ID: 951671037

View in Genome Browser
Species Human (GRCh38)
Location 3:25182347-25182369
Sequence GCACCATGCCCAGTACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951671037_951671040 6 Left 951671037 3:25182347-25182369 CCATGGGGTACTGGGCATGGTGC 0: 1
1: 0
2: 1
3: 18
4: 187
Right 951671040 3:25182376-25182398 CAGCGATATGCAGAAGACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
951671037_951671042 15 Left 951671037 3:25182347-25182369 CCATGGGGTACTGGGCATGGTGC 0: 1
1: 0
2: 1
3: 18
4: 187
Right 951671042 3:25182385-25182407 GCAGAAGACCCAGGGAAAGCAGG 0: 1
1: 0
2: 7
3: 102
4: 837
951671037_951671041 7 Left 951671037 3:25182347-25182369 CCATGGGGTACTGGGCATGGTGC 0: 1
1: 0
2: 1
3: 18
4: 187
Right 951671041 3:25182377-25182399 AGCGATATGCAGAAGACCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951671037 Original CRISPR GCACCATGCCCAGTACCCCA TGG (reversed) Intronic
900601173 1:3503249-3503271 GCACACTGCCCAGTGCCCTAGGG - Intronic
900660147 1:3778096-3778118 GCTCCAGCCCCAGTACCCCCAGG + Intergenic
900825742 1:4925302-4925324 GCACTAAGCCTAGTACCCAATGG + Intergenic
902146731 1:14407992-14408014 TCACTTTGCCCAGTTCCCCATGG - Intergenic
903832207 1:26182223-26182245 GCCCCCTGCCCAGAACCACAGGG - Intronic
905926340 1:41752477-41752499 GCACCAGCCCCTGTGCCCCATGG - Intronic
906585086 1:46968582-46968604 TCTCCCTCCCCAGTACCCCAAGG + Intergenic
907651864 1:56302818-56302840 TCACCATGCTCTGTGCCCCAGGG - Intergenic
909682239 1:78304969-78304991 GCACAATGCCCAGTACCCAGGGG + Intronic
910622752 1:89273949-89273971 CCACCGTGCCCAGTCCCTCATGG - Intergenic
912525185 1:110277677-110277699 GCCCCAGACCCAGTACCCCCAGG + Intronic
916143215 1:161717756-161717778 GTACCCAGCCCAGTAGCCCAAGG + Intergenic
919974002 1:202599186-202599208 GCTCCATGCCTAGGAACCCAGGG + Intronic
921055399 1:211538934-211538956 GCACCATGCCCAGTCCCTATGGG - Intergenic
921366246 1:214377415-214377437 GTATTAAGCCCAGTACCCCATGG - Intronic
923336759 1:232977470-232977492 ACACCATCCCGAGTGCCCCAGGG - Intronic
924667796 1:246091170-246091192 CCAACATGCCCAGCAACCCATGG - Intronic
1066196287 10:33103516-33103538 ACAGCATGCCCAGTACCACCTGG - Intergenic
1068655578 10:59571741-59571763 GCACAATGCCCAGTGCTCCATGG - Intergenic
1071192522 10:83118511-83118533 GCACCATGACCAGCTCCCTATGG - Intergenic
1072628502 10:97129770-97129792 ACTCCATGCCCGGTACCCGATGG - Intronic
1074087375 10:110218670-110218692 GTACCTTGCCCAGCACCCCCTGG + Intronic
1074831968 10:117255544-117255566 GCACCATGCCCCCTCCCCCAGGG - Intronic
1075342475 10:121658482-121658504 GCACTAAGCCTAGTACCCAATGG - Intergenic
1075452608 10:122562450-122562472 CCACCAGGCCCAGGACCTCAGGG + Intronic
1075700722 10:124467995-124468017 CCACCATGCCCAGCCCCCAAGGG + Intronic
1075780837 10:125016166-125016188 CCACCCTTCCCAGTGCCCCAAGG + Intronic
1076267262 10:129118504-129118526 CCACCATGCCCAGGACCCTCAGG - Intergenic
1076443380 10:130495658-130495680 GGTCCCTGCCCAGTCCCCCATGG + Intergenic
1078255733 11:9657109-9657131 CCACCATGCCCAGCCCCTCAAGG + Intergenic
1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG + Intergenic
