ID: 951609466

View in Genome Browser
Species Human (GRCh38)
Location 3:24476038-24476060
Sequence CCAGCTGCTGCTCTTTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951609458_951609466 22 Left 951609458 3:24475993-24476015 CCTGAGGGCACAGTTGGGAAGCT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 951609466 3:24476038-24476060 CCAGCTGCTGCTCTTTGGTGGGG 0: 1
1: 0
2: 5
3: 38
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951609466 Original CRISPR CCAGCTGCTGCTCTTTGGTG GGG Intronic
900608960 1:3536419-3536441 CCAGCTGAAGCTCTGGGGTGCGG + Intronic
901743918 1:11360060-11360082 TCAGCTGGTGCTCCCTGGTGTGG + Intergenic
901875376 1:12164412-12164434 CCCCCTGCTGCCCTTTGGAGCGG + Intergenic
902923153 1:19679233-19679255 CCAGCTGCTGCTTCCTGGCGAGG + Exonic
904271332 1:29352234-29352256 CCAGGTGCTGTTCTGTGGTCTGG + Intergenic
905321931 1:37123726-37123748 CTTGCTGCTGCTGTTTGATGGGG - Intergenic
906345210 1:45010565-45010587 GCAGCAGCAGCTCTTTGGCGTGG - Exonic
906493495 1:46286232-46286254 CCACCTGCTGTTCTCTGATGTGG - Exonic
909427181 1:75539029-75539051 ACAGCTGTTACTCTTTGGAGTGG - Intronic
909481735 1:76133701-76133723 CCAGCTGCTGATCTCAGGGGAGG + Intronic
909675110 1:78230708-78230730 CCAGCTCGTCCTCCTTGGTGTGG + Intergenic
910161059 1:84272640-84272662 CCAGCTGCTGCTCTTTAGAAAGG + Intergenic
911933016 1:103928630-103928652 CCACCTGCTGCTCTTGTCTGTGG + Intergenic
912497141 1:110098849-110098871 TCAGCTGCTGCTCCCTGGTCAGG + Intergenic
912517923 1:110227490-110227512 CCATCTGCTGCCTTTTGCTGGGG - Intronic
912557554 1:110527192-110527214 CCAGCTGCTGCTCCCTGAGGGGG + Intergenic
912668105 1:111601183-111601205 CCACCTGCTTCTCTTTGGTGAGG + Intronic
916202667 1:162286941-162286963 CCAGCTGTTAGTCTTTGCTGAGG + Intronic
916900504 1:169217491-169217513 CCATCTGTTTCTCTTTGATGTGG + Intronic
917303744 1:173606111-173606133 CCAGCTGATGCTGTGTGGAGTGG - Intergenic
917924989 1:179782043-179782065 CCAGCTGCTGCTCCTTGACGTGG + Intronic
919201520 1:194359938-194359960 ACTGCAGCTGCTCTTTGGTTTGG - Intergenic
919410379 1:197234947-197234969 CCAGCAGCTGCTCAGTGGTATGG - Intergenic
920544412 1:206803513-206803535 CCAGCTTGTACTCTTTGTTGTGG - Intronic
920924081 1:210325736-210325758 CCAGCTGCTGCTGTAGGATGAGG + Intergenic
921844134 1:219860987-219861009 CTTGCTTCTGCTCTTTGGAGTGG - Intronic
922507723 1:226136148-226136170 ACTGCTGGTGATCTTTGGTGAGG + Intergenic
922649429 1:227324479-227324501 CCAGCTAATGCTTTTTGTTGGGG + Intergenic
922731878 1:227952733-227952755 AGAGCTGCTTCTGTTTGGTGGGG - Intergenic
923039304 1:230308506-230308528 CCAGCTGCCCCTCTTTGTGGAGG - Intergenic
924569259 1:245223167-245223189 CTAGCTGATTCTCTGTGGTGGGG - Intronic
1063124434 10:3126509-3126531 CCAGCAGCTGTGCTTTGCTGCGG + Intronic
1063721134 10:8582841-8582863 CCATCTGTAGATCTTTGGTGAGG - Intergenic
1065741983 10:28805255-28805277 CAAGGTACTGCTTTTTGGTGTGG + Intergenic
1065856678 10:29836804-29836826 CATGCTGCTGCACTTTGCTGTGG + Intergenic
1065963313 10:30751763-30751785 CGAGCGGCTCCTCTTTGCTGAGG + Intergenic
