ID: 951679936

View in Genome Browser
Species Human (GRCh38)
Location 3:25284060-25284082
Sequence CAGCAAAATGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 629}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951679936_951679943 30 Left 951679936 3:25284060-25284082 CCTCCCTCCTTCTCATTTTGCTG 0: 1
1: 0
2: 5
3: 69
4: 629
Right 951679943 3:25284113-25284135 AGCCCACATGGAAATGAGTTTGG 0: 1
1: 0
2: 2
3: 20
4: 243
951679936_951679940 4 Left 951679936 3:25284060-25284082 CCTCCCTCCTTCTCATTTTGCTG 0: 1
1: 0
2: 5
3: 69
4: 629
Right 951679940 3:25284087-25284109 GATGAAGTAAACTGCCATGCTGG 0: 1
1: 2
2: 7
3: 44
4: 165
951679936_951679942 18 Left 951679936 3:25284060-25284082 CCTCCCTCCTTCTCATTTTGCTG 0: 1
1: 0
2: 5
3: 69
4: 629
Right 951679942 3:25284101-25284123 CCATGCTGGAGAAGCCCACATGG 0: 1
1: 1
2: 11
3: 55
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951679936 Original CRISPR CAGCAAAATGAGAAGGAGGG AGG (reversed) Intronic
900231132 1:1558686-1558708 CAGCCACATGAGAAGGTGTGTGG - Intronic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
901427430 1:9191333-9191355 CAGCCACATGAGAAGTTGGGGGG - Intergenic
901450470 1:9333625-9333647 CAGGAAGCTGACAAGGAGGGCGG - Intronic
901450532 1:9333928-9333950 CAAAAAAATGAGAAGGAATGTGG - Intronic
901724774 1:11232529-11232551 CTGCAAAATGAAAAAGAGGGTGG + Intronic
901775551 1:11558431-11558453 CTGCAAAGTGAGAGGGAGGCGGG - Intergenic
901860868 1:12073500-12073522 AAGAAAGAAGAGAAGGAGGGAGG - Intronic
902632248 1:17711893-17711915 CAGCCACATGAGAGGGAAGGGGG + Intergenic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903314859 1:22495249-22495271 CAGCAACATGAGAAGAAGCTGGG + Intronic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903610164 1:24605603-24605625 CAGGAAAATGAGGACGAGGCGGG + Exonic
904327249 1:29734889-29734911 AAGGAAAATGAGAAAGAGTGGGG + Intergenic
904576835 1:31510291-31510313 GAGGCAAATGACAAGGAGGGTGG - Intergenic
905172935 1:36119688-36119710 CAGCACAGTGGGAAGGAAGGAGG + Intronic
906013345 1:42550475-42550497 CAGCAAGATGAGGAGGAGGTAGG - Intronic
906759329 1:48360338-48360360 AAGTAACATGAGAAGCAGGGGGG + Intronic
907694526 1:56709407-56709429 CACCAATTTGGGAAGGAGGGCGG + Exonic
908390589 1:63679945-63679967 AAGCAAAAAGAGAAGGGAGGTGG - Intergenic
908835436 1:68224761-68224783 AAGCAAAACGAAAAGGTGGGGGG + Intronic
909665402 1:78126783-78126805 AAGCACAATGAGAAAGAGGGAGG + Intronic
909974990 1:82035519-82035541 GAGCAAAATGTGGAGGAAGGAGG + Intergenic
910601866 1:89040985-89041007 GAGGAAGATGAAAAGGAGGGAGG + Intergenic
911406665 1:97449346-97449368 CAGAGAATTGAGGAGGAGGGAGG + Intronic
911509237 1:98791149-98791171 CAGCAGAAAGAGGAGGAGAGGGG + Intergenic
911845330 1:102745646-102745668 CATCAAAAGGAGAAGGAGAGGGG - Intergenic
912021719 1:105114405-105114427 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
912822197 1:112877002-112877024 CAGCTAGAAGAGAAGGAGGGTGG + Intergenic
913207613 1:116555454-116555476 AAGCAAAGAGAGATGGAGGGAGG + Intronic
913469976 1:119177694-119177716 CATCAAAATGGGAAGGAGAGGGG + Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915261016 1:154676866-154676888 CATCAAAATGGGAAGGAGAGGGG + Intergenic
