ID: 951610162

View in Genome Browser
Species Human (GRCh38)
Location 3:24482663-24482685
Sequence CTCTTCCCTGCTCCGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 217}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951610150_951610162 29 Left 951610150 3:24482611-24482633 CCCCAGCTTCCACCCTCTCACAA 0: 1
1: 0
2: 3
3: 33
4: 351
Right 951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 217
951610152_951610162 27 Left 951610152 3:24482613-24482635 CCAGCTTCCACCCTCTCACAATA 0: 1
1: 0
2: 0
3: 14
4: 231
Right 951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 217
951610153_951610162 20 Left 951610153 3:24482620-24482642 CCACCCTCTCACAATACACTCAA 0: 1
1: 0
2: 0
3: 20
4: 268
Right 951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 217
951610154_951610162 17 Left 951610154 3:24482623-24482645 CCCTCTCACAATACACTCAACCA 0: 1
1: 0
2: 1
3: 8
4: 205
Right 951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 217
951610151_951610162 28 Left 951610151 3:24482612-24482634 CCCAGCTTCCACCCTCTCACAAT 0: 1
1: 0
2: 2
3: 26
4: 249
Right 951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 217
951610149_951610162 30 Left 951610149 3:24482610-24482632 CCCCCAGCTTCCACCCTCTCACA 0: 1
1: 0
2: 3
3: 56
4: 549
Right 951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 217
951610160_951610162 -3 Left 951610160 3:24482643-24482665 CCAATAAGAGAAGGGGGTTTCTC 0: 1
1: 0
2: 0
3: 4
4: 113
Right 951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 217
951610155_951610162 16 Left 951610155 3:24482624-24482646 CCTCTCACAATACACTCAACCAA 0: 1
1: 0
2: 1
3: 10
4: 167
Right 951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951610162 Original CRISPR CTCTTCCCTGCTCCGTGACA GGG Intronic
901664551 1:10818941-10818963 CTCTGCCCTGAGCCTTGACATGG - Intergenic
901876009 1:12167403-12167425 CTCTTACCCGCGTCGTGACAGGG + Intronic
902673438 1:17992096-17992118 CTCTTCCCTGCCCGGTGTCCAGG + Intergenic
902735748 1:18399522-18399544 CCCTTCCCTGCTCCCTGCCTTGG - Intergenic
902742349 1:18447508-18447530 CTCTGCCCTGCTGTCTGACACGG + Intergenic
903023581 1:20411408-20411430 CTCATCCCTGCTCTCTGCCAAGG + Intergenic
903320133 1:22538240-22538262 CTCTTCCTTGTTCCTTGAGATGG - Intergenic
908790442 1:67775812-67775834 ATTTTCCCTTCTCCATGACATGG - Intronic
910121100 1:83791485-83791507 CTCTTCTCTGCTTCATGAAAGGG - Intergenic
911162794 1:94698375-94698397 CCCTTCCCTGCTCCTTCCCAAGG - Intergenic
911958350 1:104266022-104266044 CTCTACCCTACTCTGTGACCAGG + Intergenic
913072815 1:115316154-115316176 GTCTTTGCTGCTCTGTGACATGG + Intronic
916729808 1:167555783-167555805 CCCTTCCCTGCTCCATGTAAGGG + Intergenic
