ID: 951657190

View in Genome Browser
Species Human (GRCh38)
Location 3:25022792-25022814
Sequence GTGGCAAGAAGCAGCATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951657186_951657190 10 Left 951657186 3:25022759-25022781 CCAGGAAGAGGGAATGGCATTGT No data
Right 951657190 3:25022792-25022814 GTGGCAAGAAGCAGCATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951657190 Original CRISPR GTGGCAAGAAGCAGCATGGT GGG Intergenic
No off target data available for this crispr