916084093 1:161255783-161255805 AAGCCAAAGGAGAAGGAGAGGGG + Intergenic
916555722 1:165892730-165892752 CAGAAGAATGTAAAGGAGGGAGG + Intronic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916939970 1:169667404-169667426 CATCAAAATGGGAAGAAGAGGGG + Intronic
917227752 1:172801996-172802018 CATCAAAAAGGGAAGGAGAGGGG + Intergenic
917445605 1:175103830-175103852 CATCAAAATGGGAAGGAGAGAGG - Intronic
917512702 1:175681441-175681463 CAGCAAAGAGAGCAGGAGCGAGG + Intronic
917656913 1:177135587-177135609 CAGCAAAGTGAAAAGCTGGGGGG + Intronic
917710855 1:177682682-177682704 AAGCAAAATGAGAATGAGAAAGG - Intergenic
917750860 1:178052148-178052170 CAGCAGAGTGAGAAGGTGAGAGG - Intergenic
917930499 1:179819283-179819305 GAGAAAACTGAGAAGGAGAGAGG - Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
919846794 1:201647853-201647875 CAGGTAAAAGAGACGGAGGGAGG - Intronic
919927690 1:202200825-202200847 CAGCAAAAGGACATGGTGGGGGG + Intronic
920004695 1:202824397-202824419 CAGCAGTATGAGGAGGAAGGAGG + Intronic
920278211 1:204824290-204824312 CAGCATTAAGGGAAGGAGGGAGG - Intergenic
920717528 1:208354701-208354723 GAGGAGAGTGAGAAGGAGGGAGG + Intergenic
920756478 1:208738498-208738520 CATCAAAATGGGAAGGAGAGGGG + Intergenic
920764212 1:208816131-208816153 GAGGAAAAGGAGAAGCAGGGAGG - Intergenic
920798165 1:209160715-209160737 CAGCAAAATGAAAAGATGGTAGG - Intergenic
920819752 1:209369374-209369396 CAGGAAAATGGCCAGGAGGGTGG + Intergenic
921669984 1:217914572-217914594 CAGCAAAGTGAGATGGAGAAGGG - Intergenic
922609387 1:226913181-226913203 CAGTAAAGTGAGAAGGGGAGAGG + Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923811418 1:237321613-237321635 CAACCAAATGAGGAGGTGGGAGG + Intronic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
924539207 1:244965422-244965444 CAGGACAGTGAGAGGGAGGGAGG - Intergenic
1063113919 10:3060008-3060030 AAGGAAAGTGAGAAGAAGGGAGG + Intergenic
1063321271 10:5054858-5054880 CATCAAAATGGGAAGAAGAGGGG - Intronic
1063331354 10:5162920-5162942 TACCAAAATGAGGAGGAGGTTGG - Intergenic
1063661653 10:8038269-8038291 AAGATAAATGAAAAGGAGGGTGG - Intergenic
1064082672 10:12321177-12321199 AAGCAACAAAAGAAGGAGGGAGG - Intergenic
1064133809 10:12732911-12732933 GAGGAAACTGAGAAGGAGGGAGG - Intronic
1064197570 10:13258454-13258476 TATCAAAATGGGAAGGAGAGGGG + Intergenic
1064281545 10:13955800-13955822 AAGCACAATGAAAAGGAAGGTGG + Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1065817276 10:29493591-29493613 CAGTAAAATGGGAGAGAGGGAGG + Intronic
1067535056 10:47102967-47102989 CATCAAAATAAGGAGGAAGGAGG + Intergenic
1070429084 10:76318270-76318292 AAGGAAAAAGAAAAGGAGGGAGG - Intronic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071231985 10:83598550-83598572 CAGAAAAATGAGAATGTGTGTGG - Intergenic
1071905778 10:90172062-90172084 CAGCAAAAAAAAAAAGAGGGGGG - Intergenic
1072012750 10:91317999-91318021 CAGCACAATGCTAAGGAGTGGGG + Intergenic
1072945965 10:99810298-99810320 CAGCAAACTGAGAGAGAGTGTGG + Intronic
1073541946 10:104322081-104322103 CTGCAAAATGCAGAGGAGGGAGG + Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073874919 10:107911817-107911839 CAGCAAAAGGAACAGGAGAGAGG + Intergenic
