTGG + Intronic
1126336974 15:47596040-47596062 TTTTTTTGATAGGGTGTTTAGGG - Intronic
1126482178 15:49136977-49136999 TTTTTTTGAGAGAGAGGGTATGG - Intronic
1126621033 15:50640275-50640297 TTTTTTTGAGGGAGGGAGTCAGG + Intronic
1126782412 15:52150061-52150083 TTTTTTTCATGGATAGATTAGGG - Intronic
1126839040 15:52697986-52698008 TTTTTTTGTGAGACAGAGTCTGG + Intronic
1127169617 15:56287139-56287161 TCTTTTTTATAGAAAGATTATGG + Intronic
1127231870 15:57005375-57005397 TTTTTGTGAGAGGTAGCTTAAGG + Intronic
1127255505 15:57288895-57288917 TTTTTTTGTGAGAAAGGGTATGG - Intronic
1128486431 15:68095123-68095145 TTTTTTTAATTGAGAGATTAAGG + Intronic
1129049566 15:72768960-72768982 TTTTTTTGAGAGACAGGATCTGG - Intronic
1129374868 15:75123359-75123381 TTTTTTAGAGAGAGAGAGATGGG + Intergenic
1129440056 15:75574995-75575017 TTTTTTTGAGACAGAGGAGACGG + Intronic
1129655571 15:77522916-77522938 TTTGTTTGAGAGAGAGAGACAGG + Intergenic
1129915879 15:79270826-79270848 TTGTTTGGAGAGGGAGTTTAAGG + Intergenic
1129962022 15:79695736-79695758 TTTTATTGAGGAAGAAATTAAGG + Intergenic
1130818195 15:87463716-87463738 TTTTTTTCAAAGAGACAATAAGG + Intergenic
1130933924 15:88452892-88452914 TTTTTTAAAGAGAGAGATTTGGG - Intergenic
1131161128 15:90105558-90105580 TTTTTTTAAAATAGAGATTAAGG - Intergenic
1131296741 15:91155945-91155967 TTTCTTGGAAAGAGAGAATATGG - Intronic
1131323800 15:91422952-91422974 TTTTTATGAGGTAGAGATTGTGG + Intergenic
1131985391 15:98038582-98038604 TTTTTTTGAGAGAGAGAGATAGG + Intergenic
1132267763 15:100491067-100491089 CTGTTTTGAGAGACAGATTTTGG - Intronic
1132490376 16:225783-225805 TTTTTTTGAGACAGAATTTCAGG - Intronic
1133278147 16:4650302-4650324 TTTTTTTGAGACAGAGTCTCAGG - Intronic
1133662447 16:7931926-7931948 TTTGTGTGAGAGAGAGAAGAAGG - Intergenic
1134412179 16:14012240-14012262 TTTTTTTGAGACAGAGTCTCGGG + Intergenic
1134771679 16:16814722-16814744 CTTTTTTGAGGGAGAGCTTTTGG + Intergenic
1136669274 16:31841053-31841075 TTTTTTTGGTAGAGACTTTAGGG - Intergenic
1137012474 16:35336496-35336518 TATTTTTCAGAGACAGACTATGG - Intergenic
1137038422 16:35587555-35587577 TTTTTTTTTGAGAGAGGGTAGGG + Intergenic
1137233619 16:46593730-46593752 TTTTTTTGAGATAGGGACTAGGG - Intronic
1137390511 16:48077316-48077338 TTTTTTAGAAAGAGAAATTGTGG - Intergenic
1137845937 16:51688164-51688186 ATTTTTTGAGAGAGAGAAAGAGG + Intergenic
1138318837 16:56093763-56093785 TCTTTTTGAGAGACAGATCTCGG - Intergenic
1138869150 16:60860007-60860029 TTTTTTTCAGAGTGGGATTTAGG + Intergenic
1139127833 16:64102045-64102067 TATGTATGAGAGAGAGATGAAGG - Intergenic
1139769138 16:69259076-69259098 TTTTTTAGACATAGAAATTAAGG + Intronic
1139922690 16:70469854-70469876 TTTTTTTTTGAGACAGAGTATGG + Intronic
1140015441 16:71177881-71177903 TTTTCTTTAGAGATAAATTAGGG - Intronic
1140427393 16:74872552-74872574 TTTTTTTTAGAGAGAGAGACAGG - Exonic
1140600976 16:76474477-76474499 TTTATCTGAAAGAGATATTATGG - Intronic
1140842149 16:78849560-78849582 TTTTTTTTTGAGAGGGATTCAGG - Intronic
1140867423 16:79075834-79075856 TTTTTTTGAGATAGTTATAAGGG - Intronic
1141145347 16:81525527-81525549 TTTTTTTAAGAGACAGAGTATGG + Intronic
1141535276 16:84675054-84675076 TTTTTTTAAGAGATAGAGTCAGG + Intergenic
1142515160 17:422924-422946 TTTTTTGTAGAGACAGATTCTGG - Intronic
1143161857 17:4877183-4877205 TTTTTTTGAGAGAAAGAAATTGG - Intronic
1143663158 17:8339746-8339768 TTTTTTTTAGAGAGAGAGACAGG - Intergenic
1144037680 17:11382068-11382090 TTTTTTAGAGAGAGAGAGAGAGG + Intronic
1144175202 17:12698752-12698774 TTTTTTTGTGAGACAGAGTCTGG + Intronic
1145315394 17:21728429-21728451 TTTTTTTTAGAGACAGAGTCTGG + Intergenic
1146972522 17:37084339-37084361 TTTTTTAGAGAGAGAAACTGAGG + Intergenic
1146981622 17:37167283-37167305 TTTTTTTGAGACAGAGTCTCAGG + Intronic
1147022834 17:37551814-37551836 TTTGTTTGATAGAGTGATTGTGG - Intronic
1147127492 17:38381931-38381953 TTTTTTTGAGACAGAGTCTTTGG - Intronic
1147524731 17:41211443-41211465 TTTTTTTGAAAAAGAAATTTTGG - Intronic
1147640353 17:41994030-41994052 TTTTTTTTTGAGAGAGAGTTTGG - Intronic
1147693307 17:42332225-42332247 TTTTTTAAAGAGAGAGATAGGGG - Intronic
1148153256 17:45408890-45408912 TTTTCTTGAGAGCAAGACTAAGG + Intronic
1149050609 17:52300102-52300124 TTTTTTTGAAGAAGAAATTAAGG - Intergenic
1149429374 17:56585119-56585141 TTTTATAGATAGAGAGATTGAGG - Intergenic
1149837086 17:59922842-59922864 TTTTTTTAAAAGAGAGTATAGGG - Intronic
1150341545 17:64372234-64372256 TCTTTTTTAAATAGAGATTAGGG - Intronic
1150615569 17:66768257-66768279 TTTTTGGGGGGGAGAGATTAGGG + Intronic
1150909478 17:69372910-69372932 TTTTTTTAAAAGAGAGATCCAGG + Intergenic
1151295027 17:73178879-73178901 TTGTTTTGAAAGACAGATCAAGG - Intergenic
1151594580 17:75069566-75069588 TTTTTTTAAGAGACAGGTTCTGG - Intergenic
1151685330 17:75643007-75643029 TTATTTTGAGACAGAGTTTGGGG - Intronic
1151774022 17:76186106-76186128 TATTTTTGAAATAGAGAGTAGGG - Intronic
1152162181 17:78675616-78675638 TTTTTTTAAGAGAGAACGTAGGG - Exonic
1152439870 17:80300274-80300296 TTTTTTTAAGAGACAGAGTCTGG + Intronic
1152679540 17:81659167-81659189 TTTTTTTGAGAGACAGGATCTGG + Intronic
1152983211 18:298161-298183 TTTATTTGAGAGAAAGAAAATGG - Intergenic
1153714915 18:7838497-7838519 GTTTTTTGGGAGATAAATTAAGG - Intronic
1155068932 18:22295895-22295917 TTTGGAAGAGAGAGAGATTAAGG - Intergenic
1156061082 18:33077041-33077063 ACTTTTTGAGAGAGAGTTTATGG - Intronic
1156067104 18:33156626-33156648 TTTTTTTGAGAGGGAGGATTAGG - Intronic
1156774783 18:40773702-40773724 TTTTTTTTAGAGAGAGAGAGAGG + Intergenic
1156778344 18:40821053-40821075 TATTTCTGAAAGAGACATTAAGG - Intergenic
1156810662 18:41246059-41246081 TTATATAGAGAGATAGATTATGG - Intergenic
1156919073 18:42497321-42497343 TGTTTTAAAGAGAGAGATTGAGG - Intergenic
1157261471 18:46178878-46178900 TTTTTTTGAGAAAGAGTCTCAGG - Intronic
