ID: 951655889

View in Genome Browser
Species Human (GRCh38)
Location 3:25007902-25007924
Sequence GGGTGACCTTGGGCAAATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951655881_951655889 27 Left 951655881 3:25007852-25007874 CCTGGGGTCAGATGATCATAGTT No data
Right 951655889 3:25007902-25007924 GGGTGACCTTGGGCAAATTATGG No data
951655882_951655889 -1 Left 951655882 3:25007880-25007902 CCATGCTCGCTTTATACCCACAG No data
Right 951655889 3:25007902-25007924 GGGTGACCTTGGGCAAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951655889 Original CRISPR GGGTGACCTTGGGCAAATTA TGG Intergenic
No off target data available for this crispr