1068083705 10:52348399-52348421 CCAGCTGCTGCAGTGGGGTGAGG - Intergenic
1068842520 10:61631261-61631283 TCAGCTGCTGCACCTTGGTGAGG - Intergenic
1069582559 10:69575609-69575631 CCAGCTACTGCTCCTTGATTTGG + Intergenic
1069727440 10:70590027-70590049 GCAGCTGCTGTTGTTTGGTGGGG - Intergenic
1072673835 10:97451156-97451178 CCATTGGCTGTTCTTTGGTGAGG + Intronic
1074470632 10:113723414-113723436 CCAGCTCCTGCTGTTTCTTGGGG + Intronic
1075554637 10:123421551-123421573 CCAGCTGCAGCGCTCTTGTGGGG + Intergenic
1076677122 10:132152960-132152982 CCACCTGCTCCTCATTGGTCAGG - Exonic
1076692249 10:132229857-132229879 CCGGCTGCAGCACTGTGGTGCGG + Intronic
1077138576 11:1013557-1013579 CCAGCTGCTGCTCATAGGAGTGG + Exonic
1077297750 11:1834085-1834107 CTGGCTGCTGCTCTCTGGAGCGG + Intronic
1077523599 11:3050699-3050721 CCACCTGCTGCTCTTTTTTTAGG + Intronic
1078098279 11:8313585-8313607 CCTGCAGCTGCTCTTCCGTGTGG - Intergenic
1080102390 11:28474656-28474678 CCATCCGCTCTTCTTTGGTGTGG - Intergenic
1081189240 11:40082275-40082297 CAAGCTGCTGGCCTCTGGTGAGG - Intergenic
1082009203 11:47438868-47438890 CCCGCTGCAGCCCTTTGCTGCGG + Exonic
1083427992 11:62599168-62599190 CAAGCTGCAGCTCCTTGGGGAGG - Intronic
1083628011 11:64081864-64081886 CCAGTGGCTGCTCGGTGGTGGGG + Intronic
1083802395 11:65054049-65054071 ACAGCTGCTGCTGTTTCCTGTGG - Intronic
1084485415 11:69445084-69445106 CCAGCAGCCTCTGTTTGGTGGGG + Intergenic
1084598916 11:70133403-70133425 CGAGCAGCTGCTCCTTGGTCAGG - Intronic
1085212075 11:74790665-74790687 CCAGCTGCTGTGCCTTGCTGTGG + Intronic
1088720570 11:112588588-112588610 CCAGCTGTAGCTTTTGGGTGAGG - Intergenic
1088903889 11:114139553-114139575 CAAACTGCTGGTCTTTGGGGGGG - Intronic
1090072962 11:123560354-123560376 TCTGCTGCTGTTATTTGGTGTGG - Intronic
1090611336 11:128473748-128473770 GCAGCTGCTGCTCTTTGTAGAGG - Intronic
1091283419 11:134395180-134395202 CTTGCTGCTGCTCTCTGCTGGGG + Intronic
1091823710 12:3493856-3493878 CCAGCTGGGGCTCCTTGGAGGGG + Intronic
1092035769 12:5333189-5333211 CCAGCTGTTCCTCTTTGTGGGGG + Intergenic
1092223354 12:6730459-6730481 CCAGCTGCTGCTCCTTGTGTTGG - Exonic
1093191757 12:16082707-16082729 CCAGCATCTGCTTCTTGGTGAGG - Intergenic
1095898268 12:47302346-47302368 CCAGCTGCTAATCTTAGATGTGG + Intergenic
1096776750 12:53969075-53969097 CCCGCCTCTGCTCTGTGGTGAGG + Intergenic
1096870087 12:54587740-54587762 CCAACTCCTGCCCTTTGGAGTGG - Intronic
1097834392 12:64258733-64258755 GCAGCTGGTGCTCTTCTGTGTGG + Intergenic
1098194291 12:67983521-67983543 CCAGCATCTGCTTTCTGGTGAGG - Intergenic
1099392123 12:82094526-82094548 TCAGCTGCTACTATTTGTTGAGG + Intergenic
1100279801 12:93107552-93107574 CCAGGTTCTGATCTTTGATGGGG - Intergenic
1102226541 12:111232727-111232749 CCAGCCCCTGCTTTTAGGTGTGG + Intronic
1103415259 12:120738781-120738803 GCAGCTGCTGACCTGTGGTGTGG + Intronic
1103844170 12:123889953-123889975 TCAGCTGCTTCTCTCTTGTGGGG + Intronic
1103925800 12:124422845-124422867 CGACATGCAGCTCTTTGGTGGGG + Intronic
1104391755 12:128397066-128397088 ACAGCTGCTGATGTATGGTGGGG - Intronic
1104926637 12:132317279-132317301 CCAGCTGCTTCTGTGGGGTGTGG - Intronic
