ID: 951617705

View in Genome Browser
Species Human (GRCh38)
Location 3:24566884-24566906
Sequence GAGGGTGAACTGAAGCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951617694_951617705 24 Left 951617694 3:24566837-24566859 CCTGGTTTATCTCATTGGGAATG No data
Right 951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951617705 Original CRISPR GAGGGTGAACTGAAGCAGGC GGG Intergenic
No off target data available for this crispr