ID: 951611342

View in Genome Browser
Species Human (GRCh38)
Location 3:24495140-24495162
Sequence GCGGCGCGGAGCAGGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951611342_951611350 19 Left 951611342 3:24495140-24495162 CCGGGGCGCCTGCTCCGCGCCGC 0: 1
1: 0
2: 2
3: 52
4: 300
Right 951611350 3:24495182-24495204 GGTTTCCCCTCCAGCCCTCACGG 0: 1
1: 0
2: 2
3: 28
4: 261
951611342_951611347 -2 Left 951611342 3:24495140-24495162 CCGGGGCGCCTGCTCCGCGCCGC 0: 1
1: 0
2: 2
3: 52
4: 300
Right 951611347 3:24495161-24495183 GCGTCTGCGAACCGGTGACCTGG 0: 1
1: 0
2: 0
3: 1
4: 26
951611342_951611344 -10 Left 951611342 3:24495140-24495162 CCGGGGCGCCTGCTCCGCGCCGC 0: 1
1: 0
2: 2
3: 52
4: 300
Right 951611344 3:24495153-24495175 TCCGCGCCGCGTCTGCGAACCGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951611342 Original CRISPR GCGGCGCGGAGCAGGCGCCC CGG (reversed) Intronic
900117424 1:1034530-1034552 GGGGCGCAGAGCCGGAGCCCCGG + Intronic
900240683 1:1615935-1615957 GCGGCGCGCGGCAGGCGCTCTGG + Intronic
900307882 1:2019780-2019802 GCGCCGCGGAGCAGGGGAACCGG - Intronic
900349489 1:2227966-2227988 GCGGGGCGGAGCGGGCGGCGCGG + Intergenic
900512747 1:3068251-3068273 GCGGAGAGGTGCGGGCGCCCTGG + Intergenic
900786779 1:4654691-4654713 GCCGCGCGGAGGAGGCGCGCGGG - Intergenic
900974274 1:6007507-6007529 GAGGCGCGGAGGAGGCGCAGAGG - Intronic
901055576 1:6447389-6447411 GGGGCGCGGAGCGGGCGGGCTGG + Intronic
901703912 1:11059713-11059735 GAGGCGGGCAGCAGGCGGCCCGG + Intronic
901703987 1:11059957-11059979 GCGGCGCGGGGCGCGGGCCCGGG + Exonic
902478815 1:16701248-16701270 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
902771197 1:18646585-18646607 GCGGCGGGGAGGGGGCGCCCCGG - Intronic
903072208 1:20732073-20732095 GCGGCGGGAAGCGGGCACCCAGG - Intronic
903233837 1:21937252-21937274 GCGGCGCGGAGCGGGCGGCGCGG - Exonic
903263318 1:22142793-22142815 GCGGGGCGGGGCAGGCCCCGGGG - Intronic
903785659 1:25859486-25859508 CCGGGGCGGGGCTGGCGCCCGGG - Intergenic
904500221 1:30908821-30908843 GCGGAACGGAGGAGGGGCCCGGG + Intergenic
904642108 1:31938519-31938541 GAGGAGCGGGGGAGGCGCCCAGG - Intronic
904652129 1:32013755-32013777 GCGGCGGTGCGCAGGCGCCGTGG + Intergenic
906090237 1:43172543-43172565 GTGGCGCGGAGGAGGACCCCGGG + Exonic
906299944 1:44674457-44674479 GCGGCGCCCAGGAGGCGCCCGGG - Exonic
906510014 1:46405524-46405546 GCGGGGCGGGGCAGGGGCACCGG + Intronic
907689243 1:56645603-56645625 GTCGCGCGGAGCTGGGGCCCCGG + Intronic
908714284 1:67053735-67053757 GCGGCGCGGCGCCGGCTCCCTGG - Intronic
910936206 1:92485792-92485814 GGGGCGCGCAGCAGGCGGTCTGG - Intronic
913048055 1:115089940-115089962 GCGCCGCGGAGCCGCAGCCCTGG - Intergenic
913300671 1:117366738-117366760 GCGGCGCGAGGCCGGAGCCCGGG + Intergenic
914673222 1:149887769-149887791 GCGGGTCGGGGCAGGCGCCCCGG - Exonic
914817135 1:151071226-151071248 GCGGCGCGGAGCCGGGGCCGAGG + Intronic
914899468 1:151704131-151704153 GGGGCCCGGAGCAGGGGTCCGGG + Intronic
915345472 1:155194935-155194957 GCGGCGCGGAGCCGTCGCCATGG - Intergenic
915440917 1:155945015-155945037 GCTGGGCAGAGCAGGCGGCCTGG + Intergenic
919830867 1:201539305-201539327 GCGGCGCGGACCCGGAGCCCGGG + Intergenic
