ID: 951609598

View in Genome Browser
Species Human (GRCh38)
Location 3:24477662-24477684
Sequence TAGCTAACGCTGCCAAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951609594_951609598 24 Left 951609594 3:24477615-24477637 CCTAACAGAAATACAGAAATAAC 0: 1
1: 0
2: 10
3: 121
4: 1170
Right 951609598 3:24477662-24477684 TAGCTAACGCTGCCAAAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951609598 Original CRISPR TAGCTAACGCTGCCAAAGCA AGG Intronic
900464153 1:2815908-2815930 CAGCCACCGCTGCCAAAGCCTGG - Intergenic
900851783 1:5149478-5149500 TTGCTAACTCTTCCAATGCAAGG - Intergenic
919838088 1:201590401-201590423 TAGATAAAGCTGCCAAAAAAAGG - Intergenic
1067789957 10:49280286-49280308 TACCTAATGCTGCCAAAGATGGG + Intergenic
1069626691 10:69872401-69872423 TAGCTAAAGATGCCCCAGCAGGG - Intronic
1079345837 11:19651535-19651557 TAGGTAACACTGCCAACCCAAGG - Intronic
1080972324 11:37293031-37293053 TAAGTAATGCTGCAAAAGCATGG - Intergenic
1096569259 12:52511481-52511503 TTGCTATCACTGCCAAAGGAAGG - Intergenic
1098990513 12:77060414-77060436 TAGTTCATGCTGCCAAAGAAAGG + Intronic
1103144283 12:118580985-118581007 TTGCTAAGGCTGCCATAACAAGG - Intergenic
1106106901 13:26741132-26741154 TAGCTAACACTTCCAGAGCCAGG - Intergenic
1117003302 14:51393688-51393710 TTGCTAGGGCTGCCATAGCAAGG + Intergenic
1118607104 14:67512576-67512598 TAGCTAACCCTCCCAGAGCCTGG - Intronic
1119037387 14:71241809-71241831 GACCTAACCCTGACAAAGCAGGG + Intergenic
1119700717 14:76752728-76752750 TAACTAATGTTCCCAAAGCAGGG + Intergenic
1121520818 14:94585142-94585164 TTGCTAACACTGGCAAAGCTTGG - Intronic
1136539085 16:30918572-30918594 TAGCTAACCCTGGCCAGGCAAGG - Intergenic
1136670825 16:31855337-31855359 TAGCAAACACAGCCTAAGCAAGG + Intergenic
1141256481 16:82407413-82407435 TAGCTGACCCTCCCAAAGCATGG + Intergenic
1151755235 17:76071977-76071999 TGGCTCAAGGTGCCAAAGCAAGG + Intronic
1152259405 17:79258946-79258968 TAGCAAGCGCTGAGAAAGCAGGG - Intronic
1155247634 18:23925108-23925130 CAGCCAACGCTTCCAGAGCAGGG + Intronic
1155419761 18:25642617-25642639 TTGCTAAGGCTGCCATAACAAGG + Intergenic
1158995858 18:62918559-62918581 TAGCTAAACCTGCCAACTCAGGG + Intronic
927590267 2:24349969-24349991 TTTCTAGTGCTGCCAAAGCATGG + Intronic
944042396 2:195370408-195370430 AAGATAACCTTGCCAAAGCAAGG + Intergenic
1170446069 20:16429212-16429234 TATTTAACGCTGTCAAAGCAGGG - Intronic
1171248764 20:23633526-23633548 GAGCTGACGCGGCCACAGCAAGG - Intronic
1171262608 20:23747431-23747453 GAGCTGACGCAGCCACAGCAAGG - Intergenic
1176732705 21:10516809-10516831 TAGCTAAGGCAGTCAAAGAAAGG - Intergenic
1178146661 21:29748051-29748073 CAGCTAACACTGTGAAAGCAAGG + Intronic
951609598 3:24477662-24477684 TAGCTAACGCTGCCAAAGCAAGG + Intronic
952156201 3:30646323-30646345 TAGGTAACGCTTTCAAAGAAAGG + Intronic
957408353 3:79801924-79801946 TATCTAGTGCTGCTAAAGCAAGG - Intergenic
964874299 3:161348370-161348392 TGGCTAGGGCTGCCCAAGCAAGG - Intronic
968531556 4:1094541-1094563 GAGCCAACACTGCCACAGCAGGG + Intronic
971497350 4:27280909-27280931 TAGATAACTCTACAAAAGCAAGG - Intergenic
976488686 4:85641343-85641365 TTGCTAAGGCTGCCATAACAAGG + Intronic
977481661 4:97585596-97585618 CAGCTAACTGTGCCACAGCAAGG + Intronic
980737247 4:136906259-136906281 TGGCTAACACTTCAAAAGCACGG + Intergenic
989310984 5:40017967-40017989 TAGCTACCTCTGCAAAAGCCAGG + Intergenic
997261002 5:132465452-132465474 TAGGTAACGGAGGCAAAGCAAGG - Intronic
1007990469 6:46249889-46249911 TAGCCAACTCTGCCATAGCAAGG + Intronic
1010048753 6:71478669-71478691 TAGCTAATGTTTCCAAAGGAAGG + Intergenic
1011509960 6:88089402-88089424 TATCAAACTCAGCCAAAGCAAGG + Intergenic
1014271527 6:119341823-119341845 TAGATAACTCAGCCAAGGCATGG + Intronic
1014912708 6:127113312-127113334 TGGCAAATGATGCCAAAGCAGGG + Intergenic
1024301445 7:47890297-47890319 TAGCTAAAGCTGGCACAGCCGGG - Intronic
1027723827 7:81777315-81777337 TAGCTAACGCTGTGATAGCATGG + Intergenic
1034062109 7:148101816-148101838 TAGCTTCCCCTGCCATAGCATGG - Intronic
1034596880 7:152204709-152204731 TAGCTAAGGCAGTCAAAGAAAGG + Intronic
1037400794 8:18493544-18493566 TAGCCAATGCCACCAAAGCATGG - Intergenic
1039882473 8:41633533-41633555 TAGCAAATTCTGCTAAAGCAGGG + Intergenic
1042325233 8:67521338-67521360 TAGCCAATGCTGCCAGAGCTAGG - Intronic
1057562359 9:96138532-96138554 TAGCTCAGGCTGCCATAACAGGG - Intergenic
1186907372 X:14126287-14126309 TAGCTAAGGCTGTCTGAGCAAGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194641368 X:96407287-96407309 TAGATCAAGCTGACAAAGCAGGG + Intergenic
1197689530 X:129482678-129482700 TTGGTAATGCTGCCAAATCATGG - Intronic