919945558 1:202317035-202317057 CTCTCCCTTGCTCTGTGAGAGGG - Intronic
921625011 1:217370229-217370251 CTCCTCCCTGCACCCTCACATGG - Intergenic
923112949 1:230907370-230907392 CACTTCCCTGATCTGTCACAGGG + Intronic
924445338 1:244124661-244124683 CTCCTGCCTGCTCCATGACCTGG - Intergenic
1066243847 10:33562999-33563021 CTCTTTCCTCCACAGTGACAAGG + Intergenic
1067470209 10:46531165-46531187 CTCTGCCTTACTCGGTGACAAGG + Intergenic
1068122986 10:52803769-52803791 CTCTTCCCTGCACCTTCACCTGG + Intergenic
1070522951 10:77270163-77270185 CCCTTGCCTGTTCCTTGACAAGG - Intronic
1070749777 10:78957157-78957179 CTCTTGCCTGCTCCGTATCTGGG + Intergenic
1070842484 10:79496931-79496953 CCTTTCCTTGCCCCGTGACAGGG - Intergenic
1072191725 10:93081471-93081493 CTCTCCCCTGCCCTGTGACTTGG + Intergenic
1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG + Intergenic
1075911753 10:126131169-126131191 CCCTTCCCTGCTCCCTGCCTCGG + Intronic
1076070131 10:127482570-127482592 CTCCACCCTGCTCCGTGCCCGGG + Intergenic
1076531173 10:131146029-131146051 CTCTTCCCCTGTCCGTGACCAGG + Intronic
1076852873 10:133101658-133101680 CTCTGCCCTACTCCTCGACACGG + Intronic
1076913182 10:133402468-133402490 CTCTGCCCTGGTCCGTCAAATGG - Intronic
1078274974 11:9834948-9834970 CTCTCTCCTGCTTCCTGACATGG + Intronic
1078857853 11:15221092-15221114 CTCTTCCTTGCTGTGTGACTTGG - Intronic
1079110897 11:17604559-17604581 CTCTTCCCTCCTCTGTAAAATGG + Intronic
1081666982 11:44922449-44922471 CTCTTCCCAGATCCTTGCCATGG - Intronic
1083173752 11:60937054-60937076 CTCTGCCCTGCCCCTTGTCATGG + Exonic
1084319730 11:68366576-68366598 CTTTTCTCTGCTCCCTGGCAGGG + Intronic
1087175136 11:95089544-95089566 CTCTTCCCAGCCCCGGGACTAGG + Intergenic
1087980657 11:104609634-104609656 CTCTTCCCATCTCCCTCACAAGG + Intergenic
1088344871 11:108811685-108811707 TTCTTTCCTACTCCGTGAAAAGG - Intronic
1088908779 11:114174861-114174883 CTCTTCCCTGCAGCTTGACCTGG - Intronic
1090230320 11:125098259-125098281 ATTTTCCCTGCCCCGTGGCATGG - Intronic
1090405633 11:126474457-126474479 CTGTACCCTGCTCCCTGCCAGGG - Intronic
1090606203 11:128425099-128425121 CGTTTCCCAGCTCCGTCACAGGG - Intergenic
1091160560 11:133415817-133415839 CTCTTTACTGCCCCGTGATACGG + Intronic
1095427786 12:42095889-42095911 CTCTCCCCTGCTCCCAGACAAGG - Intronic
1096539134 12:52294464-52294486 CTCCTCCCTTCCCCATGACAAGG - Intronic
1098102398 12:67031941-67031963 ATCTTCCCTCCTCCGTGCCTTGG + Intergenic
1098234160 12:68402327-68402349 CTCTTCCCTGAACTGTGACCAGG - Intergenic
1103446536 12:120998772-120998794 CTCTGCCTTGCTCTTTGACAGGG + Intronic
1104975709 12:132551086-132551108 CTCCTGCCTGCTCCCTGGCAGGG - Intronic