920333380 1:205228136-205228158 GGGGCGCGGGGCAGCCGGCCGGG - Intergenic
920352175 1:205344331-205344353 ACGGAGCGGAGCAGGCTCGCCGG - Exonic
921155159 1:212433228-212433250 GCGGCCCGCGGCGGGCGCCCTGG + Intronic
921947284 1:220894739-220894761 GCGGCGCGGTCCAGACACCCGGG - Intergenic
922440616 1:225652922-225652944 GAGGCGCGGAGCTGGTCCCCAGG + Exonic
922586714 1:226738800-226738822 GCGGCGCGGAGTGAGCGGCCCGG + Intronic
923372654 1:233328331-233328353 GCGGCGCGGGGCTGGCGGCCGGG - Exonic
1062843795 10:689727-689749 GCCGCGCTGAGGAGGCGCCGAGG - Intronic
1064086540 10:12349785-12349807 GCGGCGCGGAGGAGCGGCCGGGG - Exonic
1064384691 10:14879306-14879328 GCGGCGTGCGGCATGCGCCCGGG + Intronic
1065021915 10:21508701-21508723 GCGGGGCAGAGCAGGCTCCGGGG - Intergenic
1066220672 10:33334804-33334826 GAGCCGCGGAGCTGGCGCCCAGG + Exonic
1066464171 10:35639322-35639344 GCGGAGGGGAGGGGGCGCCCAGG - Exonic
1067560296 10:47300477-47300499 GCTTAGCGGAGCAGGCACCCGGG - Exonic
1069738444 10:70672620-70672642 GCGGCGCCGCGCAGGGGACCCGG + Intergenic
1072190863 10:93075109-93075131 GCGGCGGTGAGCAGACGCCCAGG - Intronic
1073100239 10:101002654-101002676 GCGGGGAGGAGCTGGCCCCCCGG - Exonic
1073109118 10:101050380-101050402 GCGGCGCGGGGCAGGCGGGCGGG - Intergenic
1074585996 10:114768208-114768230 GCTGCGCGGAGCGGGCGGCCAGG - Intergenic
1074753735 10:116609735-116609757 GCGGCGCGGAGGCGGGGCCCAGG + Intergenic
1074865683 10:117543242-117543264 GCGCCGAGGAGCGGGCGCCCTGG - Exonic
1076096358 10:127737294-127737316 GCGGGGCCGAGGAGGGGCCCAGG - Exonic
1076216503 10:128697964-128697986 GCGGCGCTGAGCAGTTGCCTGGG - Intergenic
1076329526 10:129654291-129654313 AGGGCGTGGAGCAGGTGCCCAGG + Intronic
1076864434 10:133160113-133160135 GAGGGGCGGAGCCGGCGCCCAGG - Intergenic
1076895281 10:133308586-133308608 GCGGGGCGGAGCGGGCCTCCGGG - Exonic
1077016312 11:400503-400525 GGGGCGCGGGGCAGGGGCGCGGG - Intronic
1077545025 11:3165416-3165438 GCCGCGCGGAGCGGGCGCCCAGG + Intronic
1079076715 11:17389120-17389142 CCGGCGCGGAGCGGGAGCCGCGG - Intronic
1081662099 11:44894538-44894560 TCTGCACGGAGCAGGGGCCCAGG - Intronic
1082802838 11:57427057-57427079 CCGGCGCGGAGCAGGCGGGTAGG - Exonic
1083170542 11:60921829-60921851 GCTGTGGGGAGCAGGGGCCCTGG + Exonic
1083579049 11:63813435-63813457 GCGGCGGGGGGCAGGGGCCCCGG + Exonic
1083644923 11:64166416-64166438 CCGCGGCGGAGCAGGCGCGCCGG + Intergenic
1083921077 11:65781528-65781550 GGGGCGAGGAGCCGGCGCCGCGG + Intergenic
1084174370 11:67415840-67415862 GCCGCGGGGAGCGGGCGCCCGGG - Intronic
1084192122 11:67504074-67504096 GCGGCGGGGAGAGGGCACCCGGG - Intronic
1084212209 11:67629501-67629523 GCGGCGAGGACGTGGCGCCCCGG + Intronic
1086981052 11:93197976-93197998 GCGGCGAGGAGCATGCGCAGTGG + Intergenic
1091259573 11:134223931-134223953 GCGGCGGCGAGCCGGTGCCCTGG - Exonic
1092108928 12:5945360-5945382 GCTGCGCGGCGCCGGCGGCCGGG - Intronic
1092743233 12:11649858-11649880 GCGGCGCGGCGCGGGGACCCGGG - Exonic
1092861827 12:12725251-12725273 GGAGCGCGGGGCAGGCGCGCGGG - Intergenic
1092999649 12:13982173-13982195 GCGGCCGGGAGGAGGCGCCACGG - Intergenic
1096435853 12:51590955-51590977 GCGGCGCGCTGCAGGCGAGCGGG + Intronic
1097190395 12:57216790-57216812 GAGGCGCGGAGCCGGCGCTGGGG - Exonic
