ID: 951668729

View in Genome Browser
Species Human (GRCh38)
Location 3:25156372-25156394
Sequence CTCAAACAGATGGGATTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951668729_951668734 -1 Left 951668729 3:25156372-25156394 CCCTGGAATCCCATCTGTTTGAG No data
Right 951668734 3:25156394-25156416 GTGGATGCAGTAAAATGTCATGG No data
951668729_951668735 7 Left 951668729 3:25156372-25156394 CCCTGGAATCCCATCTGTTTGAG No data
Right 951668735 3:25156402-25156424 AGTAAAATGTCATGGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951668729 Original CRISPR CTCAAACAGATGGGATTCCA GGG (reversed) Intergenic
No off target data available for this crispr