1105548861 13:21373539-21373561 ACTGCAGCTGCTCTTTGGTTTGG + Exonic
1105595812 13:21836956-21836978 CCAGCTGTTTCTTTTTAGTGGGG + Intergenic
1107725829 13:43298381-43298403 GCAGTTGCTGGTCCTTGGTGAGG + Exonic
1109916324 13:68989236-68989258 TCTGCAGCTGCTCTTTGGTTTGG - Intergenic
1110383092 13:74877033-74877055 CCAACTGATGCACTTTGTTGTGG + Intergenic
1113064600 13:106360380-106360402 CCACCTTCTGCTCGTTGGTGTGG + Intergenic
1113618900 13:111699998-111700020 CCACCTGCTGCACTTTGCAGAGG + Intergenic
1113624429 13:111785259-111785281 CCACCTGCTGCACTTTGCAGAGG + Intergenic
1113801210 13:113087306-113087328 CCAGCTCCTTCACCTTGGTGTGG - Exonic
1113885911 13:113658311-113658333 CCAGCCCCTGGTGTTTGGTGAGG - Intergenic
1113981771 13:114282047-114282069 CCTCCAGCTGCTCCTTGGTGAGG - Exonic
1114795451 14:25710440-25710462 CCAGCTGCAGTTCCTTGGTTAGG + Intergenic
1115271833 14:31561454-31561476 GCGTCTGCTGCTTTTTGGTGGGG + Exonic
1116981805 14:51179269-51179291 CCAGCCTCTGGTCTCTGGTGAGG + Intergenic
1118693070 14:68359021-68359043 GCAGCTGCTCCTCTGTGGGGTGG - Intronic
1120089596 14:80315864-80315886 CCAGCTGCTCCTCATTGCTTGGG + Intronic
1121109482 14:91303067-91303089 CCAGCTGCTTCCCATTGTTGGGG - Intronic
1121219379 14:92274502-92274524 CCACCTGCTACTTTTGGGTGTGG + Intergenic
1122034518 14:98937583-98937605 CCATTTGCTGCTTTTTGGGGAGG + Intergenic
1122867177 14:104611760-104611782 CCAGCTCCTGCTCCTCTGTGGGG - Intergenic
1122902717 14:104788418-104788440 GCAGCAGCTGCTCTCTGGAGTGG + Intronic
1124221504 15:27853794-27853816 CCTCCTGCTGCTCTTTAGAGTGG - Intronic
1125519311 15:40339337-40339359 TCAGCTGTGGCTCTTTGGTGGGG + Intronic
1126850716 15:52795288-52795310 GCAGCTGCTGCTCTTGGGCCGGG - Intergenic
1126851673 15:52801031-52801053 GCTGCTGCTGCTCTTGGGTTAGG + Intergenic
1129457208 15:75682376-75682398 CCAGCTCCTGCTCTACCGTGTGG - Exonic
1129709255 15:77812157-77812179 CCAGATGCTGCCCTTTATTGAGG + Intronic
1130127075 15:81103021-81103043 CCAGCGGCTGCCCTTCAGTGAGG - Intronic
1131506268 15:93022480-93022502 CCATCTGGAGGTCTTTGGTGTGG + Intronic
1132590508 16:724398-724420 CCAGCTGCTGCTCACGGCTGCGG + Exonic
1132732951 16:1371846-1371868 CCAGCTGCTGGTCTGTGGTGCGG - Intronic
1133834309 16:9352375-9352397 CCAGCAGCTGCACTGTGGTGTGG - Intergenic
1134225375 16:12385907-12385929 CCAGCTCCTGCACAGTGGTGGGG + Intronic
1134510972 16:14846579-14846601 CCAGGGGCTGCCCTTTGCTGAGG - Exonic
1134698615 16:16245070-16245092 CCAGGGGCTGCCCTTTGCTGAGG - Exonic
1134973220 16:18549603-18549625 CCAGGGGCTGCCCTTTGCTGAGG + Exonic
1135126225 16:19811590-19811612 AGAGCAGCTGCTTTTTGGTGGGG - Intronic
1136284093 16:29231146-29231168 CCAGCTGCTGGTCCCTGGTCTGG - Intergenic
1136399243 16:30008959-30008981 CGAGCTGCTGCTGGGTGGTGGGG + Intronic
1137877895 16:52014730-52014752 AAGGCAGCTGCTCTTTGGTGGGG - Intronic
1139475064 16:67199040-67199062 CCACCTGCCGCACCTTGGTGTGG + Intergenic
1139521520 16:67485337-67485359 ACAGCTGCTGCCCGTAGGTGAGG - Intergenic
1140573735 16:76138932-76138954 CCAGCATCTGGTATTTGGTGAGG + Intergenic
