ID: 951673865

View in Genome Browser
Species Human (GRCh38)
Location 3:25215211-25215233
Sequence CTGGCTACAGAGAACCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951673865 Original CRISPR CTGGCTACAGAGAACCACCT GGG (reversed) Intronic
902690765 1:18109072-18109094 CTGGCTCCGGAGAACCCGCTCGG - Intronic
902851685 1:19163224-19163246 CTAGCTTCTGAGAACCACTTTGG - Intronic
907775541 1:57510660-57510682 CTTGCTTAAGAAAACCACCTTGG + Intronic
908563552 1:65331202-65331224 ATGGCTACAAAGAACCAACCAGG - Intronic
909019003 1:70410983-70411005 CTGGCTCCTGAGAGCCACCCGGG - Intergenic
918251655 1:182708439-182708461 CTGTCTACAGAGGCACACCTGGG + Intergenic
919054324 1:192550738-192550760 CTGTCTCCAGCGAACCTCCTGGG - Intergenic
919081650 1:192874342-192874364 CTGGCTACTCAGAGCCACCCTGG + Intergenic
919373606 1:196763532-196763554 CAGGGGATAGAGAACCACCTGGG - Intergenic
919838437 1:201592514-201592536 CTGCCTACAGAGCACCAGCCTGG - Intergenic
922182685 1:223247711-223247733 CTGGCTGCACAGAATCACCTGGG + Intronic
922794793 1:228334710-228334732 CTGGCTGTGGAGAGCCACCTGGG + Intronic
1063273834 10:4541714-4541736 CTGGCTACAGATGCCCAGCTGGG - Intergenic
1064544286 10:16435775-16435797 CTGGCTTCTGTGAATCACCTTGG - Intergenic
1064838363 10:19560871-19560893 ATGGGTACAGAAAACCACCATGG + Intronic
1068056923 10:52022995-52023017 ATGGGTACAGCAAACCACCTTGG - Intronic
1069583368 10:69579915-69579937 CTGCCTAAAGAGAATCACCATGG - Intergenic
1071467571 10:85955479-85955501 TTGACTACAGAGACCCTCCTAGG - Intronic
1071564661 10:86665501-86665523 CTGCCTACAGAGCATCTCCTGGG - Intronic
1075401914 10:122167101-122167123 CTGGCCACTGAAAACCACCCAGG + Intronic
1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG + Intergenic
1077266292 11:1652336-1652358 CTGGCAGCAGAGACCCACGTTGG + Intergenic
1079946915 11:26755067-26755089 CAGGCAACGGAGAACCACCCAGG + Intergenic
1081236255 11:40650803-40650825 CTGGCCAAAGAGAACTACCATGG - Intronic
1081243592 11:40736092-40736114 ATGGGTACAGAAAACCACCATGG - Intronic
1081714631 11:45240552-45240574 CTGGGCACAGAGAATCAGCTAGG - Exonic
1083540197 11:63506961-63506983 CTGGCTTCAGAAAACCTCTTGGG - Intronic
1084036060 11:66511085-66511107 CTGGTTCCAGAGACTCACCTAGG - Exonic
1084421232 11:69061669-69061691 CTGGCCACTGGGACCCACCTGGG - Intronic
1085276625 11:75304348-75304370 CTGACCACAGAGAACCCTCTCGG - Intronic
1087712786 11:101572920-101572942 ATGGCTACAGCAAACCACCATGG + Intronic
1088694481 11:112355131-112355153 GTGTCTACAGAGAACCTGCTGGG - Intergenic
1091199045 11:133757620-133757642 CTAGCTGAAGAGAACCACATTGG + Intergenic
1091330268 11:134726343-134726365 CTGGTCACAGAGCAGCACCTGGG - Intergenic
1093197107 12:16142536-16142558 CTGGCTACAGGGATTCATCTGGG - Intergenic
1094245945 12:28293692-28293714 CAGACTACAGAGAACCAAATAGG - Intronic
1094657119 12:32431074-32431096 GTGGCTACAGAGAATCTCCCAGG - Intronic
1095701251 12:45193437-45193459 ATGGCCCCAGGGAACCACCTTGG - Intergenic
1097401960 12:59138952-59138974 ATGGCTACAGCAAACCACCACGG - Intergenic