1074326476 10:112455587-112455609 AAGCAAGGTGAGAAGGAGGGCGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074613224 10:115040645-115040667 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1074891144 10:117737517-117737539 AAGCAAACAGAGAAGGTGGGTGG + Intergenic
1075672674 10:124273162-124273184 CAGGAGAATGGGAAGGAGAGAGG - Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076291448 10:129349082-129349104 CAGCCCAGTGAGGAGGAGGGAGG + Intergenic
1078096365 11:8299706-8299728 CAGCCACATGAGAAGACGGGAGG + Intergenic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1078996542 11:16706597-16706619 CAGGAAAATGAGAAGCAGAGAGG + Intronic
1079292436 11:19200477-19200499 AAGGAAAGAGAGAAGGAGGGAGG - Intronic
1079730762 11:23936195-23936217 CATCAAAATGGGAAGGAGAAGGG - Intergenic
1080048734 11:27836694-27836716 TAGGACAATGAGGAGGAGGGTGG + Intergenic
1080693932 11:34584433-34584455 CAGCAATATGGTAAAGAGGGGGG + Intergenic
1080825205 11:35842538-35842560 GAGATAAATGAGAAGGAGAGAGG + Intergenic
1080905951 11:36544857-36544879 CAGAAAAGAGAGAACGAGGGGGG - Intronic
1081033616 11:38115075-38115097 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1081421879 11:42880355-42880377 CATCAAAATGGGAAGGAGAGGGG + Intergenic
1081563859 11:44244089-44244111 GAGCAGAATGAGAAGGATGGGGG - Intronic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1083369941 11:62170522-62170544 CAGCAATTTGAGAAAGAAGGTGG - Intergenic
1083603170 11:63961431-63961453 CAGGAACATGAAAAGGAGTGGGG + Intergenic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1086165425 11:83772435-83772457 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1087159745 11:94937024-94937046 CAGTAGAATGAGAAGGAAAGAGG - Intergenic
1087195638 11:95301786-95301808 CAGAAGAATGAGGAGCAGGGAGG + Intergenic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088219460 11:107552872-107552894 CAGTAAAATGAGAAGCAGCATGG + Intronic
1088803501 11:113329482-113329504 CAATAAAATGAGAAGGAAGGAGG + Intronic
1088828719 11:113517128-113517150 CAACAAGAAGAGAGGGAGGGAGG + Intergenic
1089427035 11:118386459-118386481 CAGCAAATTGAGAAGGATCGAGG + Exonic
1089553018 11:119295736-119295758 CAATAAAATGAGATGGCGGGAGG - Intronic
1089891325 11:121884259-121884281 GGACAGAATGAGAAGGAGGGAGG + Intergenic
1090029445 11:123194914-123194936 TAGCAAGAGGAGAAGGAGGAGGG + Exonic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1091585772 12:1815742-1815764 CAGCAAAATGGAGAGGAAGGAGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092472764 12:8793653-8793675 CATCAAAATGGGAAGGAGAGGGG + Intergenic
1092511262 12:9159216-9159238 TAGCAACATGAGAAGGAAGAGGG + Intronic
1092612418 12:10186499-10186521 CAGCAAAATGGGGAAGATGGGGG + Exonic
1093472054 12:19512662-19512684 CAGCAAAAAAAAAAAGAGGGGGG - Intronic
1093527296 12:20116762-20116784 CATCAAAATGGGAAGGAGAGGGG - Intergenic
1093773900 12:23049920-23049942 AACAAAAATGAGAAGGAAGGGGG + Intergenic
1095382057 12:41606778-41606800 AGGCAGAAAGAGAAGGAGGGAGG - Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095740034 12:45596912-45596934 CAGGAAGATGAGAATGAGGTGGG - Intergenic