1141173557 16:81705285-81705307 CCAGCTTCTGCTGTTGGGAGTGG - Intronic
1141219374 16:82054969-82054991 CCAGATGGTTCTTTTTGGTGGGG + Intronic
1141999104 16:87653931-87653953 CCAGCTGCCCATCTTTGGTGCGG + Intronic
1142089125 16:88200654-88200676 CCAGCTGCTGGTCCCTGGTCTGG - Intergenic
1142389408 16:89789048-89789070 CCACCTGGTGCTCTTGGGTCAGG - Intronic
1142930237 17:3278302-3278324 TGAGCTGCTGCTCTTTGCTGTGG - Exonic
1142931842 17:3291967-3291989 TGAGCTGCTGCTTTTTGCTGTGG - Exonic
1142960811 17:3551449-3551471 CCAGCTGGTGCCCTTTGGTCTGG - Intronic
1143129884 17:4671606-4671628 GCAGCTGCTTCTCTTAGGAGAGG - Intronic
1144169559 17:12646828-12646850 CCATCTGGAGCTCTTTGGTCAGG - Intergenic
1144613490 17:16746712-16746734 CCTCCAGCTGCTCCTTGGTGAGG + Intronic
1145133161 17:20376788-20376810 CCTCCAGCTGCTCCTTGGTGAGG + Intergenic
1145886342 17:28384829-28384851 CCACCTGCTGCTCCTGGGGGAGG - Exonic
1146012606 17:29207738-29207760 CCAGCCTCTGCTCTGTGGAGAGG - Intergenic
1146639995 17:34533162-34533184 CCAGCTGCTGCTTTTAAGTGTGG - Intergenic
1147195031 17:38760726-38760748 ACAGCTGCTGCTCCTTGGAAGGG + Intronic
1147945674 17:44078861-44078883 CCAGCTGCAGCCCTTGGATGAGG - Exonic
1148665639 17:49372559-49372581 CAGGCTGGTGCTCTTAGGTGGGG - Intronic
1148716973 17:49722873-49722895 CCAGCTGATCCTCAGTGGTGAGG + Intronic
1148824599 17:50383134-50383156 GCTGCTGCTGCTATTTGGTGTGG - Exonic
1149036179 17:52136595-52136617 CCAGCTTCAGCTTTTTTGTGTGG + Intronic
1149085622 17:52711791-52711813 TCAGCTGCCGATCTCTGGTGAGG + Intergenic
1149854878 17:60073477-60073499 GCTGCTGATGCTCTTTAGTGTGG + Intronic
1150171796 17:63004205-63004227 TCAACTGCTGCTCTTTTGAGGGG + Intergenic
1150435019 17:65147015-65147037 ACAGCTGCTGCTCCTGGGGGTGG - Intronic
1151195469 17:72428107-72428129 CCAACTGCTGCTCTGAGCTGGGG + Intergenic
1152517997 17:80837332-80837354 CCCCCTGCTGCTCCCTGGTGTGG - Intronic
1152615506 17:81336095-81336117 CCTGCTGCTTCTCATGGGTGGGG - Intergenic
1152780970 17:82227297-82227319 CCTGTTGCTGCTCTACGGTGGGG + Intergenic
1152979556 18:263377-263399 CCTGCAGCTGCTCTTTAGTATGG + Intronic
1153983235 18:10330400-10330422 CCATCTGTTGCTCTTTCATGAGG + Intergenic
1155256713 18:24004205-24004227 CCAGCTGTTGTTCTTTGGCCTGG + Intronic
1155459350 18:26059512-26059534 CCAGCTGCTGCTCACTGATATGG + Intronic
1156867673 18:41907013-41907035 CCATCTGTTTCTCTTTGGTCAGG + Intergenic
1160841302 19:1148040-1148062 CCAGCTCCTGCGCTTGGGAGAGG + Intronic
1161279549 19:3438306-3438328 CCAGCTTCTGCTCTGTGATTGGG + Intronic
1162371683 19:10283770-10283792 CCAGCTCCAGACCTTTGGTGAGG + Exonic
1163647567 19:18498590-18498612 CCAGCTGCTGGTCATTGGGGAGG - Intronic
1165007929 19:32821839-32821861 CCAGCTCCTCCTCTTTGCTGAGG - Intronic
1165057147 19:33184845-33184867 CCAGCTGCTTCAGATTGGTGGGG + Intronic
1167025469 19:46913484-46913506 CCAGTTGCGGCACTCTGGTGGGG + Intergenic
1167454153 19:49589987-49590009 CCAGCGCCTGCTCATAGGTGGGG - Exonic
1167512106 19:49900826-49900848 CCAGATAATGGTCTTTGGTGGGG + Intronic
1168354221 19:55691898-55691920 CCAGCTGCTGATCCCTGGGGAGG + Exonic
