ID: 951640355

View in Genome Browser
Species Human (GRCh38)
Location 3:24829286-24829308
Sequence GCTCGCTGCGCCCCGCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951640355_951640362 7 Left 951640355 3:24829286-24829308 CCAGGGGGCGGGGCGCAGCGAGC No data
Right 951640362 3:24829316-24829338 CCGCTGTCTGCTCTCAGCGGCGG No data
951640355_951640359 4 Left 951640355 3:24829286-24829308 CCAGGGGGCGGGGCGCAGCGAGC No data
Right 951640359 3:24829313-24829335 CTCCCGCTGTCTGCTCTCAGCGG No data
951640355_951640368 23 Left 951640355 3:24829286-24829308 CCAGGGGGCGGGGCGCAGCGAGC No data
Right 951640368 3:24829332-24829354 GCGGCGGCGGCAGGGGCTGAGGG No data
951640355_951640366 16 Left 951640355 3:24829286-24829308 CCAGGGGGCGGGGCGCAGCGAGC No data
Right 951640366 3:24829325-24829347 GCTCTCAGCGGCGGCGGCAGGGG No data
951640355_951640363 10 Left 951640355 3:24829286-24829308 CCAGGGGGCGGGGCGCAGCGAGC No data
Right 951640363 3:24829319-24829341 CTGTCTGCTCTCAGCGGCGGCGG No data
951640355_951640365 15 Left 951640355 3:24829286-24829308 CCAGGGGGCGGGGCGCAGCGAGC No data
Right 951640365 3:24829324-24829346 TGCTCTCAGCGGCGGCGGCAGGG No data
951640355_951640367 22 Left 951640355 3:24829286-24829308 CCAGGGGGCGGGGCGCAGCGAGC No data
Right 951640367 3:24829331-24829353 AGCGGCGGCGGCAGGGGCTGAGG No data
951640355_951640364 14 Left 951640355 3:24829286-24829308 CCAGGGGGCGGGGCGCAGCGAGC No data
Right 951640364 3:24829323-24829345 CTGCTCTCAGCGGCGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951640355 Original CRISPR GCTCGCTGCGCCCCGCCCCC TGG (reversed) Intergenic
No off target data available for this crispr