1081856719 11:46308585-46308607 GCAACATGCCCAGAACACAAAGG - Intronic
1081992991 11:47347604-47347626 GCACCATCCGCAGACCCCCAGGG - Intronic
1082784065 11:57307261-57307283 GCAACCTGCCCAGGACCACAAGG + Intronic
1083947585 11:65933011-65933033 CCACCGTGCCCAGCCCCCCATGG + Intergenic
1088286969 11:108199677-108199699 CCAACATTCCCAGTACCCGAGGG - Intronic
1089338754 11:117743594-117743616 GCTCCAGGCCCAGTTCCCCAGGG + Intronic
1092223565 12:6731603-6731625 GCAGCATTCCCAGGACCCAAGGG - Exonic
1092413966 12:8275455-8275477 CCACCGTGCCCAGAAGCCCATGG - Intergenic
1094842616 12:34348412-34348434 CCAGGATCCCCAGTACCCCAAGG + Intergenic
1095789622 12:46150533-46150555 CCTCCATGCCCACTTCCCCAAGG - Intergenic
1101402862 12:104403517-104403539 GCTCCATGCCCAGCACCTAATGG + Intergenic
1102390768 12:112547002-112547024 GCCACAGGGCCAGTACCCCAGGG + Intergenic
1103566822 12:121820244-121820266 TCACCTGGCCCAGCACCCCAGGG - Intronic
1103709988 12:122905301-122905323 CCACCATGCCCGGTCCCTCATGG - Intergenic
1104761588 12:131300169-131300191 GCCCAGTGCCCAGTGCCCCAGGG + Intergenic
1104887493 12:132119185-132119207 GCACCATCCCAGGTACCCAAAGG + Intronic
1118935036 14:70279908-70279930 GTACTAAGCCCAGTACCCAATGG - Intergenic
1120386137 14:83848257-83848279 GGAACATGCCCAGGAGCCCAGGG + Intergenic
1120819889 14:88902245-88902267 GCCCCATGGACAGAACCCCAGGG - Intergenic
1121328753 14:93036615-93036637 TCACCAGGCTCAGCACCCCAGGG + Intronic
1121340751 14:93103739-93103761 GCACTAGGACAAGTACCCCAGGG + Intronic
1122820596 14:104342930-104342952 GGTCCAAGCCCAGGACCCCATGG - Intergenic
1124017648 15:25891067-25891089 GCACCCAGCCCCCTACCCCAAGG - Intergenic
1124190263 15:27568927-27568949 GCCCCATCCTCAGGACCCCAGGG - Intergenic
1125509763 15:40286652-40286674 TCACCTGCCCCAGTACCCCAAGG + Intronic
1128683774 15:69669065-69669087 GTTCCATGCCCAGGAGCCCAGGG + Intergenic
1128766880 15:70256639-70256661 GAACCATGCCGAGGAACCCAGGG + Intergenic
1128801281 15:70498661-70498683 GCCACATGCCCAGGACACCATGG + Intergenic
1129178143 15:73854871-73854893 TCACCCTGCCCAGGAACCCAAGG + Intergenic
1130231321 15:82099474-82099496 GCAACTTGCCCAGTATCACAGGG - Intergenic
1130547429 15:84867446-84867468 GCCCCAGGCCCAGCACCTCAGGG - Intronic
1130647407 15:85741204-85741226 GCAGCAGGCCCAGTACCTCGAGG + Exonic
1132867246 16:2099603-2099625 GCTCCATTCCCAGTACTCCCGGG + Intronic
1133670385 16:8012984-8013006 TTTCCATGCCCGGTACCCCAGGG - Intergenic
1134094628 16:11411368-11411390 GCACCTTGTCCAGTGCCCCCAGG + Intronic
1134524528 16:14933512-14933534 GCTCCATTCCCAGTACTCCCGGG - Intronic
1134548372 16:15127429-15127451 GCTCCATTCCCAGTACTCCCCGG + Intronic
1134712117 16:16331999-16332021 GCTCCATTCCCAGTACTCCCGGG - Intergenic
1134719974 16:16375292-16375314 GCTCCATTCCCAGTACTCCCGGG - Intergenic
1134947452 16:18336593-18336615 GCTCCATTCCCAGTACTCCCGGG + Intronic
1134954712 16:18376695-18376717 GCTCCATTCCCAGTACTCCCGGG + Intergenic
1136184228 16:28576289-28576311 GTATTATGCCCAGTACCCGATGG - Intronic
1137277007 16:46941950-46941972 GCACCATGCCCTGTTTCTCAGGG + Intergenic