1157825316 18:50806910-50806932 TTCTTTAGAGGGAGAGATTGGGG - Intronic
1157924689 18:51750574-51750596 TTTGTTTCAGTGAGAGATTTTGG + Intergenic
1158365975 18:56736445-56736467 TATTATTGAGAGACAGAGTATGG + Intronic
1158420644 18:57290506-57290528 TTTTTTTGAGTGATATATTTTGG - Intergenic
1159079897 18:63725118-63725140 CTTTTTTGAGAGAAAGAATTTGG + Intronic
1159245894 18:65804725-65804747 TATTTATGAGAGAGAGAAAAAGG + Intronic
1159346191 18:67208599-67208621 TTTTGTTGTGACAGTGATTATGG + Intergenic
1159648095 18:70943404-70943426 TTCTTTTAAGAGAGAGAATCAGG + Intergenic
1159907646 18:74111246-74111268 TTTTTTTGAGACAGAGACTCAGG - Intronic
1160177621 18:76608810-76608832 TTTTTTTGAAAGAGAGATGGTGG + Intergenic
1161359080 19:3836309-3836331 TTTTTTTTAAAGAGAAAATACGG - Intronic
1161478052 19:4497203-4497225 TTTTTTTGAGACAGAGTCTTGGG + Intronic
1162407973 19:10487022-10487044 TTTTTTTTAGTAAGAGACTAAGG - Intronic
1162472062 19:10878186-10878208 AGTTTTTGAGAGATTGATTAGGG + Intronic
1163057292 19:14729967-14729989 TTGTCTTGAGAGAAAGATTTTGG + Intronic
1163696491 19:18766437-18766459 TTTTTTTAAAAAAGGGATTACGG - Intronic
1163756088 19:19106919-19106941 TTTTTTTGAGAGACAGAGTCTGG - Intronic
1165211711 19:34241232-34241254 ATTTTTTGAGAGAGAGGGTCTGG + Intergenic
1165285027 19:34834481-34834503 TTTTTTTTAAAGAGAGATGGGGG - Intergenic
1165669229 19:37661339-37661361 TTTTTTTGAGAGAGAGAGAGAGG - Intronic
1165783591 19:38447922-38447944 GGTTTTTGAGGGAGAGATTGGGG + Intronic
1166994447 19:46713622-46713644 TTTTTTTCAGAGGGAGAGAAAGG + Intronic
1167133837 19:47605147-47605169 TTTTTTTGAGACAGAGTCTTGGG + Intergenic
1167279745 19:48559945-48559967 TTTTTTTTAAAGAGAGATGAGGG - Intronic
1167494634 19:49810354-49810376 TTTTTTTAAGAGATGGACTAGGG - Intronic
1167553917 19:50180771-50180793 TTTTTTTAAAATAGAGATGAGGG + Intergenic
1167942509 19:52958996-52959018 TGTTTCTGAGAGAGAAAATACGG + Intronic
1168360337 19:55734348-55734370 TTTTTTTGAGATAGAGTGTCAGG - Intronic
925378257 2:3404428-3404450 TTTTTTTGGGAAAAAGATCAGGG - Intronic
925494383 2:4429758-4429780 TAATTTTGAGTGAGAGATTGTGG - Intergenic
925547395 2:5031974-5031996 TTCTGTTGAGAGAGAGATTGAGG - Intergenic
925554261 2:5111940-5111962 TTTATTTAAGCAAGAGATTATGG - Intergenic
925584655 2:5452460-5452482 TTTATGTGGGAGAGAGATTGGGG - Intergenic
925683949 2:6452856-6452878 TTTTGTAGAGAGAGAGTTTCAGG - Intergenic
925769195 2:7265787-7265809 TTTTCTTGAGGGAGAAATTGAGG - Intergenic
926322350 2:11757706-11757728 TTTCTTTGAAAGAGAGCTTGGGG - Intronic
926365306 2:12127797-12127819 TTTTTTTAAGAAAGAGAAAAGGG - Intergenic
926664215 2:15502193-15502215 TTTTATTGATGAAGAGATTAAGG - Intronic
927278958 2:21286970-21286992 TTTTTTTGAGAGAGATGCTGAGG - Intergenic
927700371 2:25264477-25264499 TTTTTTTGTGAGACAGAGTCTGG + Intronic
928389158 2:30895786-30895808 TTTCTTTGAGAGAGAGAGCAGGG - Intergenic
928807607 2:35179530-35179552 TTTTTCTTATAGAGAGAATATGG + Intergenic
929206713 2:39304158-39304180 TTTTTTTGAGAGAGCACTTTTGG + Intronic
929309370 2:40404604-40404626 ATTTATTAAGAGAGAGAATATGG + Intronic
929351456 2:40960951-40960973 TTTTTTTGAGAGAGTGAGAAAGG + Intergenic
929615199 2:43301277-43301299 TTTATTTGAAAGAGAAATTGGGG - Intronic
929762533 2:44817842-44817864 GTTCTTGGAGAGAGAGATTGGGG - Intergenic
930235938 2:48889043-48889065 TTCTTTTGAGAGAGAGGTTAGGG - Intergenic
930506958 2:52294647-52294669 CTTTTTTGGGAGAAAGAGTAGGG - Intergenic
930645343 2:53900384-53900406 TTTTTTTGAGAGAGAGACAGGGG - Intronic
930749434 2:54918808-54918830 TTTATTAGAAGGAGAGATTAAGG - Intronic
930887025 2:56337794-56337816 TTTTTTTTTGAGACAGAGTATGG + Intronic
931323890 2:61198568-61198590 TTTTTTTAAGAGAGAGAAATAGG + Intronic
931725210 2:65103286-65103308 TTTTTTTTTGAGACAGATTCTGG - Intronic
931784507 2:65607359-65607381 CTTTTTTGAGAGATAAATTTTGG - Intergenic
932547119 2:72724852-72724874 TTTATTTGAGATAGATTTTATGG - Intronic
932727328 2:74190617-74190639 TTTTTTTTAGACAGAGATTGAGG - Intergenic
933043744 2:77506658-77506680 TATTTTTGAGAGAGCAATTTTGG + Intronic
933518236 2:83333053-83333075 TTTTTTTGTGGGAGAGGTGAGGG + Intergenic
933672671 2:85023718-85023740 TTTATTTAAGAGTGAAATTACGG + Intronic
933681694 2:85107415-85107437 TTTTTTTTTGAGAGAGAGTCTGG - Intergenic
933967756 2:87443808-87443830 TGTTTTTGAGGGAGTCATTAGGG + Intergenic
934080011 2:88459739-88459761 TTTTTTTGTGAGATAGAGTCTGG + Intergenic
934110478 2:88737763-88737785 TTTTTTTGAGAGAGAGAGAGAGG - Intronic
934175205 2:89572717-89572739 TTTTTTTGAGATGGAGTTTTAGG - Intergenic
934285521 2:91647071-91647093 TTTTTTTGAGATGGAGTTTTAGG - Intergenic
934647910 2:96069907-96069929 CTTTTTTGAGATAGAGTTTTAGG + Intergenic
934841282 2:97625728-97625750 CTTTTTTGAGATAGAGTTTTAGG + Intergenic
935305735 2:101734731-101734753 TCTTCTTGAGAGAGAGATTGCGG + Intronic
935347463 2:102121685-102121707 CTTTGTTGAGAGAGAGAAAATGG - Intronic
935665392 2:105507846-105507868 TTTTTTTGAGACAGAGTCTTGGG + Intergenic
936326044 2:111506688-111506710 TGTTTTTGAGGGAGTCATTAGGG - Intergenic
936604933 2:113941752-113941774 TTTGTTTCAGATAGATATTAAGG + Intronic
937111536 2:119370463-119370485 TTTTTTTAAAAGAGAAATTTTGG + Intronic
938240400 2:129738576-129738598 TAATTTTAAGAGAGAAATTAAGG + Intergenic
938998798 2:136709384-136709406 TTTTTTTTAGAGAGAGAGACAGG - Intergenic
939127627 2:138196215-138196237 TGTTTTAGATAAAGAGATTAAGG - Intergenic
939518943 2:143204925-143204947 TTTTTTTTTAAGAGAGATTAGGG - Intronic
939550929 2:143614692-143614714 TTTCTTTGAGACAGAGATAGAGG + Intronic
939580640 2:143941661-143941683 TTTTTTTGAGAGAGAGAGTCTGG - Exonic
939702955 2:145416968-145416990 TTTTTTTGTGTGAGATTTTATGG + Intergenic
939826762 2:147024586-147024608 TTTTTTTGAAAGAGGGACAAGGG + Intergenic