1098208347 12:68136245-68136267 CTGGCCACAGAGAACCTCGGAGG - Intergenic
1098867436 12:75779006-75779028 CTGGCAATACAGAATCACCTTGG - Intergenic
1099948951 12:89278564-89278586 TTGGCTACAGACAATCATCTGGG - Intergenic
1100029716 12:90171348-90171370 GTGGCTACAGCTAACCACTTAGG - Intergenic
1101445961 12:104737167-104737189 CTGGGTACAGGGAAGCCCCTTGG - Intronic
1101940513 12:109096371-109096393 CTAGCTACAGAAGACCAGCTGGG - Intergenic
1104096363 12:125561433-125561455 ATGGCTACAGCAAACCACCATGG + Intronic
1106223482 13:27767221-27767243 ATGGCTTCAATGAACCACCTTGG - Intergenic
1107903168 13:45038408-45038430 CAGGGTACACAGAATCACCTGGG - Intergenic
1108039335 13:46324684-46324706 ATGGCTGCAGTGAGCCACCTGGG + Intergenic
1111167362 13:84476974-84476996 ATGGCTGCAGACAACCACCATGG + Intergenic
1113802213 13:113092532-113092554 CAGGCCACCCAGAACCACCTGGG - Intronic
1117667586 14:58072989-58073011 CTGGCTACAGCGCCCCTCCTTGG + Intronic
1118663798 14:68044510-68044532 TTGTCTACAGAGATCCACCCTGG + Intronic
1118924546 14:70180090-70180112 TTGCCAAGAGAGAACCACCTGGG + Intronic
1119340369 14:73872005-73872027 CTGGGTACACCGAACCACATGGG + Intronic
1121272755 14:92649094-92649116 TTCTCTACAGAGAACCACCAAGG + Intronic
1121428754 14:93872438-93872460 GTGGCAGAAGAGAACCACCTAGG - Intergenic
1121464187 14:94103595-94103617 CTGGCTACAGAGGATCACAGAGG + Intronic
1122154910 14:99744427-99744449 CTGGCTACAGCAAGCCACATGGG + Intronic
1122298682 14:100719698-100719720 CTGGCTGCAGACAGCCAGCTTGG + Intergenic
1122784675 14:104158170-104158192 CTGGCCACAGAGCCCCTCCTTGG - Intronic
1124987408 15:34634064-34634086 ATGGGTACAGCGAACCACCATGG + Intergenic
1126805062 15:52339945-52339967 CTGGAGGCAGACAACCACCTGGG - Intronic
1128128097 15:65207596-65207618 CTGGCTTCAGAGATCCACTTCGG + Intronic
1129788512 15:78324760-78324782 CTGGCTACAGAGAGACACGCAGG + Intergenic
1129909295 15:79212869-79212891 CTGTCTACAGAGACCCAGCCGGG + Intergenic
1130051089 15:80484487-80484509 CTGGCTCCAAAGAAACATCTGGG - Intronic
1130411075 15:83649261-83649283 TTGGCCACAGGGAGCCACCTTGG + Intergenic
1131486605 15:92826020-92826042 CTGGCTTCTGTGACCCACCTTGG + Intergenic
1132940070 16:2502036-2502058 CTGGCCACACAGCACCTCCTTGG + Exonic
1133017989 16:2953742-2953764 CTGTCTCCTGAGAACCCCCTTGG - Intergenic
1136040937 16:27578370-27578392 CAGGGTACAAAGAAGCACCTGGG - Intronic
1139243560 16:65419085-65419107 CTGCCTAGAGGGAGCCACCTTGG + Intergenic
1139335491 16:66228099-66228121 CTGGCTATAGAGAATCACCTGGG + Intergenic
1139492093 16:67291628-67291650 CTGGCTCCAGAGCCTCACCTTGG + Exonic
1141204776 16:81925290-81925312 CTAGCTACAGGGAACCAGTTTGG - Intronic
1141399017 16:83730598-83730620 CTGGGTACAAAGGATCACCTGGG + Intronic
1141743097 16:85907377-85907399 CTGGCTAAAGACAGCTACCTGGG + Intronic
1141779702 16:86151336-86151358 CTGGCTACAGAGCGCCTCTTTGG + Intergenic
1143125160 17:4637187-4637209 CTGGCTACAGAGAATGACGTTGG + Exonic
1143403350 17:6659974-6659996 CTGGCTACAGAGACTGACGTTGG - Intergenic
1143575355 17:7789363-7789385 CCGGCTACAGACCACCAGCTCGG - Intronic