1096097207 12:48943616-48943638 CTGCAAACTGAGAAGGGTGGTGG - Intronic
1096730142 12:53603495-53603517 CAGCAAATTTAGAAGGAAGCAGG - Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1098364148 12:69684813-69684835 GAGCAAAATGAGATTGAGAGAGG + Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098730469 12:74030469-74030491 CAACAAAATGAAAAGGATGTAGG + Intergenic
1101129419 12:101673345-101673367 CAGCATTATGAGAAGGACAGTGG - Intronic
1101258893 12:103008958-103008980 CATCAATATGAGAAGGAGGAAGG + Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101834100 12:108282946-108282968 AAACAATATGAGGAGGAGGGAGG + Intergenic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102764793 12:115423208-115423230 GAGGAAAAAGAGGAGGAGGGAGG + Intergenic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1104172519 12:126295900-126295922 AAGGAAAGAGAGAAGGAGGGAGG + Intergenic
1104527559 12:129538757-129538779 CTGCACAATGAGATGAAGGGAGG + Intronic
1104907284 12:132220095-132220117 CAGCAAAATGACAAGGCAGCTGG + Intronic
1105272552 13:18891941-18891963 CAGCAAAAGGAGAAGCAAAGGGG + Intergenic
1105988658 13:25595518-25595540 CAGCAAAATGGGAAGGGCTGAGG - Intronic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106301300 13:28468691-28468713 CAGGAACAAGAGAAGGGGGGAGG - Intronic
1106400450 13:29424829-29424851 CAGCAAAAGGAGAGGAGGGGTGG + Intronic
1106663614 13:31828084-31828106 GAACAAAAAGAGAAGGAGGAAGG - Intergenic
1107310703 13:39074034-39074056 CAGCACATTGAGAAGGGGGGTGG - Intergenic
1107588508 13:41879302-41879324 CAGCAGAAAGAGGAGGAGGGTGG - Intronic
1107851184 13:44575345-44575367 CAGCAACATGAGATGGATGGTGG + Exonic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1109784431 13:67155950-67155972 CAGCAATGTGAGAATCAGGGAGG - Intronic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1111508964 13:89235267-89235289 CAGCAAAGAGAGAATGAGAGAGG - Intergenic
1112343455 13:98571335-98571357 CATCAAAGTCAGAAAGAGGGTGG + Intronic
1112519589 13:100083652-100083674 CATCAAAATGGGAAGGAGAGGGG + Intergenic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1113145160 13:107200097-107200119 CACCAAAACGAGAAGGAGAGAGG + Intronic
1113389340 13:109880701-109880723 CAGCAAGATGATCAGGAGCGCGG + Intergenic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1114230408 14:20776469-20776491 CAGCCAAATGAGTAGATGGGAGG - Intergenic
1115027807 14:28764494-28764516 GAGCTAAGGGAGAAGGAGGGAGG + Intergenic
1115043774 14:28963857-28963879 GAAGAAAATGAGGAGGAGGGAGG + Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1116331003 14:43597879-43597901 CCACAAAATGAGAAAGAAGGCGG + Intergenic
1116630013 14:47318751-47318773 TAGTAGAATGAAAAGGAGGGAGG + Intronic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117187091 14:53251017-53251039 GAGCAGGAGGAGAAGGAGGGAGG - Intergenic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1118121680 14:62852318-62852340 CATGAAAATGAGAAGCAGTGAGG - Intronic
1118136087 14:63029655-63029677 GAGAAAAATGAGAAGAAGAGAGG + Intronic
1118930900 14:70239477-70239499 CACCAAAAGGAGAAGAAGTGTGG + Intergenic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119645239 14:76343185-76343207 GAGCCAAGTGAGAGGGAGGGTGG + Intronic
