ID: 951669256

View in Genome Browser
Species Human (GRCh38)
Location 3:25162007-25162029
Sequence ATGTATCAGCAGAACCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951669250_951669256 23 Left 951669250 3:25161961-25161983 CCAAGACAGACAGACACACAAGA No data
Right 951669256 3:25162007-25162029 ATGTATCAGCAGAACCTGTGTGG No data
951669254_951669256 -8 Left 951669254 3:25161992-25162014 CCTCACACCTTGGGCATGTATCA No data
Right 951669256 3:25162007-25162029 ATGTATCAGCAGAACCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951669256 Original CRISPR ATGTATCAGCAGAACCTGTG TGG Intergenic
No off target data available for this crispr