1098828537 12:75330312-75330334 GCGCCGCGGAGCCGGTTCCCTGG - Intronic
1101813768 12:108129871-108129893 GCTGAGCTCAGCAGGCGCCCGGG - Intronic
1103400611 12:120640789-120640811 GCGGCGCGGCGCGGGGCCCCCGG - Exonic
1103565776 12:121814579-121814601 GCGGGTAGGGGCAGGCGCCCTGG - Exonic
1103828694 12:123762110-123762132 GAGGCGCGCACCAGGCCCCCGGG - Intergenic
1104826208 12:131711273-131711295 GCGGCGCGAAGGAGGAGGCCGGG + Exonic
1104929316 12:132329679-132329701 GGGGGGCGGGGCAGGCGCGCGGG - Intergenic
1104976416 12:132553947-132553969 GTGGAGCGGAGCAGCTGCCCAGG - Intronic
1105054107 12:133081169-133081191 GAGGCGCGGAGCGGGGGCCACGG + Intronic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1106182677 13:27381898-27381920 GGGGCACGGGGCAGGAGCCCGGG + Intergenic
1106304092 13:28495037-28495059 GCGGCTCGGAGCGGGCTCCGGGG - Exonic
1111672623 13:91348572-91348594 GCGGAGCGGGGGTGGCGCCCAGG - Intergenic
1112507048 13:99981634-99981656 GCGGCGCGGCGCTCGCCCCCCGG + Intergenic
1113378908 13:109786073-109786095 GCGGCCCGGGCCCGGCGCCCAGG + Exonic
1113775600 13:112943383-112943405 GCGGCGCGGAGCCGGGGACCGGG - Intronic
1113775658 13:112943586-112943608 GAGGCCCCGTGCAGGCGCCCAGG + Intronic
1113977083 13:114235392-114235414 CTGGCGCGGAGGAGGTGCCCAGG + Intronic
1114213213 14:20633516-20633538 GCGCTGCGGAGCAGGCGCCAAGG - Intergenic
1114865996 14:26597143-26597165 GGGGCGCGGGGCAGGGGCGCAGG + Intronic
1115651266 14:35404265-35404287 TCGGGGCGGTGCAGGAGCCCCGG + Intronic
1117424428 14:55580278-55580300 GCGCCTCGGAGCGGGCGGCCCGG + Intronic
1118285275 14:64465409-64465431 GCGGAGCGGAGCGGGCGGGCAGG - Intronic
1118971554 14:70642097-70642119 GCGGCGCGCACCAGGCGCCGGGG + Exonic
1121342701 14:93115039-93115061 GGGACGCGGCGCCGGCGCCCGGG - Intronic
1121648004 14:95534482-95534504 GCGGCGCTCCGGAGGCGCCCGGG + Intronic
1122144956 14:99683741-99683763 TCCGGGCGGAGGAGGCGCCCCGG + Intergenic
1122614575 14:103008290-103008312 GCGGGGAGCAGCAGGCGCCAGGG + Intronic
1122775926 14:104116955-104116977 GGCGCGCGGAGCAGGTCCCCGGG + Intergenic
1122908685 14:104815774-104815796 GCCGCCACGAGCAGGCGCCCGGG - Intergenic
1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG + Exonic
1122947730 14:105020863-105020885 CCGGGGCGGAGGCGGCGCCCGGG - Intronic
1124370757 15:29103603-29103625 GCCCCGCGGAGCCGGCTCCCCGG + Intronic
1124652325 15:31483266-31483288 GCGGCGCGGCGCGGGCGGCGAGG - Exonic
1125771851 15:42173269-42173291 GTGGCGAGGAGCAGGTACCCTGG - Intronic
1127674823 15:61228971-61228993 GCGGCCGGGAGCGGGCGCCCGGG - Intronic
1128067865 15:64775617-64775639 GCGGCGGGGGGCGGGCGCCGGGG + Intergenic
1129940841 15:79495407-79495429 GCGGGGTGGGGCAGGCTCCCTGG + Intergenic
1130040923 15:80404602-80404624 CCGGAGCGGACCAGGCGCGCCGG + Intronic
1130370851 15:83284471-83284493 TGTGCGCGGAGCAGGCGGCCCGG - Intronic
1130517143 15:84634080-84634102 GCGGCGCGGGGCCGGAGTCCTGG - Intergenic
1130540348 15:84817363-84817385 GCGGCGGCGGGCAGGGGCCCGGG + Exonic
1132314427 15:100879807-100879829 GCGGCGGGGAGCTGCCACCCCGG + Exonic
1132500070 16:281164-281186 GCGGCGCAGAGCCTGAGCCCAGG + Intronic
1132666415 16:1083126-1083148 GCGGCGCGGAGCAAACATCCTGG + Intergenic
1132978347 16:2721388-2721410 GGGGCGCGGCGCGGGCGGCCAGG + Intergenic