1106414376 13:29534113-29534135 CCCTGTCCTGCTCAGTGACAGGG + Intronic
1109276739 13:60311903-60311925 CCCTTCTCTGCTCTGTGCCATGG - Intergenic
1113824056 13:113236468-113236490 CTCTGCCCTTCTCCGTAAGATGG + Intronic
1119520578 14:75281417-75281439 CCCTTCCCTGCCCCCTCACAGGG - Exonic
1121554192 14:94823859-94823881 CTCTTCACCGCTCCATGAAAGGG + Intergenic
1122780607 14:104141871-104141893 CTGTTTCCTGCTCTGCGACATGG + Intronic
1124022973 15:25940536-25940558 TTCTTCTCTGCAGCGTGACATGG + Intergenic
1126063036 15:44802326-44802348 CACTTCCCTGCTTGGTGAGAGGG - Intergenic
1126685130 15:51241712-51241734 TTGTTCTCTGCTCCCTGACAGGG - Intronic
1126909280 15:53401203-53401225 CTCTTCCCTGCTGAGCTACATGG - Intergenic
1128799959 15:70491000-70491022 CACTTTCCTCCTCTGTGACACGG - Intergenic
1130303891 15:82699998-82700020 CTCTTCACTGCTCAGAGACAAGG + Intronic
1130682033 15:86005549-86005571 CTCTTCCCTGGTGGGTGAAAAGG - Intergenic
1131507131 15:93029019-93029041 CTCCTCCCTCCTCCCTGGCAGGG + Intergenic
1133277429 16:4647241-4647263 CTCAGCCCTGCTCCATGACTGGG + Intronic
1133329097 16:4960196-4960218 CACTTCCCTGCTCAGTAACATGG + Intronic
1140037707 16:71383745-71383767 CTCTCCCCTCCTCAGGGACAGGG - Intronic
1140325491 16:73997567-73997589 CTGGTCCCTGCTCTGTAACATGG + Intergenic
1140909512 16:79438599-79438621 CCCTTCCCTCCTCTGTGAAATGG - Intergenic
1141749253 16:85947184-85947206 TTCTTGCCTGCTCCCTTACAGGG + Intergenic
1142138893 16:88463869-88463891 CCCTTCCCTGCTCTGGGCCAAGG + Intronic
1142261485 16:89044465-89044487 CTCTTTCCTGCTCCGCGTCTGGG - Intergenic
1142978103 17:3657070-3657092 CTCCTCCCTCCTCCCTGGCAGGG - Intronic
1143011083 17:3866501-3866523 TTTGTCCCTCCTCCGTGACAAGG + Intronic
1144050020 17:11490453-11490475 TTCCTCCCTGCTCGGTGACCTGG - Intronic
1144839340 17:18175977-18175999 CTCTTCCTTGATCCATCACAGGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1146957883 17:36947436-36947458 GTGTTCCTTGCTCCTTGACAAGG - Intergenic
1147260033 17:39204510-39204532 CTCTTCCCTGACCAGTGACCAGG + Exonic
1147774607 17:42891826-42891848 CTCTTCCCTTCTCTGAGTCAAGG + Intergenic
1150106125 17:62464003-62464025 CTCTTCACTGCTCTTTGAGATGG - Intronic
1150617570 17:66784136-66784158 CTCTGCCCCGCTCCCTGCCAGGG + Intronic
1151757757 17:76084277-76084299 GGCTTCCCAGCTCCGGGACAAGG - Exonic
1151814086 17:76462581-76462603 CTCTGCCCTGCTCCATGGTAGGG + Intronic
1152753741 17:82078305-82078327 TTCTTCCCTCCTCCCTGACCTGG - Intergenic
1152771781 17:82174224-82174246 CTCCTCCGTGCTCCCTGGCAAGG + Intronic
1153385090 18:4484128-4484150 CTCTTCCCTGCCTCATGACAAGG - Intergenic
1153396899 18:4632790-4632812 CCCTTCCCTGCACTGTGACCTGG - Intergenic