1139429159 16:66901850-66901872 GATCCATGCCCAGAACCACAAGG - Intergenic
1141430003 16:83966470-83966492 GCACCATCCTTTGTACCCCAAGG - Intergenic
1141446369 16:84061320-84061342 GCTCCACTCCCAGTGCCCCAGGG + Intronic
1141602891 16:85137122-85137144 GCACCATCCCCAGAAACTCAGGG + Intergenic
1141755742 16:85989483-85989505 GCCCCATCCCCAGCACCTCAGGG - Intergenic
1142030316 16:87835299-87835321 ACCCCATGCCCAGGTCCCCATGG + Intronic
1142513595 17:413082-413104 GCACCATCCCCAGCAGGCCAAGG + Intronic
1143239923 17:5435253-5435275 CCAACAGGGCCAGTACCCCAGGG + Intronic
1144782694 17:17815891-17815913 GGTCCGTGCTCAGTACCCCATGG - Exonic
1145880636 17:28350434-28350456 TCACCCTGCCCACTACCCCTCGG + Exonic
1147240759 17:39089172-39089194 GGGCCAGGCACAGTACCCCAAGG - Intronic
1147384702 17:40074314-40074336 ACACCATGCCCTGCGCCCCAAGG - Exonic
1147999564 17:44379912-44379934 GCACCCAGCTCAGTGCCCCAGGG + Intronic
1149477859 17:56978144-56978166 GCTCCATGACAAGTACCGCACGG - Exonic
1149658996 17:58324714-58324736 GCACCGTGCTCAGAACCCCAAGG - Intronic
1152294928 17:79461575-79461597 GCACACTGCCCATTTCCCCATGG + Intronic
1152388789 17:79991018-79991040 GCACCGTCCACAGTAGCCCATGG - Intronic
1152392551 17:80011354-80011376 GCACCTTTCCAAGTACACCAGGG + Intronic
1152640187 17:81445998-81446020 GTCCCATGCCCAGTGCCCCCAGG - Intronic
1153198339 18:2625065-2625087 ACACCATGGCAAGGACCCCAGGG + Intergenic
1153621141 18:6979260-6979282 GCAGCATGCCCAGTTTCCCCAGG + Intronic
1155767535 18:29653613-29653635 ACCCCATGCCCAGTACCCTGTGG - Intergenic
1157356162 18:46936450-46936472 CCACCATGCCCAGCACCCCCAGG - Intronic
1159097356 18:63919422-63919444 GTACAATGCCCAGTACCTCTTGG + Intronic
1160141142 18:76324337-76324359 GCGCCAAGCCCAGGACCCCATGG + Intergenic
1160748203 19:721112-721134 GCACCAAGCCTCCTACCCCAGGG - Intronic
1161584368 19:5097076-5097098 GCACCATCCCCATCACCCGATGG - Intronic
1163360184 19:16841024-16841046 GCACCATCCCCAGCACACAAGGG - Intronic
1163416083 19:17187285-17187307 GGACAAAGCCCAGCACCCCATGG - Intronic
1163823713 19:19511147-19511169 AAGCCATGCCCACTACCCCAAGG + Intergenic
1163831841 19:19550708-19550730 GCCCCATGCCCTGAACGCCACGG - Intergenic
1164628678 19:29746711-29746733 TCACCAGGCACAGGACCCCAAGG + Intergenic
1166327418 19:42059661-42059683 TCCCCAAGCCCATTACCCCATGG - Intronic
1166894385 19:46014986-46015008 GCCCCATTCCCACTACTCCATGG - Intronic
1167671161 19:50854699-50854721 GCACCAGGCCCTGTAGCTCATGG - Intergenic
1168709624 19:58491520-58491542 ACACCATGCCCAGTGCCCTTTGG - Intronic
926971118 2:18468472-18468494 CCTCCATGGCCACTACCCCAGGG - Intergenic
928932458 2:36637886-36637908 GCACCCTGGCCATTACCACATGG - Intronic
929668538 2:43852146-43852168 GCACCATGCCCAGCACGTCGAGG + Intronic
930370766 2:50498472-50498494 CCACCATGCCCCATACCACAAGG + Intronic
933744172 2:85558588-85558610 GCATCATGCCCAGTGCCCCTGGG + Exonic
933839933 2:86278409-86278431 GCTCCAGGCCCAGTATCCCTGGG - Intronic
934858346 2:97742832-97742854 CCAACATGCCCACTATCCCAAGG + Intergenic
935725050 2:106016490-106016512 GCACCAAGCTCAGTACCCACAGG + Intergenic
937303696 2:120858315-120858337 GCCACATGCCAAGTACCACAAGG - Intronic