1133063386 16:3189457-3189479 GCGTCGCGGAGGAGGGGCCGGGG + Intergenic
1135745825 16:25015352-25015374 GCGGCGCGGCGGTGGCTCCCCGG + Intronic
1136517286 16:30775675-30775697 TCAGCGCGCTGCAGGCGCCCCGG + Exonic
1136548606 16:30969470-30969492 TCGGCCAGGAGCCGGCGCCCGGG - Intronic
1137300288 16:47143085-47143107 GCCGCGAGGTGCAGGCGCCGCGG + Intronic
1137926611 16:52547007-52547029 GGGGCGCGGCGCTGGGGCCCGGG + Exonic
1139615204 16:68084737-68084759 GCGGGGCGGAGCTTTCGCCCCGG - Intronic
1140221588 16:73048038-73048060 GGGGCGCGGCGCTGGCGTCCGGG + Exonic
1140222993 16:73057896-73057918 CCGGCCCGGAGCAGTCGCCGCGG - Intronic
1142505062 17:357977-357999 GCGGGGAGGAGCAGCCACCCAGG - Intronic
1142638264 17:1270923-1270945 GGGGCGCGGGGCTGGCGCGCAGG - Exonic
1142811291 17:2396786-2396808 GCGGAGCGGGGCGGGCGTCCGGG - Intronic
1146162873 17:30569478-30569500 GCAGAGCAGAGCAGGCGCACTGG - Intergenic
1146182952 17:30709107-30709129 GCGGCGCGGAGCTGGCGGAGAGG - Intergenic
1146283462 17:31559565-31559587 GGGGCGCGGGGCAGGAGCCGTGG - Intergenic
1147168746 17:38606238-38606260 CCGGCTCGGAGGAGGCACCCGGG + Intergenic
1147250254 17:39149046-39149068 GGGGTGCAGAGCAGGGGCCCAGG - Intronic
1147636321 17:41966738-41966760 GGGGGGCGGAGCGGGCACCCGGG - Exonic
1147934653 17:44004796-44004818 GCGGTGCTGAGCCGGCGCCCCGG - Exonic
1148139188 17:45316618-45316640 GGGGCGCAGAGCAGGCGGGCGGG + Intronic
1148225471 17:45895644-45895666 GAGGCGCGGGGCTGGCGCGCAGG + Intronic
1148782598 17:50130088-50130110 GCGGCGGGGAGGAGGCGGCTGGG + Intergenic
1149314027 17:55421959-55421981 GGGGCGGGGCGCAGGAGCCCCGG - Exonic
1149849683 17:60027189-60027211 GCTGCGCGGTGGAGGGGCCCTGG - Intergenic
1149860485 17:60119335-60119357 GCTGCGCGGTGGAGGGGCCCTGG + Intergenic
1150002915 17:61452477-61452499 GCGGCGCGGAGTCGGAGCCCCGG + Intronic
1151708357 17:75784790-75784812 GTGGCGCGGCGCAGGCGCACTGG + Exonic
1152377402 17:79925793-79925815 GCTGCGCGGAGCCAGCGTCCAGG - Intergenic
1152728951 17:81960660-81960682 GCTGCGCGGAGCAGGGGTACAGG + Exonic
1152744277 17:82031871-82031893 GCGGGGCGGGGGTGGCGCCCGGG + Intronic
1152924134 17:83079820-83079842 GGGGCGCGGCGCGGGCGGCCTGG + Exonic
1153457596 18:5296519-5296541 GCGTCTCGGAGCGGGCGCCCCGG + Intronic
1153769934 18:8407392-8407414 GTGGCGCAGAGCAGGTGCTCTGG - Intergenic
1153997452 18:10454576-10454598 GCGGCACGGAGGAGGGGCCCTGG - Intergenic
1154216500 18:12420285-12420307 GCGGCGGTGAGCAAGCGCCGGGG - Intronic
1157095095 18:44680187-44680209 GCGGCGAGCGGCGGGCGCCCCGG - Intronic
1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG + Intergenic
1160507197 18:79433865-79433887 GAGGCGGTGAGCAGCCGCCCGGG - Intronic
1160543624 18:79638651-79638673 GCAGCTCGGAGCCGTCGCCCTGG + Intergenic
1160736151 19:663239-663261 GCGGGGCGGAGCGGGGGCGCGGG + Exonic
1160786120 19:900852-900874 AAGGCGCGGAGGAGGGGCCCTGG - Exonic
1160862093 19:1241782-1241804 CCGGCGCGGCGCGGGCGGCCTGG - Exonic
1161349905 19:3785815-3785837 GTGGCCCGGCGCTGGCGCCCAGG - Intronic
1161388003 19:4007262-4007284 GCAGCGCGGTGCAGGCTCCACGG - Intergenic
1161401523 19:4067738-4067760 CCCGCGCGGACCAGGCGTCCAGG - Intergenic
1161585879 19:5105165-5105187 GCGGGGCAGAGCAGGAGGCCAGG + Intronic
