ID: 951641146

View in Genome Browser
Species Human (GRCh38)
Location 3:24836951-24836973
Sequence ATGTCCATCAATAAACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951641144_951641146 -7 Left 951641144 3:24836935-24836957 CCAGTCTAAAGGTTGGATGTCCA No data
Right 951641146 3:24836951-24836973 ATGTCCATCAATAAACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951641146 Original CRISPR ATGTCCATCAATAAACAGGA AGG Intergenic
No off target data available for this crispr