ID: 951629759

View in Genome Browser
Species Human (GRCh38)
Location 3:24706798-24706820
Sequence GACACTGCCACCTACATAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951629759_951629765 11 Left 951629759 3:24706798-24706820 CCCCCTATGTAGGTGGCAGTGTC No data
Right 951629765 3:24706832-24706854 AGAACCTGGCATTTGTAGCTAGG No data
951629759_951629766 12 Left 951629759 3:24706798-24706820 CCCCCTATGTAGGTGGCAGTGTC No data
Right 951629766 3:24706833-24706855 GAACCTGGCATTTGTAGCTAGGG No data
951629759_951629764 -3 Left 951629759 3:24706798-24706820 CCCCCTATGTAGGTGGCAGTGTC No data
Right 951629764 3:24706818-24706840 GTCACACAGTGGTGAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951629759 Original CRISPR GACACTGCCACCTACATAGG GGG (reversed) Intergenic
No off target data available for this crispr