ID: 951649310

View in Genome Browser
Species Human (GRCh38)
Location 3:24932020-24932042
Sequence AGGTATCCAAAGATGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951649310_951649316 14 Left 951649310 3:24932020-24932042 CCAAGTTCCATCTTTGGATACCT No data
Right 951649316 3:24932057-24932079 AAATAGAAACTCCCAACTTGGGG No data
951649310_951649315 13 Left 951649310 3:24932020-24932042 CCAAGTTCCATCTTTGGATACCT No data
Right 951649315 3:24932056-24932078 CAAATAGAAACTCCCAACTTGGG No data
951649310_951649314 12 Left 951649310 3:24932020-24932042 CCAAGTTCCATCTTTGGATACCT No data
Right 951649314 3:24932055-24932077 ACAAATAGAAACTCCCAACTTGG No data
951649310_951649318 25 Left 951649310 3:24932020-24932042 CCAAGTTCCATCTTTGGATACCT No data
Right 951649318 3:24932068-24932090 CCCAACTTGGGGAGCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951649310 Original CRISPR AGGTATCCAAAGATGGAACT TGG (reversed) Intergenic
No off target data available for this crispr