940566678 2:155371851-155371873 TTTATTTTAGAGCAAGATTAGGG - Intergenic
941135465 2:161712050-161712072 CTTATTTGATAAAGAGATTAAGG - Intronic
941155892 2:161977599-161977621 TTTTTGTTAGAGAGTGATTGAGG + Intronic
941505996 2:166346195-166346217 TCTTTTTGAGAAATTGATTAAGG - Intronic
941830213 2:169949435-169949457 TATATTTGAGAGAGAGGTCAAGG + Intronic
943112875 2:183627713-183627735 TTGTTTTGTGATATAGATTAGGG - Intergenic
943160326 2:184241484-184241506 TTTTTTTGAAATAAAGATTAGGG + Intergenic
943169514 2:184379383-184379405 GTTTTTTTAGAGAAATATTAAGG + Intergenic
943201637 2:184834565-184834587 TCTTTCTGAGAGAGAGAGAAAGG - Intronic
943496778 2:188630243-188630265 TTTTTTGTTGAGACAGATTAAGG - Intergenic
943590240 2:189787045-189787067 TTTTTTTGAGACAGAGTTTCAGG - Intronic
943958253 2:194222057-194222079 TTTTTTTTTGTTAGAGATTAAGG - Intergenic
944119248 2:196223343-196223365 TTTCTTTGACTGAGAGATTCAGG + Intronic
944631187 2:201626479-201626501 CTTTTTTGAGAGAGTGGCTAGGG - Intronic
945411237 2:209510904-209510926 TTTTCTTGAGAAAGAGGTTGAGG + Intronic
945688924 2:213008268-213008290 TTTTTTTGAGACAGAGTCTCAGG + Intronic
946342944 2:219083595-219083617 TTATTTTGAGAGAGAGAGGAGGG + Intronic
946683179 2:222239332-222239354 TTTTTTTCAGAGAGAGAAGGAGG + Intronic
946736894 2:222762994-222763016 TTTTTTTAAGAGACAGAGTTAGG + Intergenic
946918943 2:224558164-224558186 TTTTGGTGGGAGAGAGATAAGGG - Intronic
947173346 2:227335156-227335178 TTTTTTTGAGAGACAGAGTCTGG - Intronic
947332291 2:229042948-229042970 TTTTTGAGAGAGAGAGAGAAAGG + Intronic
947413845 2:229872254-229872276 TTTTTTTAAAAGAGAGATGGGGG - Intronic
947830269 2:233134644-233134666 TTTTCCAGAGAGAGAGAATAAGG + Intronic
948744568 2:240078724-240078746 TTTTTTTGAGAGAGAGAGACAGG - Intergenic
1169103088 20:2969197-2969219 TTTTTTTGAGATAGAGTCTCGGG - Intronic
1169127845 20:3143117-3143139 TTTTTTTGAGACAGAGTCTCTGG + Intronic
1169238945 20:3958298-3958320 TTTTTGTAAGATAGAGATTTTGG - Intronic
1169441239 20:5635651-5635673 TTTTTTTTAGAGACAGAGTCTGG - Intergenic
1169660695 20:7975447-7975469 TTTTTTTGAGGGAGGGATGGAGG - Intergenic
1169806226 20:9562148-9562170 TCTTTCTGAGAGAGACATTTAGG + Intronic
1169981270 20:11387190-11387212 TTTTTAGGAGAAAGAGCTTAAGG + Intergenic
1170058662 20:12235777-12235799 GTTTTTTGAGAGAGCGACAAAGG + Intergenic
1170175567 20:13465163-13465185 TTTTTTTGGGAGAGAGAAAGGGG - Intronic
1170431993 20:16284337-16284359 TTGTTTTGAAAGAAAGCTTATGG - Intronic
1170485782 20:16815053-16815075 TCTTTCTGAGAGAGAATTTATGG - Intergenic
1170631265 20:18068066-18068088 TTTTTTTGAGAAAGTAATAAGGG - Intergenic
1171145909 20:22782325-22782347 TTTTTCTGAGACAGAAATGAGGG + Intergenic
1171218067 20:23366844-23366866 TTATTTTGGGATGGAGATTATGG + Intronic
1172144296 20:32745355-32745377 TTTTTTTTTGAGACAGATTCTGG + Intergenic
1172536141 20:35674879-35674901 TTGTTCTGAGGGAGACATTATGG - Intronic
1172740551 20:37163211-37163233 TTTTTTTGTGAGACAGAGTCTGG + Intronic
1172749220 20:37238140-37238162 TTTTATGGGGAGAGAGACTATGG + Intronic
1173081208 20:39869757-39869779 TTCTTTGGGTAGAGAGATTATGG + Intergenic
1174953695 20:55072205-55072227 TTTTTTAAAGAGAGAGTTTTGGG + Intergenic
1174969699 20:55260831-55260853 TTTCTCTGAGAGTGAGAATATGG - Intergenic
1177032209 21:15994943-15994965 CTTCTTTGAGAAAGAGAATATGG - Intergenic
1177659527 21:24064859-24064881 TTTTTTCGAGACAGAGTGTAGGG + Intergenic
1177662066 21:24097621-24097643 TTTTTATGGGAGATAAATTATGG - Intergenic
1177788131 21:25694658-25694680 TTTTTTAGAGAGAGCGATATAGG - Intronic
1177991072 21:28037140-28037162 TCTTTTTGAGAGACAGCTTGTGG - Intergenic
1178073011 21:28989962-28989984 TTTTTTTGAGACAGAGTCTCGGG - Intronic
1178145346 21:29733498-29733520 TTTTTTTGAAAAAAAAATTAGGG - Intronic
1178336768 21:31750300-31750322 CTTTTTTGAGAGAGAGAGACAGG + Intergenic
1178625637 21:34215995-34216017 TTTGTTTGCGACAGAGATTTGGG + Intergenic
1178854947 21:36242729-36242751 TTTTTTTCAGAGAAAGAAAATGG - Intronic
1179053243 21:37907343-37907365 TTTTTTTTATAGAGAAATGATGG + Intronic
1179148108 21:38786735-38786757 TCTTATTGTGAGAGAGATAAGGG + Intergenic
1179980419 21:44892854-44892876 TTTTTTTGACAGAAACATTAAGG - Intronic
1180653291 22:17397146-17397168 TATTTTTGTGAGACAGATTCTGG + Intronic
1180837466 22:18937340-18937362 TTTTTTTTAAAGAAAGATTCCGG + Intergenic
1182674653 22:32029355-32029377 TTTTTTTTAGAGAGAGAGATGGG + Intergenic
1182737467 22:32541276-32541298 TGTCTTTGAGAGAGAAATTTGGG - Intronic
1182781604 22:32872951-32872973 TTTTTTTGAGAGACAGAGTCTGG + Intronic
1182967333 22:34534526-34534548 TTTTTTTAATTGAGAGCTTAAGG - Intergenic
1183278652 22:36919424-36919446 TTTTTTTGAGACAGAGTCTCAGG + Intronic
1183564745 22:38605876-38605898 TTTTTTTGAGGGAGAAATGGAGG - Intronic
1183865049 22:40697620-40697642 TTTTTTTGAGAGAGAGATACTGG - Intergenic
1183905817 22:41039432-41039454 TTTTTTTTAGAGAGAGACAGGGG - Intergenic
1185359789 22:50398944-50398966 TTTTTTTGAGAAATAGAATAGGG + Intronic
1203287559 22_KI270734v1_random:162639-162661 TTTTTTTTAAAGAAAGATTCCGG + Intergenic
949233071 3:1774255-1774277 TTTTTTTGAGAGACAGAGAGAGG - Intergenic
949300278 3:2575831-2575853 TTTTTTTGTGAGAGAGAGTCTGG + Intronic
951320385 3:21237359-21237381 TTTTATTTAGAAAGAGAATAGGG + Intergenic
951607329 3:24450738-24450760 TTTTTTTGAGAGAGAGATTAAGG + Intronic
951731270 3:25813046-25813068 TTTTTTTGAGACAGAGTCTCGGG + Intergenic
951783844 3:26396303-26396325 TTTTTTTGAGAGAAAGAATGGGG + Intergenic
951835478 3:26978431-26978453 TTTTTTTAAGAGACAGAGTCTGG - Intergenic
951966876 3:28397115-28397137 TTTTTTTTTGAGACAGAGTATGG - Intronic
952046930 3:29333160-29333182 TTTATATCAGAGAGAAATTAAGG + Intronic
952495986 3:33916163-33916185 TTTTGTGGAGTGAGAGATTTGGG + Intergenic
952681373 3:36097384-36097406 TTCTTTTCAAAGAGAGATTATGG - Intergenic
