ID: 951636542

View in Genome Browser
Species Human (GRCh38)
Location 3:24784701-24784723
Sequence CCTCATTGAGATCATCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951636538_951636542 11 Left 951636538 3:24784667-24784689 CCTGACAGATGGGACAGTCTAGT No data
Right 951636542 3:24784701-24784723 CCTCATTGAGATCATCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951636542 Original CRISPR CCTCATTGAGATCATCATAG GGG Intergenic
No off target data available for this crispr