1154354195 18:13612368-13612390 TTATTCTCTGCTCGGTGACACGG + Intronic
1157202270 18:45669124-45669146 TTCCTCCCTGCACAGTGACAGGG - Intronic
1157478756 18:48039658-48039680 CTCTTACCTGCTTCATGTCATGG + Intronic
1157801776 18:50626980-50627002 CCCTTCCCTTCACAGTGACAAGG - Intronic
1158058414 18:53310078-53310100 CTCTCCCCTGCTCTGTGACTGGG + Intronic
1158276540 18:55774749-55774771 CTCTCCCATGCTCTGTGGCAAGG + Intergenic
1160427721 18:78789938-78789960 CTCCTCACTGCTCAGTGGCAGGG + Intergenic
1161594949 19:5146362-5146384 GTCTTCCCTGCTCCTTGAGAAGG + Intronic
1161772483 19:6238655-6238677 GTCTTCCCAGCTCCAGGACAGGG - Intronic
1161804741 19:6436379-6436401 CTCTTCCAAGCTCAGTTACATGG + Intronic
1163555467 19:17989919-17989941 CTCTTCACGGCTCCCTGCCAGGG + Intronic
1163999314 19:21082548-21082570 CTTTTCCCTGCGCAGTGACTGGG + Intronic
1165701566 19:37942422-37942444 CTCTTCCCTGATCTTTCACAAGG - Intronic
1165929629 19:39348424-39348446 CTCTTCCCCGGACCGTCACAAGG - Intronic
1166503675 19:43358620-43358642 CTCTTCCCTGCTCTCTCACTGGG - Intronic
1166506779 19:43376138-43376160 CTCTTCCCTGCTCTCTCACTGGG + Intergenic
1166859063 19:45799253-45799275 CTCTGCCCTGCTGCGTGACAGGG - Intronic
1167089916 19:47336900-47336922 CTCTTCACTGCTACCTGGCATGG + Intronic
925085676 2:1105814-1105836 CTCCTCCCTGCTCCGATGCATGG + Intronic
926783559 2:16498079-16498101 CTCGTCCCTGCTCTGTGCCCTGG - Intergenic
927041794 2:19237623-19237645 CTCTTCCCTGCCCCAGGCCATGG + Intergenic
927134736 2:20088432-20088454 CTATGCCCTGCTCTGTGCCAAGG - Intergenic
928205650 2:29281352-29281374 CGCTTCCCTTCTCCTTGACCAGG - Intronic
928257254 2:29733519-29733541 CACTTTCCTGTTCTGTGACATGG + Intronic
928434374 2:31244657-31244679 TCCTTCCCTGCTCCCTGATAAGG - Intronic
931289656 2:60861503-60861525 CTCTGCCCTGCTCTGTGCCTGGG + Intergenic
932601401 2:73129061-73129083 CTCTTCCCTCCTCTTTGCCAAGG + Intronic
933053380 2:77630222-77630244 ACCTTCCCTGCTCCCTTACATGG - Intergenic
934735288 2:96686943-96686965 CTCTTCCCTGGACCGTGACGGGG + Intergenic
934766966 2:96885120-96885142 CTCATCCCTGCTCCGTGTTTAGG - Intronic
937095735 2:119234192-119234214 CTCATCCCTGCTCCTGGGCAGGG - Intronic
937535039 2:122875751-122875773 CTCTTCCCTACTGCATTACATGG + Intergenic
937677915 2:124611932-124611954 CTCTTCCCTTCTACGTTAGATGG - Intronic
945426399 2:209709922-209709944 CTCTTCCCTGCTCTGCGAATTGG - Exonic
946007319 2:216536592-216536614 CTCTTCCCTACTGCCTTACAAGG + Intronic
946225413 2:218261703-218261725 CTCTCCCCTCCTCCAGGACAGGG - Intronic
946437451 2:219666957-219666979 CTATTCACTGCACCGTGACCTGG - Intergenic
947437474 2:230084902-230084924 CTCTTCCCTGCAACGTCACCCGG - Intergenic
