ID: 951614443

View in Genome Browser
Species Human (GRCh38)
Location 3:24525536-24525558
Sequence CTGTATGACAAGGAAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951614436_951614443 9 Left 951614436 3:24525504-24525526 CCCCGTGAGAAAGCCTGGGGTAT No data
Right 951614443 3:24525536-24525558 CTGTATGACAAGGAAGAGAAGGG No data
951614439_951614443 -4 Left 951614439 3:24525517-24525539 CCTGGGGTATACAACCTAACTGT No data
Right 951614443 3:24525536-24525558 CTGTATGACAAGGAAGAGAAGGG No data
951614430_951614443 25 Left 951614430 3:24525488-24525510 CCTTGTGGCCTTACCTCCCCGTG No data
Right 951614443 3:24525536-24525558 CTGTATGACAAGGAAGAGAAGGG No data
951614431_951614443 17 Left 951614431 3:24525496-24525518 CCTTACCTCCCCGTGAGAAAGCC No data
Right 951614443 3:24525536-24525558 CTGTATGACAAGGAAGAGAAGGG No data
951614437_951614443 8 Left 951614437 3:24525505-24525527 CCCGTGAGAAAGCCTGGGGTATA No data
Right 951614443 3:24525536-24525558 CTGTATGACAAGGAAGAGAAGGG No data
951614434_951614443 12 Left 951614434 3:24525501-24525523 CCTCCCCGTGAGAAAGCCTGGGG No data
Right 951614443 3:24525536-24525558 CTGTATGACAAGGAAGAGAAGGG No data
951614438_951614443 7 Left 951614438 3:24525506-24525528 CCGTGAGAAAGCCTGGGGTATAC No data
Right 951614443 3:24525536-24525558 CTGTATGACAAGGAAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951614443 Original CRISPR CTGTATGACAAGGAAGAGAA GGG Intergenic
No off target data available for this crispr