1146375014 17:32288005-32288027 CTGGCTGCAGAGCTCCACCTGGG - Intronic
1147240220 17:39085928-39085950 CTGGCCACAGAGAAACTCCTGGG + Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149028285 17:52055183-52055205 CTGGCAATAGAGTAACACCTAGG + Intronic
1149085537 17:52710690-52710712 CTGCCTACAGAGAGGCAGCTGGG + Intergenic
1151185835 17:72363350-72363372 CTGGCTGGAGAGAACCTCCTTGG - Intergenic
1151790590 17:76303257-76303279 CTGGGTACAAAAAACAACCTGGG - Intronic
1152690041 17:81713821-81713843 CTGGCTGCAGAACACCGCCTGGG + Intronic
1155129769 18:22921432-22921454 TTGGCTTCAGAGAAGCTCCTAGG + Intronic
1156925522 18:42573232-42573254 ATGGGTACAGGGAACCACCATGG + Intergenic
1157563120 18:48662462-48662484 CTGTCTGGGGAGAACCACCTGGG - Intronic
1158467393 18:57702991-57703013 CTTCCTACAGAGCAGCACCTTGG + Intronic
1158609714 18:58928144-58928166 CTGGGTGCAGAGAAGCACCCTGG - Intronic
1159879253 18:73843012-73843034 CTGGCTCCAGAGAACAACCCGGG - Intergenic
1160857159 19:1222736-1222758 CTGGCTTCTGAGTGCCACCTGGG + Intronic
1161357118 19:3825331-3825353 CTGGCCACAGAGAGCCCCCCCGG - Exonic
1164831146 19:31321909-31321931 ATGGGTACAGAAAACCACCATGG - Intronic
925566729 2:5262682-5262704 ATGGCTGCAGAAAACCACCATGG + Intergenic
929234749 2:39593976-39593998 CTGCCAACAAAGAACCAGCTGGG - Intergenic
929916967 2:46144193-46144215 CTTGCTGCACAGAACCACGTGGG + Intronic
931104057 2:59034852-59034874 CTTGCTACAGAGAAACCCCAGGG - Intergenic
933201705 2:79457914-79457936 GTGGCTAGAGAGAACTAGCTTGG - Intronic
935547449 2:104416233-104416255 CTGGTTACAGGGGACCCCCTTGG - Intergenic
939551394 2:143619932-143619954 ATTGCTACAAAGAACTACCTGGG - Intronic
940958919 2:159760512-159760534 CCAGCTACAGAGAACTCCCTGGG - Intronic
940996443 2:160155178-160155200 ATTGCTATAGAGAACTACCTGGG - Intronic
941093104 2:161201672-161201694 TGGGCTACAGAGCACCACCAGGG - Intronic
941885956 2:170527605-170527627 CTGTCTGCAGAGCACCATCTAGG + Intronic
944736045 2:202566836-202566858 CTGGTTACAGATAACTTCCTAGG - Exonic
948814353 2:240502304-240502326 CTGGCTACTCAGCAGCACCTGGG + Intronic
1169339233 20:4783453-4783475 CTGGGTACAGAGAAACACACAGG + Exonic
1173808316 20:45940608-45940630 CTGGCCACAGACACTCACCTTGG - Exonic
1175860770 20:62148981-62149003 CCGGCTAGCGAGCACCACCTGGG - Intronic
1178275996 21:31237371-31237393 CAGGCTCAAGAGAACTACCTTGG - Intronic
1180958739 22:19752780-19752802 CGGTCTACAGAGAACCTTCTGGG - Intergenic
1181480708 22:23197631-23197653 CTGGCTTCGGAGACCCACATAGG - Intronic
1183443389 22:37836649-37836671 ATGGGTACAGAAAACCACCACGG + Intronic
951262542 3:20527615-20527637 CTGGCTCAAGAGCAGCACCTGGG + Intergenic
951673865 3:25215211-25215233 CTGGCTACAGAGAACCACCTGGG - Intronic
953918779 3:46937610-46937632 CTGATTCCAGAGAACCCCCTAGG - Intronic
956148763 3:66219578-66219600 CTGGGTAGAGAGAACAACATGGG + Intronic
956234371 3:67052460-67052482 ATGGCTACAGGAAACCACCATGG - Intergenic
958891989 3:99794278-99794300 CTGGCCCAAGAGGACCACCTGGG + Exonic
961521634 3:127470417-127470439 CTGGCTAGAGAGAACTGCCTTGG - Intergenic
