ID: 951678955

View in Genome Browser
Species Human (GRCh38)
Location 3:25274542-25274564
Sequence GGTCCCCTTTCCAGGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951678955 Original CRISPR GGTCCCCTTTCCAGGGAGCC AGG (reversed) Intronic