1161905079 19:7150454-7150476 CCTGCGCGGAGCAGGCACCAGGG + Intronic
1162013220 19:7830405-7830427 GCCGGCCTGAGCAGGCGCCCGGG - Intronic
1162893049 19:13747869-13747891 GGGGCGCGGAGAGGGCGCCCAGG + Intronic
1162975846 19:14206661-14206683 GCGGCGCGGAGCTGGCGGAGGGG + Intergenic
1163390371 19:17026903-17026925 GATGGGCGGAGCAGGCGTCCCGG - Intergenic
1163502833 19:17686770-17686792 GCGGCGGGGAGCGGGCGGGCGGG + Intronic
1163669374 19:18618361-18618383 GCCGGGCGGGGCAGGCGCTCGGG + Exonic
1163823098 19:19507539-19507561 GCGGCTCGGATCTGGCCCCCTGG - Exonic
1165080164 19:33302291-33302313 GCTGCGCGGGGCCCGCGCCCCGG + Exonic
1165305487 19:35000452-35000474 GCGGCGCGGTGGGCGCGCCCCGG - Exonic
1165414507 19:35684067-35684089 GCGGCAGAGAGCAGGTGCCCTGG + Intergenic
1165744843 19:38224351-38224373 ACGGCGCGGAGGAGGGGCCCGGG + Intronic
1166347797 19:42177120-42177142 GCGGCGCGGCGCAGCCGGGCGGG - Intronic
1166536612 19:43578619-43578641 GCGGCGGGGAGCAGGTGCCATGG + Intronic
1168339658 19:55615785-55615807 GCGGGCGGGAGCAGGCGCTCGGG - Exonic
1202712834 1_KI270714v1_random:27079-27101 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
926095737 2:10079945-10079967 GCGGCGCGGGGCGGGCTCCGGGG + Exonic
927956749 2:27212253-27212275 GCGGCCCGGTCCAGTCGCCCTGG - Exonic
928313907 2:30231817-30231839 CCGGCACGAAGCAGGCGCCCGGG - Intronic
932567834 2:72920681-72920703 GCGGCGCGGTCCCGGCGCGCGGG + Intronic
932599256 2:73112742-73112764 GGGGCGCGGAGCCGGCGGCGGGG - Exonic
932702696 2:74002375-74002397 GCGGAGCGGAGCAGACGCCGGGG - Intronic
935361709 2:102251124-102251146 GTGGCGCCGAGCGGGCGCCGGGG + Intergenic
938338908 2:130522756-130522778 GGGGCGCGGGGCTGACGCCCGGG + Intronic
938350930 2:130597994-130598016 GGGGCGCGGGGCTGACGCCCGGG - Intronic
941951573 2:171161119-171161141 GCCGCGCGGCGCGGGAGCCCGGG + Intronic
942459588 2:176159980-176160002 AAGGCGCGTAGCAGGCGACCCGG - Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
942947135 2:181683678-181683700 GCGGCGCGGGCCGGGCGTCCCGG + Intergenic
943725223 2:191245687-191245709 AAGGCGCGGAGCAGGCGCCTCGG - Intronic
944933677 2:204545672-204545694 TGGGCGCGGAGCAGCCGCCTGGG + Intergenic
945080764 2:206085241-206085263 GCGGGGCGGGGCGGGCGGCCTGG - Intronic
946321992 2:218959795-218959817 GCAGAGCGGGGCCGGCGCCCAGG - Exonic
947800951 2:232928245-232928267 GCGGCGGGGCGGGGGCGCCCGGG + Intronic
948206968 2:236167626-236167648 GCGACGCGGAGAAGCCGCCGGGG + Exonic
948461041 2:238130147-238130169 GCCCCACGGAGCAGGCGGCCTGG + Exonic
948829175 2:240589426-240589448 GCAGCGCGGCGCAGGCACACAGG - Exonic
948874372 2:240819275-240819297 GCGGCGCGCCCCCGGCGCCCGGG - Intronic
949042318 2:241855101-241855123 GGGGGGCGGAACAGGAGCCCAGG - Intronic
1168760725 20:347873-347895 GGGGCGGGGCGCAGGCACCCGGG - Intronic
1169065864 20:2693756-2693778 GCGCCGCGGTGCTGGCGTCCAGG - Exonic
1169068897 20:2709730-2709752 GAGGAGCGGAGCAGCCCCCCCGG + Intronic
1171427620 20:25058331-25058353 GCGGGGCGGAGCAGGGTCCCAGG + Intronic
1172042001 20:32052465-32052487 GAGACGAGGAGCGGGCGCCCAGG + Exonic
1172474483 20:35226750-35226772 CCGGCGCGGCGCGGCCGCCCCGG - Exonic
1172702929 20:36863683-36863705 GCCGGGCGGAGCCGGGGCCCGGG - Exonic
