ID: 951663345

View in Genome Browser
Species Human (GRCh38)
Location 3:25095051-25095073
Sequence TCACTGGACCAGAGGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951663345_951663347 -8 Left 951663345 3:25095051-25095073 CCTTCTGGCCTCTGGTCCAGTGA No data
Right 951663347 3:25095066-25095088 TCCAGTGATTTTTTTCCCTTTGG No data
951663345_951663351 20 Left 951663345 3:25095051-25095073 CCTTCTGGCCTCTGGTCCAGTGA No data
Right 951663351 3:25095094-25095116 GACTTAATCTCAAGATTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951663345 Original CRISPR TCACTGGACCAGAGGCCAGA AGG (reversed) Intergenic
No off target data available for this crispr