965734131 3:171803069-171803091 CTGGCTAAACAAAATCACCTGGG - Intronic
966830379 3:184002879-184002901 CTGGCAACAGAGAGGTACCTCGG + Intronic
968087408 3:195880139-195880161 CTGGCACCAGAGAACCACAATGG + Intronic
968978430 4:3834007-3834029 CAGGCTACAGAGAAACACGGAGG - Intergenic
970656234 4:18233640-18233662 TCAGCTATAGAGAACCACCTTGG + Intergenic
977552136 4:98453308-98453330 CTGGCTTCACAGAATGACCTAGG + Intergenic
978375083 4:108066493-108066515 CTGTCCCCAGAGCACCACCTGGG + Intronic
981688505 4:147481210-147481232 CCGGCTTCAGAAAACCTCCTGGG - Exonic
985576380 5:675272-675294 CTGGCCACACTGAACCCCCTGGG - Intronic
986320413 5:6627701-6627723 CTGGGTACAGAGAACAGCCTGGG + Intronic
986895857 5:12367282-12367304 GTGGTTACAGAGAACAACCTTGG + Intergenic
987388165 5:17350164-17350186 CTGGCCAGAGGGAACCATCTAGG + Intergenic
987662735 5:20898245-20898267 CTGGCTACAGAGTTCCAGCTTGG + Intergenic
988759957 5:34303949-34303971 CTGGCTACAGAGTTCCAGCTTGG - Intergenic
989779532 5:45247421-45247443 CTGGCTGCTGAGAAGCACCTTGG + Intergenic
990036612 5:51329311-51329333 TAAGCTTCAGAGAACCACCTTGG + Intergenic
991577523 5:68120638-68120660 TTGGTTACTGATAACCACCTAGG - Intergenic
994454107 5:99983579-99983601 ATGCCTACAGAGAAACACTTTGG + Intergenic
994619628 5:102147585-102147607 CTGGCTATAGAGCACCACGCTGG + Intergenic
996110444 5:119560001-119560023 CTGGCTTCATAGAACAACTTAGG - Intronic
997878944 5:137572823-137572845 CTGCCCACAAGGAACCACCTGGG - Intronic
998172984 5:139883250-139883272 CTGCCAGCAGAGAACCAGCTGGG - Intronic
999284990 5:150389375-150389397 ATGGCTACAGAGAAATCCCTTGG + Intronic
1000038579 5:157467694-157467716 CTGCTGATAGAGAACCACCTGGG - Intronic
1003859501 6:10309173-10309195 CTTGCTACAGAGCAGCACTTGGG - Intergenic
1004232296 6:13844439-13844461 CTGGCTGAAGAAAACCATCTAGG - Intergenic
1006076294 6:31534741-31534763 CCGGCAACAGAGAAGCACCGTGG - Intronic
1008811197 6:55501622-55501644 TTGGCTGCACAGAATCACCTTGG + Intronic
1011335027 6:86250780-86250802 CTGGCTACACAAAACCAACTGGG + Intergenic
1011394533 6:86892049-86892071 CTTGCTAAAGAGCACCAGCTGGG - Intergenic
1011492480 6:87906658-87906680 GTGGCTGCAGGGAAGCACCTTGG + Intergenic
1011667510 6:89648760-89648782 GAGGCTACAGTGAGCCACCTGGG + Intronic
1014053908 6:116990339-116990361 CTGCATTCAGGGAACCACCTTGG + Intergenic
1014505956 6:122256488-122256510 CTGAATACAGAGAAGCAACTAGG + Intergenic
1014848927 6:126315956-126315978 CTGACTACAGAGAGACACATGGG - Intergenic
1015510688 6:134035286-134035308 CTGGTTTCTGAGACCCACCTTGG - Intronic
1015796206 6:137014110-137014132 CTGGCTCCTGAGAAACTCCTTGG + Intronic
1018131323 6:160734824-160734846 CTAGTTACAGAAAACCACCCTGG + Intronic
1022025741 7:26446057-26446079 CTGTCTACAGAGGGCCCCCTAGG - Intergenic
1024653889 7:51432567-51432589 CAGGGCACAGAGAGCCACCTCGG + Intergenic
1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG + Intergenic
1027777605 7:82486120-82486142 ATGGGTGCAGCGAACCACCTTGG - Intergenic
1029976095 7:104835385-104835407 GTGCCTACAGAGAATCTCCTAGG - Intronic