948906023 2:240979916-240979938 CTCATCCCTGCTCCGTCTCTGGG + Intronic
949071798 2:242029632-242029654 CACTGCCCTGCTCCCCGACACGG - Intergenic
1169962328 20:11175046-11175068 CACTTCCGGGCTCAGTGACAGGG + Intergenic
1171274314 20:23842619-23842641 CTCTTCTCTGAGCCATGACATGG + Intergenic
1174199022 20:48794177-48794199 CCCTTCCGTGCTCAGAGACAGGG - Intronic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1175030591 20:55950004-55950026 TTCTCCCCTGCTCTGTGCCATGG - Intergenic
1176122828 20:63461802-63461824 CTCTTCCCTGCTCCCTGGGGTGG - Intronic
1176122915 20:63462074-63462096 CTCTTCCCTGCTCCCTGGGGTGG - Intronic
1176122925 20:63462104-63462126 CTCTTCCCTGCTCCCTGGGGTGG - Intronic
1179158205 21:38869444-38869466 CTCTTCACTGGACCATGACAAGG + Intergenic
1180247732 21:46559506-46559528 ATCTCCTCTGCTGCGTGACAAGG - Intronic
1180716941 22:17878235-17878257 CACTGCCCTGCTCAGTGAAAAGG + Intronic
1181470584 22:23136914-23136936 CTCTTTCCTGCTCTGTGATCTGG - Intronic
1181805681 22:25373288-25373310 CTTTTCTCTGCTCCCTGGCAGGG - Intronic
1183272071 22:36868543-36868565 CTCTTCCCTGCTCAGAGCCCAGG - Intronic
1183374521 22:37455312-37455334 CACATCCCTGCTCCGTGAACTGG + Intergenic
1184537301 22:45095871-45095893 GCCTTCCCAGCTGCGTGACATGG - Intergenic
1184978785 22:48081544-48081566 CTCTCCCCTGCGCCGTGTCCTGG + Intergenic
1185020774 22:48373648-48373670 CTCTTCCCAGCCCCGTGGCTGGG - Intergenic
951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG + Intronic
953880634 3:46689629-46689651 CTCTGCCCTGCTCCCTGCCTAGG + Intronic
955021932 3:55130270-55130292 CCCTGACCTGCCCCGTGACAGGG + Intergenic
956739099 3:72260981-72261003 CTCTACCCTGCTCTGTGTCCTGG + Intergenic
958073263 3:88641955-88641977 CTCTTCCCTTCTCAGTGATCTGG + Intergenic
961356374 3:126342409-126342431 CTCATCCCGGCTCCCTGACCTGG - Intergenic
962366539 3:134789649-134789671 CTCTTCACTCCTCCTTGAGAAGG + Intronic
962626695 3:137232394-137232416 CTGTTCCCTGCTCTCTGCCAAGG - Intergenic
962813251 3:138976715-138976737 CTCTGCCCTGCTCCCTGACCTGG + Intergenic
963712954 3:148768281-148768303 CTCTTCCTTGCTTCTAGACAGGG - Intergenic
966246401 3:177812806-177812828 CTCCTCCCTGCCCAGTGGCAAGG - Intergenic
967347765 3:188477369-188477391 CTCTGCCCTTCTCTCTGACAAGG - Intronic
968051219 3:195656337-195656359 CACTGCCCTGCTCCCCGACACGG - Intergenic
968104604 3:195992001-195992023 CACTGCCCTGCTCCCCGACACGG + Intergenic
968302895 3:197629584-197629606 CACTGCCCTGCTCCCCGACACGG + Intergenic
969701692 4:8771216-8771238 CTCTTCCCTGCTTGTTGCCAGGG - Intergenic
973532553 4:51847480-51847502 TTCTTCCCTGGTCAGTGGCAAGG + Intronic
975489401 4:74972080-74972102 CCCTTCCCTGCTCAGAGACAGGG - Intronic