1168419620 19:56192800-56192822 CCAGGATCTGCTCTTTGGTGTGG + Exonic
1168421346 19:56206144-56206166 CCAGGATCTGCTCTTTGGTGTGG - Exonic
1168424113 19:56224794-56224816 CCAGGATCTGCTCTTTGGTGTGG + Exonic
1168426601 19:56244273-56244295 CCAGGATCTGCTCTTTGGTGTGG - Exonic
1168689565 19:58368609-58368631 CCTGCTGCTGCTGGTTGGGGCGG + Exonic
925164598 2:1708339-1708361 CCAGCAGCTCCTCTTTGGTCTGG + Intronic
931602826 2:64020426-64020448 CCAACTTTAGCTCTTTGGTGGGG - Intergenic
933446504 2:82386970-82386992 CCAGCAGCAGCTCTGAGGTGAGG + Intergenic
935198365 2:100834460-100834482 CCAGCTGACTCTCTTAGGTGCGG + Intronic
936165620 2:110116840-110116862 CCCCCTGCTGCTCCCTGGTGTGG + Intergenic
937437201 2:121890308-121890330 CCAGCTGGAGCTCGGTGGTGGGG - Intergenic
938369858 2:130762267-130762289 CCAGCTGCGCCCCTTTGTTGGGG - Exonic
939641857 2:144649239-144649261 CCAGATGCTGCTCTTTAGAAAGG - Intergenic
940362752 2:152813634-152813656 ACAGCTGCTTCTCTGTGGAGTGG + Intergenic
941035944 2:160569493-160569515 CCTGCTGCTGCTCCTTGCTGTGG + Intergenic
941722561 2:168827399-168827421 CCTGCTGCTGCTCTTGGGGTTGG - Intronic
942083746 2:172426148-172426170 ACAGCTCCTGCTCTTTCCTGGGG + Intergenic
944979477 2:205098810-205098832 CCAGCTGTTGCTAATTGGTTTGG + Intronic
945144011 2:206716819-206716841 CCAGATGCTGCTCTTGGTAGAGG + Intronic
945236580 2:207636976-207636998 CTAGGTGTTGCTCTGTGGTGTGG - Intergenic
946133886 2:217629511-217629533 CCAGCTCCTGCTCTGTGGGGTGG - Intronic
946848050 2:223878629-223878651 GGAGCTGCTGTTCTTAGGTGTGG + Exonic
946904381 2:224401989-224402011 CCCGCTGCTGCTGTGTGGAGAGG - Exonic
946941016 2:224770282-224770304 CCAGCTGGTCCTCTTTGATGAGG + Exonic
948891813 2:240910520-240910542 CCAGCTGTCCCTCTTTGCTGAGG + Intergenic
1168934603 20:1653129-1653151 GCAGCTGCTGCTCTTGGGTGTGG - Intronic
1171445777 20:25203895-25203917 GCAGATCCTGCTATTTGGTGGGG - Intronic
1172054569 20:32145161-32145183 ACAGCTGATTCTCCTTGGTGGGG - Exonic
1172103058 20:32497266-32497288 CCTGGAGCTGCTCTTTGCTGGGG + Intronic
1172347996 20:34219409-34219431 CTAGCTCCTGGTCTTGGGTGTGG - Intronic
1173285913 20:41671334-41671356 CCAGCTCTTGCTCCCTGGTGGGG - Intergenic
1173503852 20:43571949-43571971 ACAGCTGCTGCCCTGGGGTGTGG + Intronic
1174204783 20:48830249-48830271 CCAGCTGCTGGGCTGAGGTGGGG + Intergenic
1174270029 20:49361365-49361387 CCAGCTCTTGCTCTGTTGTGGGG - Intergenic
1175111910 20:56654387-56654409 CCACCTGCTGGTCCTTGGCGGGG + Intergenic
1175197384 20:57253647-57253669 CCACCAGCTGCTCTTTGTGGTGG - Intronic
1175262411 20:57682896-57682918 CGAGCTGCTGCTCATTTGTCAGG - Intronic
1175397671 20:58678112-58678134 AGATCTGCTGCTCTTAGGTGTGG + Exonic
1175623067 20:60467142-60467164 CCATCTGCTTCTCTGTGGTGAGG - Intergenic
1175715030 20:61249631-61249653 CCAGCTGCTGCTCTGTTACGTGG + Intergenic
1176676854 21:9786746-9786768 CCAGCTGCGGCTCCTGGCTGAGG - Intergenic
1178490065 21:33044295-33044317 CCAGATACTTCTCTGTGGTGGGG + Intergenic
1181131815 22:20736501-20736523 CCAGCTGCTGCCCTCTGGCCTGG - Intronic
1181274385 22:21679301-21679323 CCAGCTGTTTTTTTTTGGTGGGG - Intronic