952782878 3:37120885-37120907 CTTTTTTAAGACAGAAATTAGGG + Intronic
952793614 3:37219684-37219706 TTTTTTTGAGACAGAGTCTCAGG + Intergenic
953649570 3:44789440-44789462 TTTTTTTGAGACATAATTTATGG + Intronic
953949744 3:47179954-47179976 TTTTTTTTAGAGATAGAGTCTGG + Intergenic
954046316 3:47934216-47934238 TTTTTTTAAAAAAGTGATTAGGG + Intronic
954273747 3:49529203-49529225 TTTTTTTGAAATAGAGATGGGGG + Intronic
955777759 3:62451594-62451616 TTTTTTTTTGTGAGAGATCATGG - Intronic
956071104 3:65452714-65452736 TTCTTTTGAGACAGAGGTTGAGG - Intronic
956099612 3:65753682-65753704 TTTTTTTGAGATGGAGTTTGTGG - Intronic
956603155 3:71044947-71044969 TTTTTTTATCAGAGAGATGATGG - Intronic
957130088 3:76213155-76213177 TTATCTTGAGAGAGAGATTTTGG + Intronic
957490969 3:80926598-80926620 TTTTTTTGAAAGAGGGAATCTGG - Intergenic
957553885 3:81740913-81740935 TGTGTATGAGAGAGAGATTTTGG - Intronic
957974148 3:87421463-87421485 TTTTTTTGAGAAAGAGAGAAAGG + Intergenic
958110237 3:89132876-89132898 TCTTTTTGAGAGACAGAGTCTGG - Intronic
958680215 3:97320489-97320511 TTTTCTTGAGAGAGGGAATGAGG + Intronic
958684539 3:97376568-97376590 TTTTTCTGAAAGAGAGCTTTTGG + Intronic
959067680 3:101675052-101675074 TTTTTTGGAGACAGAGCGTAGGG - Intronic
959133750 3:102391127-102391149 TTCTTTGGAGAGAGAGCTTATGG + Intronic
959216761 3:103460116-103460138 TTTTTTTGTGAAAGAAAGTAAGG - Intergenic
959612833 3:108314326-108314348 TTTTTTTAAGAGACAGTATAGGG - Intronic
959660459 3:108862671-108862693 TTTTTTTAACACAGAGATGAAGG + Intergenic
960117881 3:113915376-113915398 TTCTTTTGAGTGACATATTATGG + Intronic
960562210 3:119097203-119097225 TTTTTTTGAGAAACGTATTATGG - Intronic
961185358 3:124910361-124910383 TTTTTTTTATAGAGAGATGGGGG - Intronic
961258959 3:125583990-125584012 TTTTTTTGAGACAGAGTCTGGGG - Intronic
961860239 3:129911201-129911223 TTTTTTTGAGATGGAGTTTGTGG - Intergenic
962017107 3:131453107-131453129 TTTTTTTGAGAGAGGGTCAAAGG + Intergenic
962555900 3:136551174-136551196 TTTTTTTGAGAGAGAGAGAGAGG + Intronic
963674328 3:148289575-148289597 TTGTTTTATGAGAGACATTATGG + Intergenic
963841190 3:150108043-150108065 TTTTATCCACAGAGAGATTAGGG - Intergenic
964351569 3:155808231-155808253 TTTATTTGAAATAGTGATTATGG - Intergenic
964683435 3:159367383-159367405 TTTTTTTGAGATGGAGTTTTTGG - Intronic
964832807 3:160904430-160904452 ATTTTTGGACAGAGGGATTATGG + Intronic
964954483 3:162335259-162335281 TATTTTTGAGAGAGAGAAAAAGG + Intergenic
965126535 3:164637888-164637910 TTTTTTTGAGGCAGAAATTCTGG - Intergenic
965230587 3:166046704-166046726 TAATTTTGAGAGGGAGAATATGG + Intergenic
965422438 3:168478650-168478672 TTTTCTTGAGATAACGATTATGG - Intergenic
965564752 3:170103131-170103153 TTATATTGAGAGATATATTATGG - Intronic
965791168 3:172389307-172389329 TTTTTTAGAGTAACAGATTAAGG - Intronic
966039951 3:175471183-175471205 CTTTTTTAAGAAAGAAATTATGG + Intronic
966685931 3:182695587-182695609 TTTTTTTTAGAGAGAGAGATGGG + Intergenic
966857927 3:184208350-184208372 TTTTTTTGAGACAGGGAGTGCGG - Intronic
967034113 3:185634891-185634913 TTTTTTTGAGACAGAGTCTCAGG - Intergenic
967075040 3:185994327-185994349 TTTTTTTTTGAGAGAAAGTATGG + Intergenic
967474507 3:189901023-189901045 TTTTTCTGTGAAAGAAATTATGG + Intergenic
967511198 3:190314702-190314724 TACTTTTTAGAAAGAGATTATGG - Intronic
968164980 3:196457404-196457426 TTTTTTTGAAACAGAGGTTTTGG + Intergenic
968842522 4:3018081-3018103 TTTTTTTTAGATAGAGATGGGGG + Intronic
969226072 4:5799129-5799151 TCTTTCTGAGAGAGGGATTTGGG - Intronic
970146245 4:13039035-13039057 TTTTTGTGAGACAGAGAGAAAGG - Intergenic
970311285 4:14784920-14784942 ATTTTGTGGGAGAGAGATGATGG - Intergenic
970352685 4:15219121-15219143 ATATTTGGAGAGAGAGATTGTGG + Intergenic
970614983 4:17760566-17760588 CTTTGGTGAGAGAGAGAATAGGG - Intronic
970669426 4:18379009-18379031 ATAATTTGAGAGAGAGATAAGGG + Intergenic
970912747 4:21296413-21296435 TTTTTTTGATGGAAAGATGATGG + Intronic
970913481 4:21306380-21306402 TTTTTTTGAGAGAGAGAGACAGG + Intronic
971059480 4:22951524-22951546 CTTTTTTGAGTGAGAGAGAAAGG - Intergenic
971305813 4:25480365-25480387 TTATTTTAAGACAGAGTTTATGG - Intergenic
971341146 4:25770114-25770136 TTTTTTTTAGAGACAGAATCTGG - Intronic
971403482 4:26298443-26298465 TTTTTTTGAAGAGGAGATTATGG + Intronic
971404423 4:26308828-26308850 TTTCTTTGAAAGAGTGATAAAGG + Intronic
971412814 4:26393384-26393406 TTGTTTTGAGAGACAGAGTCTGG + Intronic
971775076 4:30952773-30952795 TTTTTTTGAGAGCAAGATACGGG + Intronic
971788859 4:31141473-31141495 TTTGTTTGAGAAAGAGAGAATGG - Intronic
972118423 4:35668654-35668676 TATTTTTGAGAGAGAGAGAGAGG + Intergenic
972166817 4:36296459-36296481 TTTATATGAAAGAGAGATAATGG + Intronic
972271733 4:37517343-37517365 TTTTTTTGACACAGAAAATACGG + Intronic
972342862 4:38167637-38167659 TTTCTTTGGGTGAGAGATTTGGG - Intergenic
972605816 4:40612504-40612526 CTTTTTTGAGAGACAGAGTCTGG - Intronic
973102924 4:46294749-46294771 TTTTTTTGAGAGACAGCTCTTGG + Intronic
973172435 4:47162463-47162485 TTTTTTTGCAAGAAAGAATATGG + Intronic
973299030 4:48559512-48559534 TTTTTTGGAGAGAGAGGATCTGG - Intronic
973720970 4:53723297-53723319 TCTTTTTGAGAGAGAAACTGAGG + Intronic
974579741 4:63781069-63781091 TTTTTTTGAGACAGAGTCTGGGG + Intergenic
975386717 4:73767512-73767534 TTCTTTTGAGAGACAGCTTTTGG - Intergenic
975693854 4:76992582-76992604 TTATTAAGAGAGAGAAATTAGGG + Intronic
975872315 4:78794038-78794060 TTTTCTTGGGAGAGGGCTTATGG + Intronic
975901952 4:79163937-79163959 TTTTTCTGACAGAGAGGCTATGG + Intergenic
975939633 4:79627147-79627169 TTTTTTTTAGAAAGAGAAAAGGG + Intergenic
976707902 4:88038104-88038126 TTTTGTTGTCAGAGAGATTTGGG - Intronic
977048462 4:92095927-92095949 TTTATTTGAGAGAGATTTCAGGG + Intergenic
977430766 4:96928209-96928231 TCTTTTTGAGAGACAGCTTTTGG + Intergenic
