ID: 951645232

View in Genome Browser
Species Human (GRCh38)
Location 3:24882796-24882818
Sequence CTGGTTAAGCACATGTCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951645232_951645240 21 Left 951645232 3:24882796-24882818 CCTATAGACATGTGCTTAACCAG No data
Right 951645240 3:24882840-24882862 AACCCATGATTGGTTGATGAAGG No data
951645232_951645238 11 Left 951645232 3:24882796-24882818 CCTATAGACATGTGCTTAACCAG No data
Right 951645238 3:24882830-24882852 CCGTTCTCCTAACCCATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951645232 Original CRISPR CTGGTTAAGCACATGTCTAT AGG (reversed) Intergenic
No off target data available for this crispr