1182244306 22:28943281-28943303 GCAGCTGCTGGACTTTGATGGGG + Intronic
1182462545 22:30492616-30492638 CCAGCACCTGCTCTTGGCTGTGG - Intronic
1182652026 22:31859769-31859791 CCAACTGCTGCTCTAGGGAGTGG + Intronic
1183446388 22:37858603-37858625 GCAGCTTTAGCTCTTTGGTGGGG - Intronic
1183463780 22:37968745-37968767 CCAGCTCCTCCTCTTTGAAGGGG - Exonic
1185309855 22:50148266-50148288 GCAGCTTCTGCTCTGTGGTCAGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951432768 3:22627766-22627788 AGGGCTGCTGCTCTTTGCTGGGG + Intergenic
951609466 3:24476038-24476060 CCAGCTGCTGCTCTTTGGTGGGG + Intronic
953928658 3:46995265-46995287 CCAGCAGCTGCTCTTGGCAGCGG - Exonic
954419779 3:50412652-50412674 GCAGCTGCTGCTCTGAGGAGTGG + Intronic
954748883 3:52802777-52802799 CCAGCAGCTGCTCAATGGTGAGG - Exonic
956008304 3:64804043-64804065 CCATCACCTGCTCTTTGGGGAGG + Intergenic
956721702 3:72123779-72123801 CCAGCTGTTGGCCTTTCGTGAGG - Intergenic
960529226 3:118744406-118744428 TCAGTTGGTTCTCTTTGGTGTGG + Intergenic
961657161 3:128449551-128449573 CCACCTGCTCCTTTTTGGTGGGG - Intergenic
962350639 3:134653177-134653199 CCAGATAATTCTCTTTGGTGGGG + Intronic
963229259 3:142893273-142893295 TCAGCTGCTGCTTCTTGGTGTGG + Intergenic
966694802 3:182778612-182778634 CCTGCTGCTGCTTTGGGGTGAGG + Intergenic
966820463 3:183920356-183920378 CCAACTGCTGCTTTTTGAGGTGG - Exonic
967131053 3:186471136-186471158 CCAGCAGCTGCTTTCTAGTGGGG - Intergenic
967307993 3:188077386-188077408 CCAGTTGCTGACCTTTGGTTGGG - Intergenic
968588680 4:1446825-1446847 CCAGCACCTGCTCTGTGCTGGGG - Intergenic
968615471 4:1575735-1575757 CCAGCTCCTGCTCTCTGGCAAGG - Intergenic
968736395 4:2298951-2298973 CGCGCTGCTCCTCTGTGGTGGGG - Intronic
972072487 4:35038683-35038705 GCAGCTGCAGCTGTATGGTGGGG - Intergenic
972092246 4:35301660-35301682 CCTGCTGCTGCTCTTTTGTCTGG + Intergenic
972236272 4:37137674-37137696 CCAGCTGCTGCTAGTTGGTGTGG - Intergenic
972892929 4:43582055-43582077 CCAGCTGCTGCCATTGGCTGTGG + Intergenic
975799649 4:78046907-78046929 CATGCTGCTACGCTTTGGTGAGG + Intergenic
982736207 4:159009585-159009607 CAAGCTGCTGCTCTTTTGCATGG + Intronic
984830771 4:183970690-183970712 CTGGCTGCAGCACTTTGGTGGGG - Intronic
985091024 4:186362760-186362782 CCAGCTGTTCCTGTTTGGTGAGG - Intergenic
985398685 4:189572037-189572059 CCAGCTGCGGCTCCTGGCTGAGG + Intergenic
985546380 5:511498-511520 CCATCTGCCTGTCTTTGGTGTGG - Intronic
985577639 5:681132-681154 CCAGCTGCTTCTCCTTGGATGGG + Intronic
985592565 5:773230-773252 CCAGCTGCTTCTCCTTGGATGGG + Intergenic
986494492 5:8328916-8328938 CCTACTGCTGCTTTTTGTTGAGG + Intergenic
989411168 5:41121596-41121618 CCAGCAATAGCTCTTTGGTGGGG + Intergenic
990699127 5:58456980-58457002 GCAGCTGCTGCTCTTTTTGGTGG - Exonic
992000610 5:72432547-72432569 TCAGCTGCTGCTCAGTGGGGAGG - Intergenic
994446324 5:99879275-99879297 CCAGCTGCTCCTCTCTGGGCAGG + Intergenic
995279738 5:110320072-110320094 CCAGCTCCTGAACTTAGGTGTGG + Intronic
997443829 5:133927064-133927086 CCAGATGGAGCTCTTTGGAGAGG + Intergenic
998128325 5:139638546-139638568 CTAGCTCCAGCTCTTCGGTGTGG + Intergenic