977499815 4:97824291-97824313 TGTTTATGAGAGAGAGAGAAAGG - Intronic
977788885 4:101074286-101074308 TCTTTCTGAGAGGGAGATGAGGG - Intronic
977987515 4:103400870-103400892 TTTTTTAGAGAGTGACTTTATGG + Intergenic
979164615 4:117512065-117512087 ATTTTATGAGAGAGATAATAGGG - Intergenic
979458359 4:120951804-120951826 TGTGTGTGAGAGAGAGAGTAGGG - Intergenic
980056097 4:128081392-128081414 TTTTTTTGAGATATAGATATTGG + Intronic
980059341 4:128111984-128112006 TTTTTTTAAGAGACAGAGGATGG - Intronic
980178014 4:129370629-129370651 TTTTTCTGAGAGAAAAATTCAGG + Intergenic
980211012 4:129787454-129787476 TTTAGTAGTGAGAGAGATTAAGG + Intergenic
980652863 4:135743353-135743375 TTTAATTGAGAGAGAGAGGATGG + Intergenic
980796057 4:137684547-137684569 TTTATAAGAGAGGGAGATTAGGG + Intergenic
981238887 4:142450861-142450883 ATTTCTTGAGAAAGAAATTAGGG + Intronic
981472687 4:145154691-145154713 TTTTTGTTAGAGGGAGATGAGGG + Intronic
981845159 4:149159285-149159307 TTTTTCAGAGAGAGAAATTGAGG - Intergenic
982011492 4:151109885-151109907 TTTTTTTTTGAGACAGATTCTGG - Intronic
982170861 4:152660527-152660549 ATTTTTTCAGATAGACATTAGGG + Intronic
983058564 4:163128819-163128841 TTTTTTTTCAAGAGTGATTATGG - Exonic
983518773 4:168685025-168685047 CTTTTTTGATATAGGGATTATGG - Intronic
983639154 4:169928471-169928493 TTTTCATGAAGGAGAGATTAGGG + Intergenic
983849631 4:172564462-172564484 TTTTTCTGAAAAAGATATTAAGG + Intronic
983989008 4:174095473-174095495 TTCTTTTGAGACAGGGTTTAGGG - Intergenic
984216602 4:176920882-176920904 TTTTTTTCAGACAGTCATTAAGG - Intergenic
984692676 4:182745799-182745821 TTTTCCAGAGGGAGAGATTATGG - Intronic
984731531 4:183073161-183073183 TTTTTTTGCGAGACAGAGTCTGG + Intergenic
984792930 4:183630661-183630683 TTTTTTTGAGACAGAGTCTCAGG - Intergenic
984835350 4:184014557-184014579 TTTTTTTTAAAGAGAGCTAATGG - Intronic
985128647 4:186720295-186720317 TTTTTATGAGGCAGAGGTTAAGG - Intronic
985281784 4:188294149-188294171 TTTTTTTGAGAGAGAGAGAAGGG + Intergenic
986414162 5:7511624-7511646 TTTTTTAGATAGGGAGATCAGGG + Intronic
986488077 5:8260669-8260691 TTTTAGTGAGAGAAAGATTAGGG - Intergenic
986943179 5:12981712-12981734 TTATTTTGAGAGACAGAGAAAGG - Intergenic
987303848 5:16619430-16619452 TAATTTTGAGAGAGAGAGAAAGG - Intergenic
987319374 5:16753481-16753503 TTTTTTTGGGAGACAGAGTCTGG + Intronic
987364798 5:17139375-17139397 TTATTGTGAGAGAGTGATGAAGG - Intronic
987783244 5:22465843-22465865 AGTTTTTGTAAGAGAGATTATGG - Intronic
987792400 5:22584922-22584944 TTTTTTTAAGATAAATATTATGG - Intronic
988153092 5:27413087-27413109 TTCTTATTAGACAGAGATTATGG + Intergenic
988174765 5:27707696-27707718 TTTTCTTGAGATTGAGAGTAAGG + Intergenic
988914745 5:35881064-35881086 TTTTGTTGAAAGAGAGCTTATGG - Intergenic
989698041 5:44227091-44227113 TTTGATTGAGAGAGAGAACAGGG + Intergenic
989767877 5:45107855-45107877 ATTTTTGGAGATAGAGATTGAGG - Intergenic
990792170 5:59494683-59494705 TTTTTGAAAGAGAAAGATTAGGG - Intronic
990807214 5:59678115-59678137 TCTTTTTGAGACTGAGTTTAAGG - Intronic
991245478 5:64505184-64505206 TTGTTTGGAGAGGGAGATAAAGG - Intergenic
991403905 5:66283113-66283135 TGTTTTAAAGAGAGAAATTAGGG - Intergenic
991476196 5:67022396-67022418 TTTTTTTGGTAGAGAAAATAGGG - Intronic
991691459 5:69229006-69229028 TTTTTTTGAGATGGAGTTTCCGG - Intronic
991946145 5:71900139-71900161 TTTTTTTGAGAGACAGCTGTTGG + Intergenic
992112377 5:73508133-73508155 TTTTTTTGAGAGAAGTATTAAGG + Intergenic
992708501 5:79423889-79423911 CATTTTTGAGACAGAGATGATGG + Intronic
994269853 5:97763937-97763959 TTTTTTTCTGATAGAGATTGGGG - Intergenic
994856989 5:105135293-105135315 TTCATTTGAGAAAGAGATTATGG + Intergenic
994933290 5:106217929-106217951 TGTTTTTGAGATAGAGTTTTGGG + Intergenic
995018198 5:107336896-107336918 TTTTTCTGATAAAGAAATTAAGG - Intergenic
995551981 5:113290853-113290875 TTTTTTTAAAATTGAGATTAAGG - Intronic
995674329 5:114645042-114645064 TTTTTGTGAGGGGGAGGTTAGGG + Intergenic
997122660 5:131191233-131191255 ACTTTTAGAAAGAGAGATTAAGG - Intronic
997324573 5:133009301-133009323 TTTTTTTAAGAGACAGAATCAGG - Intronic
997342928 5:133159926-133159948 TTTTTTTGAAAGAGGGCTTCTGG + Intergenic
998100807 5:139432475-139432497 TTTTTTTTAGAGACAGGGTAGGG + Intronic
998200894 5:140119225-140119247 TTTTTTGAAGAGAGAGATTAAGG + Exonic
998695912 5:144639358-144639380 TTTTATAGAGAGAGAGAAGAAGG + Intergenic
998731850 5:145086940-145086962 TTGTCTTTAGAGAGAGATTGAGG - Intergenic
999509295 5:152231319-152231341 ATATTTTGAGAGAGAGAAAAAGG + Intergenic
999876635 5:155813903-155813925 TTATTTTGATGGAGAGATGAAGG + Intergenic
999960166 5:156746280-156746302 TCCTTTTGTGAGAGAGATTTTGG - Intronic
999965193 5:156801753-156801775 ATTTTTTAAAAGAGAGATTCTGG - Intergenic
1000298899 5:159937453-159937475 TTTTTTTGAGACAGAGTCTCAGG + Intronic
1000638774 5:163675989-163676011 TTTTTTTTAGAGAGAGAGACAGG - Intergenic
1000690950 5:164320075-164320097 TTTTTTTAAGTGAGATGTTAAGG - Intergenic
1001210347 5:169805393-169805415 TTTTTTTAAGACAGAGAGTCAGG - Intronic
1001417535 5:171556507-171556529 TTTTTTTGAGAGAGAGAGTCTGG + Intergenic
1001677268 5:173528929-173528951 TTTTTTTGAGACGGAGTTTTTGG - Intergenic
1002336343 5:178481116-178481138 TTTTTTTGAGAGACAGTCTCTGG - Intronic
1002716169 5:181229394-181229416 TTTCTTTGAGAGAGAATATAGGG - Intronic
1003600647 6:7514009-7514031 ATCTTTGGATAGAGAGATTATGG - Intergenic
1003673863 6:8184851-8184873 TTTTTTAAAGAGAGTGATTATGG - Intergenic
1003869758 6:10392113-10392135 TTTTGGTGAGAGAGAGAAAAAGG + Intergenic
1003902105 6:10663942-10663964 TTTTTTTTTGAGACAGAATATGG + Intergenic
1003959251 6:11193772-11193794 TTTTTATGAGGGAGAGTTGAGGG - Intronic
1004062131 6:12207888-12207910 TTTTTTTGAGACAGAGTCTCAGG - Intergenic
1004062603 6:12212453-12212475 TTTTTTTTAGAGAGAAAGTCTGG - Intergenic