1030153411 7:106427856-106427878 CAGGCTAGAGAGAACAGCCTGGG - Intergenic
1031605732 7:123764762-123764784 CTGGCTACAGAGGATGACTTTGG - Intergenic
1031855103 7:126912611-126912633 CTGGCTACAGAGAGCTGCCTTGG - Intronic
1032137622 7:129295244-129295266 CTGGCTTCACAGAACCAGCCTGG - Intronic
1034259659 7:149746855-149746877 ATGGAGACAGAGAACCACCCTGG - Intergenic
1037574815 8:20191750-20191772 CTTGCTACATAGAAACACATAGG + Intergenic
1039769728 8:40672936-40672958 CTAGCTACAGAAAAGCAACTTGG - Intronic
1040384499 8:46905101-46905123 CTGGAGACAGAGAACCAGCGAGG - Intergenic
1041353661 8:56976265-56976287 CTGGCACCAGGGAACTACCTTGG + Intronic
1042137231 8:65644278-65644300 CTGCCTAAAGAGAAACATCTCGG + Intergenic
1042617663 8:70668499-70668521 CAGGCTGCAGAGAACCAATTTGG + Intronic
1047565911 8:126043381-126043403 CTGGCTACACAGAATGAGCTAGG + Intergenic
1052033557 9:23655852-23655874 CTGGGAACAGAGAAGCATCTAGG + Intergenic
1052249662 9:26382815-26382837 CTTGCTGCAGTCAACCACCTTGG - Intergenic
1052901950 9:33800992-33801014 TTGGCTTCAGATAACCAGCTGGG - Intergenic
1052995382 9:34549306-34549328 CTGGCTCCCCAGAACCACCATGG + Intergenic
1055462874 9:76535882-76535904 ATGGCTTCATAGAATCACCTGGG + Intergenic
1057504365 9:95620401-95620423 CTGCCCAAAGAGAGCCACCTTGG - Intergenic
1058038766 9:100281893-100281915 CTGGCTACAGAGAGGCTTCTTGG + Intronic
1058900506 9:109438578-109438600 CTGGATAAAGAGAACCCACTGGG + Intronic
1059060682 9:111032644-111032666 TTGGTCAAAGAGAACCACCTAGG + Intronic
1059854128 9:118376540-118376562 CTGGCTAAAGCGATCCTCCTGGG - Intergenic
1061358489 9:130124486-130124508 TTGGTCCCAGAGAACCACCTGGG - Intronic
1185521066 X:740160-740182 CTGGGCACAGAAAAACACCTCGG - Intergenic
1185744120 X:2557953-2557975 CTCACTACAGAAAACGACCTGGG + Intergenic
1185919884 X:4079081-4079103 CGTGCTACACAGAACCACCTGGG - Intergenic
1186214180 X:7281451-7281473 CTGGGCACAGAGAACCAACCTGG + Intronic
1186979072 X:14939702-14939724 TTGGCTACACAGAATTACCTGGG - Intergenic
1187006518 X:15238153-15238175 CTGCCTCCAAAGAACCACATGGG + Intronic
1187075491 X:15930200-15930222 TTGGCCACACAAAACCACCTGGG - Intergenic
1187701552 X:21968402-21968424 CTGGCCACATAGAACCACTGGGG - Intronic
1187929381 X:24279888-24279910 CTGGCTACAGAAAATTGCCTGGG + Intergenic
1191612293 X:63130550-63130572 CTGGGTACAGCAAACCACCATGG - Intergenic
1191624004 X:63248376-63248398 CTGGGTACAGCAAACCACCATGG + Intergenic
1194625348 X:96220572-96220594 ATGGCTCCAGAAAACCACCATGG + Intergenic
1194734376 X:97494807-97494829 CTGGCCTCAGTGAACCACCAGGG - Intronic
1194938784 X:99984407-99984429 CAGGCTACAGAAAAGCATCTGGG - Intergenic
1196032748 X:111108724-111108746 CTGGCTTAAGAGAAACAGCTGGG + Intronic
1196175861 X:112638442-112638464 TCAGCTACAGAGAAGCACCTAGG + Intronic
1196624126 X:117858676-117858698 CAGGCCACAGAGAAGCAGCTGGG - Intergenic
1197442560 X:126509935-126509957 CTCGTTTCAGAGAACCAACTGGG - Intergenic
1200786875 Y:7268336-7268358 CAGGAGACAGAGACCCACCTAGG - Intergenic
1200875969 Y:8155196-8155218 CTGGATGCAGAGAATCCCCTTGG + Intergenic