998620094 5:143784139-143784161 CCACCTGCTGGTATTTGATGTGG + Intergenic
999534265 5:152500131-152500153 CTAGATGATGCTATTTGGTGGGG - Intergenic
999596994 5:153215432-153215454 AGAGCTGCTGCTCTTTGCTGGGG - Intergenic
999938674 5:156516405-156516427 ACAGCTGCTGCAGTTTGCTGGGG - Intronic
1000206516 5:159065394-159065416 TCAGCTGCTGCTTTTTGATGTGG - Intronic
1000907566 5:166980910-166980932 CAAGTTGCTGCTCTATGATGTGG - Intergenic
1002043631 5:176530581-176530603 CCAGGAGCTGTCCTTTGGTGTGG - Exonic
1003809005 6:9758887-9758909 CAGGCTGCTGCTCTTTGGAGTGG - Intronic
1004362203 6:14981168-14981190 CAACCTGCTGCTGTTTGGGGAGG - Intergenic
1005669687 6:28092676-28092698 CCAGGATCTGTTCTTTGGTGTGG - Intergenic
1005700726 6:28398147-28398169 CCAGAATCTGTTCTTTGGTGTGG + Exonic
1005987273 6:30882962-30882984 CCAGCTGCTGTTCTCTGGAGGGG + Intronic
1006427892 6:33977600-33977622 CCAACTCCTGCTCGTTGGTGGGG - Intergenic
1006449146 6:34096016-34096038 CCTGCTGCTGCTGTTGGGAGAGG - Intronic
1007934785 6:45723318-45723340 CCAGCAGCTCCACTTTGCTGTGG + Intergenic
1009840885 6:69073258-69073280 GCAGCTTCTGCCCTTTGATGAGG - Intronic
1012002735 6:93674396-93674418 CCAGCTGCTTCAGATTGGTGGGG - Intergenic
1013201291 6:107898927-107898949 CCAGCTGCTGCACCTTGTAGCGG - Intronic
1013582700 6:111551864-111551886 CCAGCTGCTGCTCGACGATGAGG + Intergenic
1015842224 6:137488378-137488400 CCAGCTGCGTCTCTTCGCTGGGG - Intergenic
1016026449 6:139292228-139292250 CCAGCTGCTTCTCTCTGCTAAGG - Intergenic
1017796138 6:157846327-157846349 CCAGCTGTAGTTCTGTGGTGAGG + Intronic
1019060582 6:169254823-169254845 GAAGCTGCTGCTCTAAGGTGGGG + Intergenic
1019190668 6:170249010-170249032 CCAGCGGCTGCCCCTCGGTGTGG + Intergenic
1019377138 7:698904-698926 CCAGCTGCTGCTGCTGCGTGGGG - Intronic
1019420615 7:949069-949091 GCATCTGCTGTTCCTTGGTGGGG - Intronic
1019437793 7:1030866-1030888 GCACCTGCTGCTCTGTGTTGGGG - Intronic
1020028202 7:4914523-4914545 CCAGCTCCCTCTCTTTGTTGGGG - Intronic
1022646015 7:32229064-32229086 CCACCTGCTGCTGTTTTGTAAGG + Intronic
1022977581 7:35573450-35573472 CCAGCTGCAGGTCTGTGATGGGG - Intergenic
1023718726 7:43071664-43071686 CCAGCTCCTCCTCTTCTGTGTGG - Intergenic
1024364722 7:48507940-48507962 CCATCGGCAGCTCTGTGGTGAGG + Exonic
1025958541 7:66201022-66201044 CTGGCTGATGCTCTCTGGTGAGG + Intergenic
1029167805 7:98606777-98606799 CCTGTAGCTCCTCTTTGGTGAGG + Intergenic
1029356672 7:100057240-100057262 CCAGGATCTGCTCCTTGGTGTGG - Exonic
1029858323 7:103541267-103541289 CAAGCTGCTGCTTTCTGGTCTGG + Intronic
1031254404 7:119428991-119429013 AAAGCTGCTGCTGTTTGCTGGGG - Intergenic
1033467381 7:141607433-141607455 CCATCTGTAGATCTTTGGTGAGG + Intronic
1034886895 7:154805073-154805095 ACAGCTACTCCTCTGTGGTGGGG - Intronic
1035226312 7:157434877-157434899 TCAGCTGCTGCTGTCTGGTTTGG - Intergenic
1035630730 8:1104838-1104860 CCACTTCCTGCTCTCTGGTGAGG - Intergenic
1036212799 8:6855727-6855749 ACAGCTCCTGACCTTTGGTGGGG - Intergenic
1037477038 8:19268027-19268049 TCAGTTGCTGCTCTTTGGCTAGG + Intergenic