1119697139 14:76721918-76721940 CACCAAAACGCTAAGGAGGGAGG + Intergenic
1120669335 14:87346282-87346304 AAGCAAAGAAAGAAGGAGGGAGG - Intergenic
1120701712 14:87705564-87705586 AAGCATGATGAGAAAGAGGGTGG + Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121061600 14:90915004-90915026 CAGCAAACTGAGAATCAAGGAGG + Intronic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121586654 14:95067577-95067599 CAGCAGCATGAGGGGGAGGGTGG + Intergenic
1121599286 14:95191155-95191177 CTGCTTAATGAGAAAGAGGGTGG - Exonic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121798777 14:96756264-96756286 CAGCCACATGACAAGGAGGCAGG + Intergenic
1123975442 15:25549231-25549253 CAGCAAAATGAAGAGTAGAGGGG + Intergenic
1124863934 15:33470891-33470913 AAGCAAAATGAGAAAAAAGGAGG + Intronic
1125010671 15:34870144-34870166 CAGGAAAATGAGAAAAAGAGGGG - Intronic
1125181392 15:36883909-36883931 CTGCAAAAGGAAAGGGAGGGGGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125969139 15:43897912-43897934 CAGGAAAGAGAGAATGAGGGGGG - Intronic
1127116985 15:55738764-55738786 CAGGAAGAAGAGAGGGAGGGAGG + Intronic
1127471147 15:59291533-59291555 CAGCAAAAAGAGAACAAAGGTGG + Intronic
1127886517 15:63206411-63206433 CAGGAAAATGAGGGGGAGAGGGG - Intronic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1129209731 15:74060725-74060747 CAGCAGAGAGAGAGGGAGGGAGG + Intergenic
1129302739 15:74635353-74635375 CATCAAACTGCTAAGGAGGGAGG + Intronic
1130020432 15:80226180-80226202 CAGTAAAAAGAGAATGAGGTGGG + Intergenic
1130079496 15:80720094-80720116 CAACAAAAAGAAAAGGAGGCTGG - Intronic
1130878173 15:88032227-88032249 CAGCAGAAGGACAAGGAGAGGGG + Intronic
1131776138 15:95800935-95800957 CAGAAAGATGAGAAGGAGCATGG + Intergenic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1133219188 16:4311613-4311635 CAGCACAATGGCAGGGAGGGGGG + Intergenic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133656722 16:7872090-7872112 AAGGAAAAAGGGAAGGAGGGAGG - Intergenic
1133854488 16:9536825-9536847 CAGCAAAGTGAGGGTGAGGGAGG + Intergenic
1133937947 16:10284138-10284160 CAGGAAAGTGAGAAGGGGTGGGG - Intergenic
1134880987 16:17745401-17745423 GAGCAAACAGAGAAGGAGAGAGG - Intergenic
1135213724 16:20546253-20546275 CAGAAAAAAGGGACGGAGGGAGG - Intronic
1135339216 16:21632075-21632097 CATCAAAAGGGGAAGGAGAGGGG - Intronic
1135433594 16:22408794-22408816 GAGCAAAGTAAGCAGGAGGGAGG + Intronic
1135497453 16:22964956-22964978 AAGAAAGATGAAAAGGAGGGAGG - Intergenic
1136131123 16:28222217-28222239 CAGCTAAAAGTGAAGGTGGGAGG - Intergenic
1137800981 16:51262011-51262033 AGGCAAAAAGAGAGGGAGGGAGG - Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138659084 16:58507322-58507344 CTGCAAAATGAGGAAGAGGTCGG + Intronic
1141475878 16:84273032-84273054 GAGTAAAATGAGAAGATGGGTGG - Intergenic
1141847439 16:86620337-86620359 CATCAAGATAAGAAGGATGGGGG - Intergenic
1141884138 16:86880238-86880260 GAGGAAAAAGAGAAGAAGGGAGG + Intergenic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1143274459 17:5699834-5699856 CTGCAAGAAAAGAAGGAGGGGGG + Intergenic
1143569479 17:7746575-7746597 CAACCAAATGAAATGGAGGGTGG - Intronic