976843422 4:89458495-89458517 CTCTGCTCTGCTCCATGACTTGG - Intergenic
977836895 4:101655896-101655918 CTCTTCACTGCTTCCTGAGATGG + Intronic
978396307 4:108284097-108284119 CTCTTCTCTCCTCCCTGACCTGG - Intergenic
978459978 4:108940645-108940667 CTGTTCCCTTCTCCATCACAGGG - Exonic
982669559 4:158304123-158304145 CTCCTCCCTGCAAAGTGACAAGG - Intergenic
985760438 5:1746143-1746165 CCCTTCCCTGCTCCCTGCCTCGG - Intergenic
986923794 5:12720740-12720762 CTCTTAACTGCTGTGTGACATGG + Intergenic
987740003 5:21895377-21895399 CTCTTCTCTACTCAGTGCCAGGG - Intronic
988167056 5:27606872-27606894 CACTTTCCTCCTCCATGACAAGG - Intergenic
989428921 5:41329166-41329188 ATCTTCCCTGCCCCGTCACTTGG + Intronic
990334587 5:54759619-54759641 CTTTTCCCTGCTCTGTGTCCAGG - Intergenic
994181839 5:96775903-96775925 CTCTTCCTTGCTCCATGCCCAGG - Intronic
995332355 5:110959160-110959182 CTCTGCCCTGCTCTGTGCCATGG - Intergenic
996454490 5:123664401-123664423 CTCTTCCCTCATCCATGGCAAGG - Intergenic
997447435 5:133951787-133951809 CTCTTCTGTGGTCAGTGACATGG + Intergenic
997590161 5:135067484-135067506 CTGTTTCCTCATCCGTGACATGG - Intronic
997659029 5:135576079-135576101 CTCTTCCCTTCTCCGTGCTCTGG + Intronic
998140481 5:139697134-139697156 CCCTTCCCTGCTCTGTGGGAAGG - Intergenic
998365179 5:141625872-141625894 CTCTTCCCTGCTCTGAGCCCAGG + Intronic
1000566375 5:162852454-162852476 CTCTTGCCTTCTCCCTGAAATGG - Intergenic
1001419177 5:171573899-171573921 CTTCTCCCTGCTCCCTGGCAGGG - Intergenic
1001673145 5:173491030-173491052 CTCTGCCCTGCTCTGTGCCCTGG - Intergenic
1003284594 6:4723705-4723727 CTCTGCCCTGCTCTGTGGCTTGG - Intronic
1006162684 6:32047351-32047373 CTCCTCCCTCCTCCCTGACTCGG - Intronic
1006636850 6:35467451-35467473 CACTTCCCTGCTCAATGACAAGG + Intergenic
1007399712 6:41596904-41596926 CACTTCCCAGCTCCGAGACCTGG + Intronic
1007973581 6:46077460-46077482 CTCTTCCCTGCTCTGTGGAAGGG - Intronic
1008033750 6:46724738-46724760 CTCTTCTCTGTTCAGTGACTAGG - Intronic
1012218669 6:96621018-96621040 CTCTTTGCTCCTCGGTGACAGGG - Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1016782344 6:147973329-147973351 CTCTTCCCAGGTCCGTAGCAGGG + Intergenic
1017144207 6:151219292-151219314 CCCTTCTCTGCTCCAGGACAGGG - Intergenic
1017775698 6:157679290-157679312 CCCTTCTCTCCTCCATGACACGG + Intergenic
1017775707 6:157679321-157679343 CCCTTCTCTCCTCCATGACACGG + Intergenic
1018807787 6:167274661-167274683 CACTCACCTGCTACGTGACATGG + Intronic
1019103191 6:169648728-169648750 CTCTTCCCTGTCCAGTCACAAGG + Intronic
1019191311 6:170252535-170252557 CACTTCCCTTCTCTGTGACCTGG - Intergenic
1020047585 7:5054000-5054022 TTCTTCCCTGCTCTGTGGCCTGG + Intronic