938798444 2:134738330-134738352 CCACCATGAGCAGTTCCCCAGGG + Intergenic
942011131 2:171763391-171763413 TCACCCTGTCCAGTACCCCAGGG - Intergenic
944035574 2:195290755-195290777 GGACCATTCCCACTACCACAAGG + Intergenic
947520135 2:230839100-230839122 GGACCAGGCCCAGCTCCCCAAGG + Intergenic
948756084 2:240160447-240160469 GGACCATGCACAGGACCACAGGG - Intergenic
948843627 2:240672535-240672557 GCACCATGGCCACAACCTCATGG + Intergenic
948902821 2:240964864-240964886 GAACCATGCCCAGCAGCACACGG + Intronic
1170032814 20:11959989-11960011 GCACCCTGCCCAGACCCCCAGGG - Intergenic
1171175011 20:23045180-23045202 GCTCCATGCACAGTGCCCTATGG - Intergenic
1173596926 20:44264489-44264511 GCACCATGGCCAGTTCCCCGAGG - Exonic
1173812659 20:45965692-45965714 GCCCCACCCCCAGTACCCCAAGG - Exonic
1175787557 20:61721646-61721668 GCACCATGCACATTTCCCCTTGG + Intronic
1176122746 20:63461554-63461576 GGACCATGGCCAGCACCCCGGGG + Intronic
1176370652 21:6059917-6059939 GCAGCCTCCCCAGTACCCCATGG + Intergenic
1178943296 21:36925511-36925533 GCAGCACGTCCAGTTCCCCAAGG + Intronic
1179531520 21:42022660-42022682 GCACCTTGCCCAGCGCCCCGCGG - Intergenic
1179577748 21:42318315-42318337 GCCCGATGCCCACTACCGCACGG - Intergenic
1179752867 21:43478624-43478646 GCAGCCTCCCCAGTACCCCATGG - Intergenic
1180954257 22:19734495-19734517 GTCCCATGCCAAGGACCCCAGGG - Intergenic
1181165344 22:20980164-20980186 GCACCTTAGCCAGTACTCCAGGG - Intronic
1181442151 22:22942189-22942211 GCCCCATGACCAGCACCCCGAGG + Intergenic
1182114252 22:27746087-27746109 GGAATATGCCCAGTAACCCATGG - Intergenic
1182453050 22:30432551-30432573 GGCCCATGCCAAGTCCCCCAGGG - Intergenic
1183343845 22:37296196-37296218 GCATCTTGTCCAGTGCCCCATGG + Intronic
1183483554 22:38077643-38077665 CCACCCTCCCCAGGACCCCAGGG + Intergenic
1184041703 22:41947819-41947841 GCAACATGGCCAGATCCCCATGG - Intergenic
1185332068 22:50256385-50256407 GCACCAAGCCCAGCAGCCCTCGG + Intronic
951671037 3:25182347-25182369 GCACCATGCCCAGTACCCCATGG - Intronic
952037577 3:29221198-29221220 CCTCCATGCCCAGAACCTCAAGG + Intergenic
954131795 3:48564742-48564764 GCTCAGTGCCCAGTTCCCCACGG + Intronic
954390179 3:50264602-50264624 GCCCCATACCCAGTACTCCTGGG + Intergenic
956468476 3:69541985-69542007 GCGCCGTGCCAAGTGCCCCAGGG + Intronic
957147988 3:76448426-76448448 GCACCAAGGCCAGTTCACCAAGG + Intronic
958730864 3:97958911-97958933 GCACCCTGCCCTGAAACCCAGGG + Intronic
959388057 3:105737651-105737673 ACACCATGCCTAATACCACATGG + Intronic
962850674 3:139306362-139306384 CCCCCATCCCCAGTACCCCAGGG - Intronic
964458374 3:156893876-156893898 GGGCCATGTCCATTACCCCAAGG - Intronic
969517936 4:7658855-7658877 GCACAGTGCCCAGTCCCCCATGG - Intronic
969593672 4:8136174-8136196 ACACCATGCCCAGTCCCAGAAGG + Intronic
969752167 4:9119630-9119652 GCACCACGTCCGGTACACCAAGG + Intergenic
973151370 4:46892541-46892563 TCACCTTGTCAAGTACCCCAAGG - Intronic
973992814 4:56427517-56427539 CCACCATGCCTAGTGCCTCATGG - Intronic
974823217 4:67094768-67094790 TGACCATACCCACTACCCCATGG + Intergenic
975731707 4:77343835-77343857 CCAACATTCCCAATACCCCATGG - Intronic