1004098000 6:12578667-12578689 TTTGTTAGAGAGAGAGAAAAAGG - Intergenic
1004111546 6:12723499-12723521 TTTTTTTGAGAGAGAGAGAGGGG + Intronic
1004212547 6:13665074-13665096 ATTGTGTGAGATAGAGATTAAGG - Intronic
1004592602 6:17068414-17068436 TTTTTTTAAAAAAGAGATTAGGG - Intergenic
1004618658 6:17314083-17314105 TTTTTTTTTGAGATAGAGTATGG - Intergenic
1004894524 6:20134664-20134686 TTGTTTTGAGAAAGACAGTATGG - Intronic
1005519079 6:26582805-26582827 TTTTTTTGTGAGACAGGTTCTGG + Intergenic
1005804809 6:29464287-29464309 TTTTTTTGAGACTGAAATAAAGG + Exonic
1006104884 6:31710536-31710558 TTTTCCAGAGAGACAGATTAAGG - Intronic
1006208449 6:32371749-32371771 TCTTTGTCAGAGAGAGATCAAGG + Exonic
1006569333 6:34987700-34987722 CTGTTTTAAGAGAGAGATTATGG + Intronic
1006684142 6:35818368-35818390 TTTTTTTTTGAGACAGATTCTGG + Intronic
1007645223 6:43374683-43374705 GTTTTTTGAGACAGAGGTTATGG - Intergenic
1007937484 6:45746094-45746116 CCTTTTTGAGAGAGAGAACAGGG - Intergenic
1008040987 6:46797977-46797999 TTTTTTTGTGAGACAGAGTCTGG + Intronic
1008274248 6:49525106-49525128 TTTTATTGAGCAAAAGATTAGGG + Intronic
1009390112 6:63135079-63135101 TCTTTTTGAGAGACAGCTTTTGG - Intergenic
1009428936 6:63545283-63545305 ATTTCTTGAGCCAGAGATTAAGG - Intronic
1009591886 6:65683530-65683552 TTATTTTGAAAGACAGATTGTGG - Intronic
1009596141 6:65739168-65739190 TTTTTGTGAAAGAGAGACAAGGG + Intergenic
1009602052 6:65813900-65813922 TTCATTTGAAAGAGTGATTAAGG + Intergenic
1009766233 6:68079405-68079427 TATATTTGAGAGAGAGTTTATGG - Intergenic
1009834728 6:68984861-68984883 GTTTTGTGTGGGAGAGATTATGG + Intronic
1009969129 6:70608028-70608050 TTTTTTTGAAAGTCAGATGAAGG - Intergenic
1010305281 6:74314320-74314342 TTTCTTTGAAATATAGATTAAGG - Intergenic
1010404008 6:75481991-75482013 TCCTTTTGAGAGAAAGATTAGGG - Intronic
1010661940 6:78581488-78581510 ATATTTTGACAGAGAAATTAAGG - Intergenic
1011245540 6:85317827-85317849 TTTTTTCAAGAGAGGAATTAAGG + Intergenic
1011447640 6:87459350-87459372 TTTTTCTGACAGAGAGGTCATGG - Intronic
1011725124 6:90203375-90203397 TTTTTTGGAGAGAGAGAGAGAGG - Intronic
1011732426 6:90279209-90279231 TTTTTTTAAGAGCAAGATTTAGG - Intronic
1011995494 6:93581893-93581915 TTTTTTTTAGAGACAGAGTCTGG + Intergenic
1012454943 6:99393652-99393674 TTTTTTTCAGAAAGAATTTAAGG - Intronic
1012629547 6:101446810-101446832 TTTTTTTGTGAGAGAATTTATGG + Intronic
1012694469 6:102360864-102360886 ATTTTTTGAGAAACAGAATACGG - Intergenic
1012846414 6:104395189-104395211 TGAGTTAGAGAGAGAGATTATGG - Intergenic
1012887819 6:104864996-104865018 TTTTTTTGAGAGGGAGTGTCTGG - Intergenic
1013917494 6:115358848-115358870 TTTTTTTGTGAGACAGCTTCTGG - Intergenic
1014764794 6:125393923-125393945 TTTCTCTGAGATGGAGATTAAGG + Intergenic
1015234950 6:130960051-130960073 ATATTTTGAGAAACAGATTATGG - Intronic
1015508431 6:134013110-134013132 TTTTTTTGAGAGATGTATGATGG - Intronic
1015711875 6:136150818-136150840 TTTTTTAAAGACAGAGCTTATGG - Intronic
1016822864 6:148362558-148362580 TTTTTTTGAAAGTGAGGTGAGGG + Intronic
1016976192 6:149811250-149811272 TAATTTTGAGAGAGAGAGAAGGG - Exonic
1017080215 6:150661238-150661260 TGTTGTTGAGAGAGATATTTTGG - Intronic
1017255357 6:152327258-152327280 GTTTTTTGAGAGACAGAGTCTGG - Intronic
1017288022 6:152701083-152701105 TTTTTTTCTGAGAAAGATTTAGG - Intronic
1017350013 6:153429213-153429235 ATTTTTTGAAATAGATATTATGG + Intergenic
1017593711 6:156005997-156006019 ATATTTAGAGAGAGAGATAAAGG + Intergenic
1018502210 6:164423108-164423130 TTTTTTTTTGAGACAGATTCTGG + Intergenic
1018524873 6:164698668-164698690 GTTTTTTCAGTGAGAGATAATGG - Intergenic
1020221994 7:6245907-6245929 TTTTTTTGAGACCGAGTTTGGGG + Intronic
1020233016 7:6334460-6334482 TTTTTTTGAGACAGAGCCTCTGG - Intronic
1020245772 7:6428300-6428322 TTTTTTTGAGACAGAGTCTCAGG - Intronic
1020395745 7:7716065-7716087 TTTTTTTGAAAATGAAATTATGG + Intronic
1020403700 7:7806212-7806234 TCTTTTTTAGAAAGAGATTTGGG - Intronic
1020465302 7:8471922-8471944 TTTTCCTGAGAGAGACATTACGG + Intronic
1020479225 7:8637232-8637254 TTTTTTTGAGAGAGAGGGCCTGG + Intronic
1020555308 7:9663447-9663469 TTTTTTTGAGACAGAGTCTCTGG - Intergenic
1021199594 7:17713140-17713162 TTTTTTTTGGAGGGAAATTAGGG - Intergenic
1021973817 7:25991623-25991645 TTTTTTAGAGGCAGAGATAAGGG - Intergenic
1022755908 7:33289474-33289496 TTTATTTGAGAGAAAAGTTATGG + Intronic
1022769805 7:33457087-33457109 GTCCTTTGGGAGAGAGATTAGGG + Intronic
1023139117 7:37083466-37083488 TTTTTTTTATAGAGTGAGTAAGG - Intronic
1023210213 7:37795228-37795250 TTTATTTAAGTGAGAGTTTAAGG - Intronic
1023475044 7:40568427-40568449 TTTGTTTGAGAAAGATCTTAGGG - Intronic
1023703956 7:42919617-42919639 TATTTCTGAGGGAGAGATTTTGG + Intronic
1024086761 7:45899317-45899339 CTATTTTGAGAAAGAGATTGTGG - Intergenic
1024346342 7:48318358-48318380 TTTTTTGGAGAGACAGACTCTGG + Intronic
1025186121 7:56860244-56860266 TTTTTTTTTGAGACAGATTAGGG - Intergenic
1025685800 7:63716668-63716690 TTTTTTTTTGAGACAGATTAGGG + Intergenic
1026057536 7:66997305-66997327 TTTTTTTAAGAGAGATATGCAGG - Intronic
1026073689 7:67145942-67145964 TTTTTTTTAGAGACAGAGTTTGG + Intronic
1026118668 7:67517848-67517870 TTGGTTTGAGTGAGTGATTATGG + Intergenic
1026187870 7:68097032-68097054 TTTTTATGAAAGAAACATTATGG + Intergenic
1026378025 7:69771794-69771816 TTTTTTTGAGATAGAGTTTTTGG + Intronic
1026566965 7:71497057-71497079 TCTTTTAGAGAGAGAGATTCAGG - Intronic
1026611420 7:71863251-71863273 TTTTTCTGAGAGAGAGAGAGAGG - Intronic
1026923460 7:74173232-74173254 TTTTTTTGAGATGGAGAATCAGG - Intergenic
1027176540 7:75907494-75907516 TTTTTTTCAGAGACAGAGTTTGG + Intronic
1027397444 7:77770667-77770689 TTTTTTTAAGAGATAGGTTCTGG - Intronic
1027990387 7:85352336-85352358 TTTTATTTAAAGAGAGATTCTGG + Intergenic