1025127296 7:56354264-56354286 TTCTTCCCTGTTCCCTGAGAGGG - Intergenic
1025602548 7:63013835-63013857 TTCTTCCCTGTTCCCTGAGAAGG - Intergenic
1027115728 7:75478369-75478391 TTCTTCCCTGCTCCATGGCCTGG - Intronic
1027120978 7:75519738-75519760 TTCTTCCCTGCTCCGTGGCCTGG - Intergenic
1029371288 7:100152569-100152591 CTCTTCCCTCTTCCTTGATATGG - Intronic
1029721812 7:102372276-102372298 TTCTTCCCTGCTCCATGGCCTGG + Intronic
1030694731 7:112572376-112572398 CTCTTCTCTGCTCTGTGCCTAGG - Intergenic
1032035191 7:128516591-128516613 CTCTTCACTGCTCTTTGAGATGG - Intergenic
1034926757 7:155129047-155129069 CACCTTCCTACTCCGTGACAGGG - Intergenic
1034996389 7:155579942-155579964 CTTTGCCAAGCTCCGTGACATGG + Intergenic
1035026039 7:155826863-155826885 CTCTGCCCTGCTCAGAGACAAGG - Intergenic
1036497104 8:9279480-9279502 CTCTTCTCTGGTCCCTGGCAAGG - Intergenic
1036588127 8:10143933-10143955 GTCTCCCCTGCTTCTTGACACGG - Intronic
1036816452 8:11906312-11906334 TTCTTCCCGGCTCTGTGCCAAGG + Intergenic
1038339636 8:26674533-26674555 CTCCTGCTTGCTCCGGGACAGGG - Intergenic
1038452120 8:27646511-27646533 CTCTGCCCTCCCCCGTGACTGGG - Intronic
1041409430 8:57536779-57536801 CTCCTCCCTGCTCTGTTACTTGG + Intergenic
1043348326 8:79326465-79326487 CTTTTCCATGCTCAGTGAGAAGG - Intergenic
1045753000 8:105508559-105508581 CTCCTCCCTTGTCAGTGACAAGG + Intronic
1048886008 8:138910507-138910529 CTGTTCCCTGGTCTGTGAAATGG + Intronic
1050793778 9:9510016-9510038 GTCTTTCCTGCTCAGTGACAAGG + Intronic
1056134736 9:83621111-83621133 CTCTTCCCTGCTCTGAGCCCAGG + Intergenic
1056781663 9:89555304-89555326 CACTTCCCTGCTCCTTCACGTGG + Intergenic
1056948648 9:91023954-91023976 CTCTACTCTGCTCCGTGACTGGG + Intergenic
1057731686 9:97614644-97614666 CTCTTCCCTGCACCTTCACATGG - Intronic
1057731940 9:97617209-97617231 CTCTTCCCTGCACCTTCACATGG - Intronic
1059439011 9:114292331-114292353 CACCTCCTTGCTCTGTGACAAGG + Intronic
1059818494 9:117945513-117945535 TTCTTCCCTGCTCAGAGACTTGG + Intergenic
1060636025 9:125200447-125200469 CTCTTCCCTGCTCCGCCCCGAGG - Intergenic
1060714373 9:125909163-125909185 CTCTTCACTTCACAGTGACAAGG + Intronic
1061543598 9:131291010-131291032 TTCTTCCCTGCTCCTTCCCAGGG + Intronic
1186843650 X:13509633-13509655 CTCTTCTCAGCTCCTTGAGAGGG + Intergenic
1190712476 X:53080761-53080783 CTCCTCTCTGCTCCGCGACAAGG + Intergenic
1193455322 X:81724730-81724752 CTCTTCCATGGTCCTTGACAGGG - Intergenic
1196084686 X:111672525-111672547 GTTTTCCCTGCTCGGTTACAGGG - Intronic
1200075505 X:153548619-153548641 CTCCTCCCCGCTCTGTGGCAGGG + Exonic
1201942461 Y:19474499-19474521 CTCTTCACTGCTATGTGTCATGG + Intergenic