1144504358 17:15817464-15817486 CAGAAAGATGCAAAGGAGGGTGG - Intergenic
1144634115 17:16893132-16893154 CAGAAAGATGCAAAGGAGGGTGG - Intergenic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145168212 17:20632973-20632995 CAGAAAGATGCAAAGGAGGGTGG - Intergenic
1145864185 17:28229433-28229455 CAGCAAAATGGGATGGAAAGTGG - Intergenic
1146164302 17:30575942-30575964 CAGAAAGATGCAAAGGAGGGTGG - Intergenic
1146892207 17:36513543-36513565 CAGCAAGATGCGAGGGAGGCAGG + Intronic
1147284867 17:39394180-39394202 CAGGAAAATCCAAAGGAGGGAGG - Intronic
1147808340 17:43148401-43148423 CAGCAAAAGGAGATGGGGTGGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149570181 17:57666795-57666817 CAGCAACATGAGAGGGTGGCTGG + Intronic
1149636552 17:58175284-58175306 AAGCAAAATGAGGAGGAGCATGG - Intergenic
1150052678 17:61980258-61980280 AAGGAAATTGAGAAGGAGGTTGG - Intronic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1150365154 17:64576204-64576226 CAAAAAAAAGAGAGGGAGGGAGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150996608 17:70325285-70325307 CAACAATTTGAGAAGGAGGAAGG - Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151400021 17:73849929-73849951 CAGCAAGATGAGGAAGATGGCGG + Intergenic
1151407134 17:73895748-73895770 CAGCTAAGTGAGAAGGAAAGAGG + Intergenic
1151594052 17:75066058-75066080 CAGTAAAATGAAAGGGAGGAGGG - Intergenic
1151798816 17:76365247-76365269 GAGCTAAATGAGATGGAGAGTGG + Intronic
1152064378 17:78102394-78102416 CAGCACAATAAGAAGTGGGGAGG + Intronic
1152795972 17:82306522-82306544 CAAGAAAATGAGAACGAGGCCGG - Intergenic
1153438237 18:5089036-5089058 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1154932674 18:21016723-21016745 CAGCTAAATGGGAGTGAGGGAGG - Intronic
1155044305 18:22090130-22090152 CAGCAAATTGAGAGGGAGCCAGG + Intronic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1157046579 18:44107420-44107442 CAGCAAGATGAGAAGCAGAGAGG - Intergenic
1157177377 18:45463946-45463968 CAGAAAAATTAGAAATAGGGTGG - Intronic
1157857121 18:51113481-51113503 CATCAAAATGGGAAGAAGAGGGG - Intergenic
1157877978 18:51291510-51291532 AAGGAAAATGGGAGGGAGGGAGG - Intergenic
1157894004 18:51447179-51447201 GAGCAAAAGGAGAAGGAAAGAGG + Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158727125 18:59983778-59983800 CAACACAGTGAGAGGGAGGGAGG - Intergenic
1159060631 18:63510522-63510544 CAGGAAAATGAGAACAAGTGAGG + Intergenic
1159233170 18:65635423-65635445 CCTAAAAATGAGAAGTAGGGTGG + Intergenic
1161585518 19:5103405-5103427 CAGGAAAATGAGAAAGCGGGCGG - Intronic
1162010056 19:7807667-7807689 AGGTAAAATGAGAATGAGGGCGG - Intergenic
1162362234 19:10227174-10227196 TAGCTAAATGGGAGGGAGGGGGG + Intronic
1162527169 19:11213053-11213075 GAGCATAATGAGCAGGAGGAGGG - Intronic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1165216434 19:34277056-34277078 GAGCATCATGAGTAGGAGGGAGG + Intronic
1165281524 19:34802327-34802349 CAGCACAATGAGGAGGAGTGGGG + Intergenic
1165368821 19:35389258-35389280 CAGCAAAATGAGACCCATGGAGG + Intergenic
1165390774 19:35537458-35537480 AAGCAAAGGGAAAAGGAGGGAGG + Intronic
1166365939 19:42278554-42278576 CAGCCAAAACAGAAAGAGGGTGG - Intronic
