ID: 951634414

View in Genome Browser
Species Human (GRCh38)
Location 3:24757227-24757249
Sequence CAGGACCACATGAAGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951634414_951634417 -8 Left 951634414 3:24757227-24757249 CCAGAAAACTTCATGTGGTCCTG No data
Right 951634417 3:24757242-24757264 TGGTCCTGTAGGGCTAGAAGAGG No data
951634414_951634419 0 Left 951634414 3:24757227-24757249 CCAGAAAACTTCATGTGGTCCTG No data
Right 951634419 3:24757250-24757272 TAGGGCTAGAAGAGGAGATTTGG No data
951634414_951634420 1 Left 951634414 3:24757227-24757249 CCAGAAAACTTCATGTGGTCCTG No data
Right 951634420 3:24757251-24757273 AGGGCTAGAAGAGGAGATTTGGG No data
951634414_951634421 6 Left 951634414 3:24757227-24757249 CCAGAAAACTTCATGTGGTCCTG No data
Right 951634421 3:24757256-24757278 TAGAAGAGGAGATTTGGGCCAGG No data
951634414_951634422 14 Left 951634414 3:24757227-24757249 CCAGAAAACTTCATGTGGTCCTG No data
Right 951634422 3:24757264-24757286 GAGATTTGGGCCAGGCGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951634414 Original CRISPR CAGGACCACATGAAGTTTTC TGG (reversed) Intergenic
No off target data available for this crispr