ID: 951643212

View in Genome Browser
Species Human (GRCh38)
Location 3:24859110-24859132
Sequence TCTTTGTATTTAGCCCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951643210_951643212 14 Left 951643210 3:24859073-24859095 CCTTAATACTCTTATTAGAAGCT No data
Right 951643212 3:24859110-24859132 TCTTTGTATTTAGCCCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951643212 Original CRISPR TCTTTGTATTTAGCCCTACC TGG Intergenic
No off target data available for this crispr