975816763 4:78225135-78225157 GCACCATGCTCAGCACTCAAAGG - Intronic
978479650 4:109174674-109174696 CCACCATCCCCAGAACTCCAGGG + Intronic
985866508 5:2518507-2518529 GTACCTTTCCCAGGACCCCAAGG + Intergenic
986200720 5:5575826-5575848 GCTCCATGCCCTGTGCTCCATGG + Intergenic
989255145 5:39358420-39358442 GCACCCTTCCCTGTTCCCCAGGG - Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
994500905 5:100576289-100576311 TCACCAGGCACAGTACCTCAAGG + Intronic
999937229 5:156500751-156500773 GCCCCATGCCCAGGACTCCTAGG - Intronic
1000284938 5:159818959-159818981 GCACAAAGCCCTGTGCCCCAAGG + Intergenic
1005181956 6:23116042-23116064 CCAACATGCCCAGCAACCCATGG + Intergenic
1010582430 6:77616082-77616104 GCTCAAAGCCCAGGACCCCATGG - Intergenic
1018384846 6:163292709-163292731 CCACCATGCCCAGTCCCCAATGG + Intronic
1018969815 6:168519304-168519326 GCACCTGGCCCAGGAGCCCAGGG - Intronic
1020840668 7:13213651-13213673 CCACCATGCCCAGAAGCTCAAGG - Intergenic
1022339126 7:29452004-29452026 GCAACCTGCCCAGGACCCTAAGG - Intronic
1025270802 7:57512433-57512455 ACAGCATGCCTAGGACCCCAGGG - Intergenic
1027515209 7:79133855-79133877 GCCCCATGCCTAGTACTCCAGGG + Intronic
1028213182 7:88100800-88100822 CCACCATGCCCAGCCTCCCAAGG + Intronic
1031342742 7:120624491-120624513 CCACCATGCCCAGCCCACCATGG - Intronic
1032270674 7:130402054-130402076 CCACCATGCCCAGCAGCTCATGG - Intronic
1040342567 8:46448352-46448374 GCACCATGGTCAGTCGCCCAGGG + Intergenic
1041432183 8:57794919-57794941 CCACCCTGCTAAGTACCCCATGG + Intergenic
1043810632 8:84735149-84735171 GTACCAAGCCGAATACCCCAAGG + Intronic
1048977543 8:139681439-139681461 GCCCCATGCCCAGAGCTCCAGGG + Intronic
1049019029 8:139941245-139941267 GCACCATGACCAGGACCCTGGGG + Intronic
1049299278 8:141861234-141861256 CCAGCCTGCCCAGCACCCCATGG - Intergenic
1049544837 8:143225770-143225792 GCACCCTGCCCAGCACCCCAAGG - Intergenic
1049594462 8:143477036-143477058 GCTCCATCCCCAGTACCACCAGG - Intronic
1050131770 9:2420381-2420403 GCACTATGCTCAGTACTTCACGG - Intergenic
1053083181 9:35194510-35194532 CCAACATGCCCAGCAACCCATGG + Intronic
1053238835 9:36479506-36479528 TCACCATGCCCAGAAGACCAGGG + Intronic
1056576774 9:87860397-87860419 CCACCATGCTAAGTACCCCCGGG - Intergenic
1056812881 9:89777832-89777854 GCACCTGGCCCAGAAACCCAGGG - Intergenic
1057706733 9:97399994-97400016 GCAACATGCTCAGGAACCCAGGG - Intergenic
1059711802 9:116874392-116874414 GCAGCATGCCCAGTGCACTAAGG - Intronic
1061057762 9:128233351-128233373 GCAGCATGAGCAGTACCCCGCGG - Intronic
1061193113 9:129093733-129093755 GCCACTTGCCCAGTGCCCCAAGG - Intergenic
1061393447 9:130330420-130330442 GCACCATGCCCAGTGCACTGAGG + Intronic
1186352701 X:8756632-8756654 CCACCATGCCCAGCACCAAATGG + Intergenic
1187396550 X:18924370-18924392 GCACCATGCTCAGTAACTCCAGG - Exonic
1191215844 X:57931637-57931659 GCAACAAGTCCAGTTCCCCAAGG - Intergenic
1192681423 X:73257633-73257655 GCATCATACCCTGTGCCCCAGGG - Intergenic
1196812611 X:119640688-119640710 TCACCCTGCACAGTGCCCCAAGG + Exonic
1198477907 X:137013252-137013274 GCAATTTGCCCACTACCCCAGGG + Intergenic