1172944044 20:38674398-38674420 GCGGCGCGGAGCAGCTGGTCCGG + Intergenic
1175517252 20:59577472-59577494 GCGGAGCGGAGCCGGGGCCGCGG - Intergenic
1175856271 20:62122524-62122546 GCGGTGGCGAGGAGGCGCCCAGG + Exonic
1175994093 20:62804705-62804727 GGGGCGCGGGGCGGGCGTCCCGG + Intergenic
1178351166 21:31873733-31873755 GCGGCGCGGAGGACGCGGCCAGG + Exonic
1178843604 21:36156886-36156908 GCGGCGCGGAGGAGCCCTCCGGG - Intronic
1180031252 21:45210005-45210027 TCCCCGCGGAGCAGGCTCCCCGG + Intronic
1180109767 21:45642557-45642579 GCGGCGCTGAGCGCCCGCCCCGG - Intergenic
1180179439 21:46111482-46111504 GGAGCACGGAGCAGGTGCCCTGG - Exonic
1180707425 22:17818146-17818168 GGGGGGCTGAGCAGGCTCCCGGG + Exonic
1181017556 22:20080079-20080101 GCGGGAGGGACCAGGCGCCCAGG - Intergenic
1181068813 22:20320130-20320152 GCAGGGCGGGGCAGGCGGCCAGG - Intergenic
1181079709 22:20405744-20405766 GCAGCGCGGGGCGGGCGCCGGGG + Exonic
1181333320 22:22111418-22111440 GCAGGGAGGAGCAGGGGCCCCGG - Intergenic
1181532132 22:23522776-23522798 GGGGCGAGGAGCAGGGCCCCGGG - Intergenic
1182036591 22:27203229-27203251 GCGGGGCAGAGTAGGCGCTCTGG + Intergenic
1183166051 22:36148283-36148305 GCCGTGCAGGGCAGGCGCCCTGG + Intronic
1183295060 22:37024527-37024549 GCGGGGCGGAGTAGAGGCCCTGG - Exonic
1183486348 22:38089362-38089384 GGGGCGCGGAGAACGCGCCGGGG + Intronic
1183546301 22:38456061-38456083 GCGGCGCGGAGCAGGGGCTGGGG + Intergenic
1183590592 22:38777302-38777324 GAGGTGGGGAGCAGGCGCCGAGG - Intronic
1184253789 22:43275875-43275897 GGGGGGCGGAGAAAGCGCCCCGG + Intronic
1184265260 22:43343000-43343022 GCTGCGGGGAGGGGGCGCCCCGG + Intronic
1184412170 22:44331705-44331727 GCGGCGCGGAGCTGGGGCCGGGG + Intergenic
1184472240 22:44702446-44702468 TGGGCGCGGCGCAGGCGGCCCGG + Intronic
1184640384 22:45867235-45867257 GCGGCGCGGCGGAGCGGCCCTGG + Intergenic
1184663362 22:45975725-45975747 GCGGCGCACAGTAGGCGCGCAGG + Intronic
1185267721 22:49913229-49913251 GCGGCTCAGAGCAGGTGCTCAGG - Intronic
1185332077 22:50256404-50256426 TCGGGACGGAGCAGGTGCCCTGG + Intronic
951543862 3:23806704-23806726 GAGGCGGGGAGCGGGTGCCCGGG - Intronic
951611342 3:24495140-24495162 GCGGCGCGGAGCAGGCGCCCCGG - Intronic
952416837 3:33097192-33097214 GCGGGGCTGAGCAGGCGCGAGGG - Exonic
953464404 3:43106073-43106095 GCGGCTCTGCGCAGGCGCACAGG - Exonic
954409683 3:50365010-50365032 GCGGCACGGAGGGGGCGCGCGGG + Intronic
954763975 3:52897564-52897586 GCGGCGCGGAGTCGGCGGCCGGG - Exonic
961775133 3:129279015-129279037 GCGACGCGGAGAGGGCGGCCTGG + Intronic
962891586 3:139677527-139677549 GCAGCGCGGAGCTGTCCCCCCGG + Intronic
963904628 3:150763250-150763272 GCCGGGCGGAGCCAGCGCCCCGG - Exonic
963939651 3:151086163-151086185 GCGGCTCCGGGCAGGCGCCGAGG - Intronic
965882042 3:173397772-173397794 GCGGCGCGGAGAGCGCGCCCGGG + Intronic
966886398 3:184380031-184380053 ACGGGCCGGAGCCGGCGCCCGGG + Intronic
967924141 3:194633231-194633253 GCGGCGCGGGGCCGGGGACCTGG + Exonic
968074858 3:195810664-195810686 GTGGTGCGGAGGAGGCGGCCAGG - Intronic
968384649 4:125195-125217 GCCACGCGGAGGAGGCGCACAGG - Exonic
968401795 4:304752-304774 GCCACGCGGAGGAGGCGCACAGG + Intronic
968405874 4:338528-338550 GCCACGCGGAGGAGGCGCACAGG - Intronic