1028111617 7:86949294-86949316 TTTTTTAGAGACAGAAACTAAGG - Intronic
1028270719 7:88785525-88785547 TTTTTATGAGAGAAATACTATGG - Intronic
1028486047 7:91358650-91358672 TTTTTTTGAGGGAATGAATAAGG + Intergenic
1028559605 7:92159632-92159654 TTTTTTTGAGACGGAGATCTCGG + Intronic
1028851342 7:95541567-95541589 CTTTTTTGAGATAGGGAGTAGGG + Intergenic
1028882988 7:95900736-95900758 TTTTTTTGAGAAAGAGAGGATGG - Intronic
1028916742 7:96267785-96267807 TTTTTTTGAGACAGAGTCTCAGG - Intronic
1029018723 7:97341619-97341641 TTTTTAGGAGAGAGAGAGTTGGG + Intergenic
1029228727 7:99048375-99048397 TTTTTTTGAGAGAGAGAGTCTGG - Intronic
1029558040 7:101283887-101283909 TTTTTTTGAGATGGAGTCTATGG - Intergenic
1029651146 7:101893179-101893201 TTTTTTTAAAATAGAGATGAGGG + Intronic
1029997946 7:105028178-105028200 TTTTTTTGTGAGACAGAGTCTGG + Intronic
1030106713 7:105993662-105993684 TTTTTTTGTGAGACAGAGTCTGG - Intronic
1030424615 7:109358579-109358601 TTTTTGTGAGAGAGAGAAAAAGG + Intergenic
1030584990 7:111406714-111406736 TAATTTAGAGAGAGTGATTAAGG - Intronic
1030998872 7:116391622-116391644 TTTTTTTTAGAGAGAGAGAGTGG - Intronic
1031071479 7:117166875-117166897 TTTTTTTGAGAGACAGAGTCTGG - Intronic
1031276120 7:119725241-119725263 TGTTTCTGAGAGACAGAGTAGGG + Intergenic
1031395330 7:121267037-121267059 TTTTTTTAAGATAGAGTTTTAGG - Intronic
1031676557 7:124618362-124618384 TTTTTTTGAGAGACAGCTCTTGG + Intergenic
1031761418 7:125717115-125717137 TCTTTTTGAGAGACAGCTTTTGG + Intergenic
1032882600 7:136105056-136105078 TGTTTTTGAGAAATAGATTCGGG + Intergenic
1032913274 7:136458682-136458704 TTTTATTGAGACAGAGACTGGGG + Intergenic
1032952496 7:136930883-136930905 TTTTTTTGAGAGAATGAGTCTGG - Intronic
1033354627 7:140589577-140589599 TTTCTTTGAGAGAGAGAAAGGGG + Intronic
1033395525 7:140970476-140970498 TTTTTTTGAGATGGAGTTTCTGG - Intergenic
1033419141 7:141190482-141190504 TTTTTTTTATATAGAGATGAAGG + Intronic
1034208268 7:149338198-149338220 CTTTTTTTAAAGAGAGATTGGGG - Intergenic
1034604793 7:152302247-152302269 TTTTTTTGAGATGGAGTTTTAGG + Intronic
1034639225 7:152589373-152589395 TTTTTTTGAGAGAGAGAGAAAGG + Intergenic
1035826141 8:2645909-2645931 TTTATTTGAGTGAAATATTACGG - Intergenic
1035963863 8:4168387-4168409 ATATATTGAGAGAGAGAGTAAGG - Intronic
1036110188 8:5890636-5890658 TTTTATAGAGAGAGAAATTGAGG - Intergenic
1037047000 8:14318743-14318765 TTGTTTTGCTAGAGAGATTGTGG - Intronic
1037123050 8:15313084-15313106 TTTTTTTGAGATAGTGTTTTTGG - Intergenic
1038076480 8:24080828-24080850 TTTTTTGGAGAAACAGATTCTGG - Intergenic
1038678100 8:29641854-29641876 TTTTTTTGAGAGGAAGTTTCAGG - Intergenic
1038754173 8:30325536-30325558 ATTTTTAGAGAGAGAGCTAAAGG - Intergenic
1039082573 8:33747185-33747207 TTTTTTTGAGAGAGAGAGAGAGG - Intergenic
1039250744 8:35661412-35661434 TATTCTTGAGAGAGAGTTTGTGG + Intronic
1039449659 8:37661832-37661854 TTTTTTGGAGATAGGGATGAGGG - Intergenic
1041446242 8:57953902-57953924 TTTTCTTGAGAGAGGGTTTGTGG + Intergenic
1041587123 8:59534325-59534347 TTCTTGAGAGAGAGAGATTGAGG - Intergenic
1042387261 8:68191262-68191284 ATTTATTGTGAGAAAGATTATGG - Intronic
1042584404 8:70318994-70319016 TTTTTTCAAGAAAGAGCTTAGGG - Intronic
1042987465 8:74600283-74600305 TTTTTTTGAGATGGAGTTTCAGG + Intronic
1043063771 8:75540171-75540193 TTTTTTTGCTGGAGAGTTTAGGG + Intronic
1043071730 8:75644293-75644315 TTATTTTTAGAGATAAATTATGG + Intergenic
1043534790 8:81190544-81190566 TTTTTTTTAGCAAGAGATTTAGG + Intergenic
1043618030 8:82152185-82152207 TTTTTTTTTGAGATAGATTCTGG + Intergenic
1044198063 8:89402220-89402242 TTTTTTTAAAAGATAGATTGGGG - Intergenic
1044250146 8:89996859-89996881 TATTTTTAATAGAGAGAATAAGG - Intronic
1044911988 8:97069456-97069478 TTTTTTTTAGAGACAGATGGGGG - Intronic
1045049419 8:98309202-98309224 TTTTTTAGAGAGAGAGGGCAGGG - Intergenic
1045330020 8:101147561-101147583 TGCTTTTCAGGGAGAGATTAGGG + Intergenic
1046278399 8:111992072-111992094 TTCATTTGAGAGATAGATTAAGG - Intergenic
1046279947 8:112014314-112014336 TTATTTTAAGAGTGAGAATATGG - Intergenic
1047014000 8:120703134-120703156 TTTTTTTGAGAGATGGAGTCTGG + Intronic
1047263080 8:123279793-123279815 TTTTTTTTAGAGAGAGAGACAGG + Intergenic
1047370573 8:124252678-124252700 TTTTTTTGAGACAGAGTCTGTGG - Intergenic
1047479538 8:125268054-125268076 TTTTTTTTAAATAGAGATGAGGG - Intronic
1048239680 8:132729200-132729222 TTAGTTTGAGTCAGAGATTAGGG + Intronic
1048346524 8:133579819-133579841 GATTTTTGACAAAGAGATTAGGG - Intergenic
1048435748 8:134415672-134415694 TTCTTTTGAGAGATATATTCTGG - Intergenic
1048449155 8:134516841-134516863 TTTTTTTGAGAGATAGGGTCTGG - Intronic
1049064884 8:140305302-140305324 TTTTTTTGAGAGAGAGAGAGAGG + Intronic
1049759298 8:144324752-144324774 TTTTTTTTAGTGTGAGATGAGGG - Intronic
1049779269 8:144420848-144420870 TTTTTTTTTGAGAGAGAGTTTGG - Intergenic
1049827378 8:144678256-144678278 TTTTTTTTAGAGAGAGAGTCAGG - Intergenic
1050129374 9:2395630-2395652 TTTTTTTAAGAGGAAGATAATGG + Intergenic
1050543263 9:6688155-6688177 TTATTTTGAAAGAGAAACTATGG + Intergenic
1050682703 9:8132351-8132373 TTTTTTTTTGAGACAGAGTATGG - Intergenic
1050697272 9:8293092-8293114 TTTTGTTGAGAGAGAGCCTGAGG - Intergenic
1050888736 9:10796760-10796782 GTCTTTTGAGAGACAGATCATGG - Intergenic
1051236641 9:15007108-15007130 TTTTTTTGAGACAGAGTCTTAGG + Intergenic
1051331774 9:16031526-16031548 GGTTTTTTAGAGAGAAATTAGGG - Intronic
1051968056 9:22853311-22853333 TTTTTGTGAGAGAAAGAGAAAGG - Intergenic
1052026068 9:23574390-23574412 TTCTTTTGAGAGAGCAATTTTGG - Intergenic
1052491107 9:29169247-29169269 TTTTTTTGAAACAGAGTTTTGGG - Intergenic
1053068630 9:35087205-35087227 TTTTTTTTTGAGAGAGAGTCTGG + Intergenic
1053490388 9:38496246-38496268 CTTTTTTGAAAGACAGTTTAAGG - Intergenic
1053544111 9:39004963-39004985 TTTTTTTTAGATAAATATTAAGG - Intergenic
