ID: 951625950

View in Genome Browser
Species Human (GRCh38)
Location 3:24663252-24663274
Sequence GAGCCCCATGGGCCTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951625950_951625955 -8 Left 951625950 3:24663252-24663274 CCTGGGGGAGGCCCATGGGGCTC No data
Right 951625955 3:24663267-24663289 TGGGGCTCTTTCTCAGGTCTGGG No data
951625950_951625954 -9 Left 951625950 3:24663252-24663274 CCTGGGGGAGGCCCATGGGGCTC No data
Right 951625954 3:24663266-24663288 ATGGGGCTCTTTCTCAGGTCTGG No data
951625950_951625959 23 Left 951625950 3:24663252-24663274 CCTGGGGGAGGCCCATGGGGCTC No data
Right 951625959 3:24663298-24663320 GCAAGGCTGTTTGGCAGCTCCGG No data
951625950_951625958 14 Left 951625950 3:24663252-24663274 CCTGGGGGAGGCCCATGGGGCTC No data
Right 951625958 3:24663289-24663311 GACAGAGGTGCAAGGCTGTTTGG No data
951625950_951625956 -1 Left 951625950 3:24663252-24663274 CCTGGGGGAGGCCCATGGGGCTC No data
Right 951625956 3:24663274-24663296 CTTTCTCAGGTCTGGGACAGAGG No data
951625950_951625957 6 Left 951625950 3:24663252-24663274 CCTGGGGGAGGCCCATGGGGCTC No data
Right 951625957 3:24663281-24663303 AGGTCTGGGACAGAGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951625950 Original CRISPR GAGCCCCATGGGCCTCCCCC AGG (reversed) Intergenic
No off target data available for this crispr