968410641 4:386848-386870 GCCACGCGGAGGAGGCGCACAGG - Intergenic
968419643 4:473428-473450 GCCACGCGGAGGAGGCGCACAGG + Intronic
968542988 4:1177759-1177781 GGGGCGCGGCACAGGCACCCAGG + Intronic
969298052 4:6281134-6281156 GCGGACAGGAGCAGGAGCCCTGG + Intronic
970637052 4:18021447-18021469 GCGGCGCGGCGCGGCGGCCCCGG - Intronic
977573976 4:98658300-98658322 CCGGCGGGGAGCAGGAGCTCAGG + Exonic
983077463 4:163343790-163343812 CTGGCGCGGAGCAGGCGCCTTGG + Intronic
984823544 4:183905442-183905464 GCTGCGTGGACCCGGCGCCCCGG + Exonic
985769738 5:1801466-1801488 GCGGCGCGGAGCCTGCCCCTGGG + Exonic
986330522 5:6713664-6713686 GCGGCGCGGGGCGGGCGCGGGGG - Intergenic
988796443 5:34656785-34656807 GGGGCGCGGGGCAGGGGCCGCGG + Intronic
992473137 5:77077330-77077352 GCGCCGCGGCCCAGGCGCGCCGG - Exonic
992550247 5:77852708-77852730 ACGTCGCGGAGCATGCGCCATGG - Intronic
992627532 5:78648823-78648845 GCGGCGCGGGGCCGGGGCCTGGG - Exonic
999696224 5:154190612-154190634 GCGGCGCGGGGCGGGCGGCTCGG + Intronic
1001543746 5:172557260-172557282 GCCGCGCAGAGGAGACGCCCCGG + Intergenic
1002276024 5:178104871-178104893 GCGGACCAGAGCAGGGGCCCGGG + Intergenic
1002351991 5:178589927-178589949 GCGGCTCGGCCCAGGCGTCCAGG + Exonic
1002724602 5:181286301-181286323 GCGGACCAGAGCAGGGGCCCAGG - Intergenic
1004614882 6:17280825-17280847 GCGGCGCGGCGCTGGGGCTCGGG - Intergenic
1006634554 6:35452580-35452602 AGGGCGTGGAGCCGGCGCCCTGG + Exonic
1006717614 6:36130485-36130507 GCGGCGCGGGGCGGGCGCAGCGG + Exonic
1014246813 6:119078513-119078535 ACGGCGCGGGGCAGATGCCCGGG + Exonic
1015024928 6:128520736-128520758 GCGGCGCGGGGCGCGCGGCCGGG - Intergenic
1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG + Intronic
1015366357 6:132401499-132401521 GCGGCGGCGAGCGGGAGCCCAGG + Exonic
1016328228 6:142927014-142927036 GCGGCGCGGGGCGGGCGGCCAGG + Intronic
1016329848 6:142945056-142945078 GGCGCGCGGCGCAGGCGGCCGGG - Intronic
1017021401 6:150143069-150143091 GCGGCGCAGAGCAGGTGCCGGGG + Exonic
1017021524 6:150143566-150143588 GCGCCCCGGAGCTGGAGCCCGGG - Intronic
1018050808 6:160006178-160006200 GTGGGGCGCAGCAGGCGCACAGG - Intronic
1018679772 6:166253996-166254018 GCGGGGCCGCGTAGGCGCCCGGG - Intergenic
1018856273 6:167677520-167677542 GCTGCACTAAGCAGGCGCCCAGG - Intergenic
1019425688 7:975564-975586 GGAGCGCCGAGCAGGCACCCCGG + Exonic
1020106159 7:5423267-5423289 CCGGCGGGGAGGGGGCGCCCCGG - Intronic
1020235045 7:6348785-6348807 GCGGCGCGGAGAGGGCGGGCGGG - Exonic
1022410315 7:30134926-30134948 GCGGGGCGGAGGAGGAGCCGCGG + Exonic
1022923524 7:35038057-35038079 GTGGGGCCGACCAGGCGCCCAGG - Intronic
1023067201 7:36389775-36389797 GGGGCGGGGAGAGGGCGCCCCGG + Intronic
1024043875 7:45574599-45574621 GGGGCGCCGAGCGGGCGGCCGGG + Exonic
1024639360 7:51316849-51316871 GCGGCGCGGGGCGGGGGCGCCGG + Intergenic
1027001811 7:74658734-74658756 GCCCCGCGGGGCAGGCGCGCCGG - Intronic
1029701356 7:102248719-102248741 GCGGGGCTGGGCAGGGGCCCCGG - Exonic
1030176522 7:106660490-106660512 GCGGCCAGGAGGAGGCGCCGCGG - Exonic
1032306028 7:130733482-130733504 CCGCCGCGGATCAGGCGCCCCGG - Exonic
1033207398 7:139434762-139434784 GCGGTGCGGCGCGGGCGGCCAGG + Intergenic
1035354277 7:158267607-158267629 GGGGCGAGGGGCAGGCCCCCAGG - Intronic