1053552984 9:39103574-39103596 TTTTTTTGAGAGAGGGAGAGAGG - Intronic
1053808542 9:41828461-41828483 TTTTTTTTAGATAAATATTAAGG - Intergenic
1054622050 9:67358967-67358989 TTTTTTTTAGATAAATATTAAGG + Intergenic
1054966585 9:71034759-71034781 TTTTTTTTAGAGAGAGATGTTGG + Intronic
1055224753 9:73982929-73982951 TCATTTTGAGACAGAGAATAAGG - Intergenic
1055874744 9:80928391-80928413 TTGTGTTGAGAAAGAGATGAGGG + Intergenic
1055909907 9:81337555-81337577 TTTATTTGAGAGAGAATCTATGG - Intergenic
1056066316 9:82939269-82939291 TTTTTTTGAGACAGAGTCTCAGG + Intergenic
1056139852 9:83665268-83665290 TTATTTTGGGAAAGAAATTATGG - Intronic
1056241779 9:84655033-84655055 TTTTTTTTTGAGAGAGAATGAGG + Intergenic
1056303024 9:85261348-85261370 TTTTTTTGGGAGTGAGAGTTAGG - Intergenic
1056368325 9:85928661-85928683 TTTTTTTTAGAGACAGAGTGAGG - Intergenic
1056400242 9:86220384-86220406 TTTTTTTAAGCAAGGGATTATGG + Exonic
1056503319 9:87232312-87232334 TTTTCTTGAGAGGGAGAAGATGG + Intergenic
1056558478 9:87709526-87709548 TTTTTTTGAGAGAGAGGGCTTGG + Intergenic
1057280772 9:93710002-93710024 TTTTTTTAAGAGAGAAATCTTGG - Intergenic
1058772800 9:108254022-108254044 TTTTCTTCAAAGAGAGATGATGG - Intergenic
1059020644 9:110572774-110572796 TTTTTTTGTGAGAGAGAGAGAGG - Intronic
1059164033 9:112061939-112061961 TTTTTTAGAGAGGAAGATTGAGG - Intronic
1059179406 9:112197737-112197759 TTTTTTTTGGAGACAGATTCTGG - Intergenic
1059788745 9:117616705-117616727 TTGTTTCCAGAGAGAGATAAGGG - Intergenic
1060036837 9:120262994-120263016 TTTTATTGATAGTGAGACTAAGG + Intergenic
1060435991 9:123593661-123593683 TTTTTTAAAGGGAGAGAATATGG + Intronic
1060830431 9:126710991-126711013 TATTTTTTGGAGAGAGATGAAGG + Intergenic
1061126156 9:128677201-128677223 TTTTTTTGAGACAGAGTTATAGG - Intergenic
1061132720 9:128717137-128717159 TTTTTTTGTGAGACAGAGTCTGG + Intronic
1061335570 9:129932197-129932219 TTTTTTTGAGAGAGATAGTCTGG - Intronic
1061651305 9:132052563-132052585 TTTTTTTAAAAGAGAGAGAATGG - Intronic
1061708409 9:132470570-132470592 TTTTTTTGAGAAAGAAATTTGGG + Intronic
1061979355 9:134091748-134091770 TTTTTTTAAGAGAGAGAGACAGG + Intergenic
1062301149 9:135870781-135870803 TTTTTTGGAGAGAGAGACTCTGG - Intronic
1185497862 X:571368-571390 TTTTTTTTAGAGAGAGATAGGGG - Intergenic
1185596508 X:1310179-1310201 TTTTTTTGAGACAGAGAGATGGG - Intronic
1186167458 X:6841591-6841613 TTTTTTTGAGAGAGAGGGAGAGG - Intergenic
1186575493 X:10761109-10761131 TTGTTCTGAGTGAGAGATAATGG - Intronic
1186651285 X:11563045-11563067 TTTTTTTAAAAGAGACATAAGGG + Intronic
1187119066 X:16385651-16385673 TTATTTTGAGGGATATATTATGG - Intergenic
1187166072 X:16805001-16805023 TTTTTTTGAGAGACAGAGCCTGG + Intronic
1187267137 X:17745624-17745646 TTTTCTTGAGTGTGAGTTTACGG - Intronic
1187301447 X:18054385-18054407 TTTTTTTGAGACAGAGTCTCGGG - Intergenic
1187619437 X:21034242-21034264 TATTTTTGAGAGAAAGGTCAGGG + Intergenic
1190034711 X:47010821-47010843 TTTTTTTGAGAGAGAAAGAGAGG - Intronic
1190628922 X:52366339-52366361 CTTTTTGGAGACAGAGATTGAGG + Intergenic
1190738969 X:53275742-53275764 TTTTTTTGAGACTGAGATCTTGG + Intronic
1190766778 X:53481696-53481718 TTTTTTTAAGAGAGAGAGACAGG - Intergenic
1191779649 X:64851520-64851542 TTATTGAGAGAGAGAGAGTAGGG + Intergenic
1191876632 X:65804101-65804123 TTTTTTTGTGCTAGAAATTAAGG + Intergenic
1191932925 X:66394159-66394181 TTTTTTTGAGAGACAGCTTTTGG + Intergenic
1192307562 X:69978489-69978511 TTTTTTTTTGAGACAGATTCTGG - Intronic
1194160754 X:90449543-90449565 TTTTTTTCAAAGAGATTTTAAGG - Intergenic
1194698912 X:97090328-97090350 TTTTTTTGAGAAAGAGCTCTGGG + Intronic
1194738126 X:97538763-97538785 TTTATTTGAGAGGGAGTTTCTGG - Intronic
1195050467 X:101091870-101091892 TTTTTTTGAGATGGAGTTTCAGG + Intronic
1196351793 X:114740099-114740121 TATTTTTGAGAGAGAGAGAGAGG - Intronic
1196669872 X:118354404-118354426 TTTTTTTAAGAGACAGAGTCTGG - Intronic
1196934770 X:120718794-120718816 TTTTTTTTAGAGACAGTATAGGG + Intergenic
1197449636 X:126595431-126595453 TTTTTTTCAGATAGAAATAAAGG - Intergenic
1197493670 X:127151632-127151654 TTTTTTTGAGAGAATAATTGAGG - Intergenic
1197675309 X:129323607-129323629 TTTTTTTTAGAGACAGACTCTGG + Intergenic
1197871258 X:131064801-131064823 TTTTGTGGGGAGAGAGATCATGG - Intronic
1198401164 X:136269691-136269713 TTTTTTTTCGAGACAGATTCTGG + Intergenic
1198656670 X:138922145-138922167 TTTTTTTGTGTGAGAAAATATGG - Intronic
1198920887 X:141725152-141725174 TAGTTTTGACAGAGACATTATGG - Intergenic
1199012356 X:142772189-142772211 TATGTGTGAGAGAGAAATTAGGG - Intergenic
1199319009 X:146416547-146416569 ATTTTTTGATAGAGTTATTATGG + Intergenic
1199904882 X:152215567-152215589 TTTTTTATAGTGAGAGATAAGGG - Intronic
1199943759 X:152649447-152649469 TTATTTTGGGAGAGAGAATGGGG - Intronic
1200507043 Y:4026476-4026498 TTTTTTTCAAAGAGATTTTAAGG - Intergenic
1200878567 Y:8186314-8186336 TTATTTTGAGATAAAAATTATGG - Intergenic
1201055809 Y:9990203-9990225 TTATTTTGAGATAAAAATTATGG + Intergenic
1201329482 Y:12802750-12802772 TTTTTTTGAGATGGAGTTTCTGG + Intronic
1201686133 Y:16704585-16704607 ATCTTTTGAGAGAGAGAAAATGG + Intergenic
1201730420 Y:17196428-17196450 TTTTTTTTAGAGTGTGGTTAGGG - Intergenic
1201785057 Y:17766994-17767016 TTTTTTTGAGAGAGAGTCTCTGG - Intergenic
1201816496 Y:18138993-18139015 TTTTTTTGAGAGAGAGTCTCTGG + Intergenic
1201970255 Y:19785066-19785088 TTTTTTTTTGAGACAGATTCTGG + Intergenic
1202190376 Y:22236759-22236781 TTATTTTGAGATACAAATTATGG - Intergenic
1202273589 Y:23094108-23094130 TTTTTTTGAGAGACAGAAAGAGG + Intergenic
1202292437 Y:23326573-23326595 TTTTTTTGAGAGACAGAAAGAGG - Intergenic
1202426586 Y:24727853-24727875 TTTTTTTGAGAGACAGAAAGAGG + Intergenic
1202444203 Y:24942233-24942255 TTTTTTTGAGAGACAGAAAGAGG - Intergenic