1039406355 8:37316015-37316037 CCTGCAGCTCCTCTTTGCTGGGG + Intergenic
1042590504 8:70393495-70393517 CCAGCTGCTGACCTTTGGTGGGG - Intronic
1042679213 8:71362036-71362058 TCTGCCGCTGCTGTTTGGTGGGG - Exonic
1046291106 8:112162922-112162944 GCCGCTGCTGCACTTTTGTGGGG + Intergenic
1046457421 8:114484760-114484782 CTAGCTGCTGCTGGATGGTGTGG + Intergenic
1048021767 8:130546182-130546204 CCAGCTGCTGTTCCTTTGAGAGG + Intergenic
1048104871 8:131397057-131397079 GAAGTTGCTGCTCTTTGCTGGGG + Intergenic
1049011826 8:139892346-139892368 CCAGCTGCCTCTCTCTGGAGAGG + Intronic
1049520227 8:143084245-143084267 CCAGCAGCGGATCTTTGGTGAGG + Intergenic
1051068585 9:13135253-13135275 CCAGATACTGCTCTTTGGACTGG - Intronic
1051306609 9:15717138-15717160 CCAGCAGCGGCTATGTGGTGGGG + Intronic
1053014703 9:34655210-34655232 GCAGCTGCTGCTCATCTGTGGGG - Exonic
1053427088 9:38017255-38017277 CCGGCTGCTTCTCTTGGGAGGGG + Intronic
1056751316 9:89353460-89353482 TCAGCTGCAGCCCTCTGGTGAGG - Intronic
1056806211 9:89730933-89730955 TCTCCTGCTGCTCTGTGGTGCGG + Intergenic
1056818104 9:89816327-89816349 CAAGCTGCTGCTCTCTGTGGTGG + Intergenic
1056831090 9:89918142-89918164 CCAGGTGCTGCTCTGGGATGGGG - Intergenic
1056964546 9:91154988-91155010 CCTACTGCAGCTCTGTGGTGTGG + Intergenic
1057152394 9:92807698-92807720 CCAGCTGCTGCTGAAAGGTGCGG + Intergenic
1057346697 9:94258103-94258125 CCAGCAGTGGCTCTGTGGTGCGG + Intergenic
1058803748 9:108569756-108569778 CCAGCTGCTGGCCTTCTGTGTGG - Intergenic
1058951758 9:109910613-109910635 CCAGCGGACCCTCTTTGGTGTGG - Intronic
1059767782 9:117400333-117400355 CCACCTGCTGTCCTTTTGTGGGG + Intronic
1062100753 9:134727274-134727296 CCAGCAGCTGCTCTTTGTCTCGG + Exonic
1062322614 9:135997838-135997860 CCAGCTGCTCCTCTCGGCTGTGG + Intergenic
1062331326 9:136046133-136046155 CCACCTCCTGCTCTCTGGAGGGG + Intronic
1062516165 9:136937640-136937662 AGAGCTGCTGGTCTTTGGTCTGG + Intronic
1185501504 X:600097-600119 CCAGCTCCTGCTGGTTTGTGGGG + Intergenic
1185625380 X:1477702-1477724 CCAGATGATCCTCTGTGGTGGGG - Intronic
1186027777 X:5332731-5332753 CCAGGTGCTGGCCTTTGATGAGG + Intergenic
1188232528 X:27682932-27682954 CCAGCTACTGCTTGTTTGTGAGG - Intronic
1189284270 X:39840481-39840503 CCCGCTGGTGGTCCTTGGTGGGG - Intergenic
1189824107 X:44899337-44899359 CCTGCTTCTGCTTTGTGGTGGGG + Intronic
1190473516 X:50806131-50806153 GCAACTGGTGCTCTTGGGTGGGG + Intronic
1192105251 X:68309481-68309503 TCAGCTGCTGCTCTCTGTTATGG - Intronic
1192836865 X:74809097-74809119 CAAGGTGCTGCTCTCTGGTGAGG - Intronic
1194391482 X:93322636-93322658 CCTGCAGCTGCAGTTTGGTGTGG - Intergenic
1194842085 X:98754868-98754890 CCAGCAGCAGCTGTGTGGTGCGG - Intergenic
1195622806 X:106974302-106974324 CCAACTGCTGCTCTGGGGTATGG + Intronic
1195686269 X:107589355-107589377 ACGGCTGCTGCTATTTGCTGGGG + Intronic
1196624128 X:117858677-117858699 CCAGCTGCTTCTCTGTGGCCTGG + Intergenic
1197089817 X:122523315-122523337 CCAGCTAGTGCACTGTGGTGGGG + Intergenic
1197830483 X:130637264-130637286 TCAGCTGCTGTTCTTTGTTAGGG + Exonic
1198159847 X:133996939-133996961 CCAGCTAATACTCTTTGGTGTGG + Intergenic