ID: 951670039

View in Genome Browser
Species Human (GRCh38)
Location 3:25170921-25170943
Sequence CAGACAGGAGGTAGCATGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951670039_951670043 -4 Left 951670039 3:25170921-25170943 CCAATCATGCTACCTCCTGTCTG No data
Right 951670043 3:25170940-25170962 TCTGGCGTTTTGTTTATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951670039 Original CRISPR CAGACAGGAGGTAGCATGAT TGG (reversed) Intergenic
No off target data available for this crispr