ID: 951651900

View in Genome Browser
Species Human (GRCh38)
Location 3:24959786-24959808
Sequence AAGAACAAGGGGAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951651890_951651900 25 Left 951651890 3:24959738-24959760 CCTTGATGTTCCACAAAAAAGAA No data
Right 951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG No data
951651892_951651900 15 Left 951651892 3:24959748-24959770 CCACAAAAAAGAAAAGAGAGGAA No data
Right 951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951651900 Original CRISPR AAGAACAAGGGGAATGAGGC AGG Intergenic
No off target data available for this crispr