1035635198 8:1139111-1139133 GCGGCCGGCAGCAGGCGCTCAGG - Intergenic
1035747621 8:1973708-1973730 GCCGCGCGGAGCCAGCGCTCCGG - Intergenic
1035751966 8:2002518-2002540 GCGCCACGGCGAAGGCGCCCCGG - Exonic
1035752005 8:2002724-2002746 GCGGCGAGGCGCAGGCGGCGGGG + Exonic
1036776036 8:11613700-11613722 CGGGCCCGGAGCAGCCGCCCAGG + Intergenic
1036803266 8:11808601-11808623 GCGGGGCGGTGCCTGCGCCCGGG - Intronic
1037845119 8:22275785-22275807 TCAGCGCGGAGCACGCACCCAGG + Intronic
1038933388 8:32220419-32220441 ACGGAGCGGAGCAGGGGCTCGGG + Intronic
1039212688 8:35235335-35235357 GCGGCGCTGGGCTGGGGCCCGGG - Intergenic
1040951421 8:52941316-52941338 GCCGCGCGGAGCCGACGCCTGGG - Intergenic
1041689940 8:60678898-60678920 GCGCCGCGGAGGAGGCGGCCCGG + Exonic
1049235017 8:141508087-141508109 GGGTCGCGGAGCAGGCGGCGGGG - Intergenic
1049411453 8:142475651-142475673 GCGGGGCGGAGCCGGAGCCCTGG + Intronic
1049416992 8:142499810-142499832 CCGGCACCGAGCAGGCACCCAGG - Intronic
1049419576 8:142510837-142510859 GGGGCGCGGAGCCGCCGCTCGGG + Intronic
1049682061 8:143923668-143923690 GCGGCGAGGCGGAGGCGGCCCGG - Exonic
1049689935 8:143953938-143953960 GCGGCCGGGAGCATGCGCCCGGG - Intronic
1049765657 8:144354176-144354198 GCGGCGCGGGGCCGGCCCTCAGG + Intronic
1053050504 9:34957880-34957902 GCGGCCCGGAGGGGGCGCCTTGG - Intronic
1053055157 9:34989673-34989695 GCGGCGCGGAGGCGGAGCCGTGG + Exonic
1053198262 9:36136437-36136459 TCGGCGCAGAGCAGCCACCCGGG + Intergenic
1055611811 9:78031700-78031722 GCGGCGAGGAGCGGGCGCGCCGG - Intergenic
1057432318 9:95005231-95005253 GCGGCGCGGTCCCTGCGCCCCGG + Intronic
1058684090 9:107465708-107465730 GCGGCGCGGAGCGGGTAGCCAGG + Intergenic
1059208449 9:112487376-112487398 GCGGCCCGGGGCAGGCGGACCGG - Intronic
1060643863 9:125261778-125261800 GCGGCGCTGCGCACGCGCGCTGG + Intronic
1060696623 9:125714523-125714545 GAGGCGTGGACCAGGCACCCAGG + Intergenic
1060806260 9:126579174-126579196 GGGGCTGGGAGCAGGCGGCCCGG - Intergenic
1061208456 9:129177419-129177441 GGGGCGCGGAGCAGGCGGCCGGG + Exonic
1061248402 9:129413321-129413343 GGGGCGAGGAGCAGGGCCCCGGG + Intergenic
1061481889 9:130901577-130901599 GTGGCCCGGAGCAGGTGCGCAGG + Intergenic
1061844057 9:133376647-133376669 GCGGCGAGGGGCCCGCGCCCTGG + Intronic
1062294779 9:135818663-135818685 GCGCCGCGGCGCAGGCGTCGTGG - Intronic
1062341385 9:136095213-136095235 GCGGCGCGCCGCAGCTGCCCAGG - Exonic
1062472455 9:136712486-136712508 GCGGCGCGGCGGGGGCGCGCGGG - Intergenic
1062596812 9:137303280-137303302 CAGGCGCGGAGCAGGAGGCCAGG + Intergenic
1062636371 9:137493709-137493731 GCGCCTCGGAGCAGGAGCCCTGG - Intronic
1062653455 9:137590186-137590208 GCGGCGCGGAGCCCGCGACCCGG - Intronic
1203792572 EBV:159700-159722 GAGGCGAGGAGGAGGCGTCCCGG - Intergenic
1187915578 X:24149910-24149932 GCGGCGCCGAGCAGGCCCCGAGG + Intronic
1189398888 X:40647151-40647173 GCGGCGGTGAGGAGGGGCCCAGG + Intronic
1189611861 X:42745538-42745560 GTGTCGAGGAGCAGGGGCCCTGG - Intergenic
1200138531 X:153886255-153886277 GCGGGGCGGGGCGGGCGGCCGGG - Intronic
1201788395 Y:17809569-17809591 GCGGGGCGAAGGAGGCGGCCTGG + Intergenic
1201813158 Y:18096419-18096441 GCGGGGCGAAGGAGGCGGCCTGG - Intergenic