1166635236 19:44445449-44445471 GAGCAGAATGAGAAAGAGGGAGG - Intronic
1167112159 19:47468864-47468886 TATCAAAAAGAGAAGGAGAGAGG + Intronic
1167836816 19:52079620-52079642 CAGCAAAGAGAAAAGGTGGGAGG + Intronic
1167901698 19:52627190-52627212 CAGCAAAAGGAGATGGGGTGGGG - Intronic
1168082110 19:54017718-54017740 AAGTAAAAGGAGGAGGAGGGAGG - Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
925910106 2:8568237-8568259 CAGCAAAAAGGGAGGGAGGGAGG + Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926394965 2:12431450-12431472 CAGCATAATGAGAGAGATGGTGG + Intergenic
926570573 2:14525351-14525373 AAGGAAGAGGAGAAGGAGGGAGG + Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
928071688 2:28223440-28223462 CAGCAGAATGGGGAGGAGAGAGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
929103165 2:38337087-38337109 CAAGAAAAAGAGAGGGAGGGAGG + Intronic
929632523 2:43479379-43479401 CTGCAAAATGAGAATGAGACTGG + Intronic
929870268 2:45753225-45753247 CAGAAACATGGGGAGGAGGGTGG - Intronic
930038974 2:47105970-47105992 CATCCAAATGGGAAGGAGAGGGG + Intronic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
930851599 2:55966843-55966865 GAGGAAAATGAGAATCAGGGAGG - Intergenic
931057301 2:58487128-58487150 CAGCAAAAAGAGGAGAAGTGGGG + Intergenic
931547545 2:63406335-63406357 CAGCAAAAAGAGTGTGAGGGAGG - Intronic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
932854755 2:75221567-75221589 CAGCAAAATGAAAGGCAGGGAGG - Intergenic
933366017 2:81355069-81355091 AAGGCAAATAAGAAGGAGGGAGG + Intergenic
935314329 2:101816630-101816652 GAGCAAAAGGAGAAGGTAGGTGG - Intronic
935854299 2:107258086-107258108 GGGCAAAATGAGAAGGAGGGAGG + Intergenic
935922228 2:108028842-108028864 CACCAAAATGGCAAGGAGGCAGG + Intergenic
936016811 2:108965640-108965662 CACCCAAATGAGAAGGAAGGAGG - Intronic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937755680 2:125535361-125535383 CAACCAAAAGAGAAGGAGTGAGG - Intergenic
937979007 2:127602050-127602072 CATAAAAATGCGAAGGAGAGAGG - Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938145587 2:128832499-128832521 AAGAAAAAAGAAAAGGAGGGAGG - Intergenic
938805760 2:134806035-134806057 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
941243701 2:163071193-163071215 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
941594095 2:167454370-167454392 AAGGAAAATGAGAAGGACTGAGG - Intergenic
941646077 2:168042876-168042898 CTCCAAAATTAGAAGGAAGGTGG - Intronic
941778367 2:169417329-169417351 CAGAAAATTCAGAGGGAGGGAGG + Intergenic
942398291 2:175575294-175575316 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
942627324 2:177915920-177915942 AAGCAAAATGACAGGGAGTGAGG - Intronic
943539008 2:189188056-189188078 CAGCAGAATGAGAGGGTGAGTGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943902192 2:193454732-193454754 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
944729440 2:202502289-202502311 CATCAAAATGGGAAGGAGAGGGG + Intronic
945682864 2:212934956-212934978 CAGCAAAATCAGAAGGCCTGGGG - Intergenic
946035209 2:216736562-216736584 CACCAAATTGAGAAGGAAGGGGG + Intergenic
946040270 2:216776831-216776853 CAGTAAAATGAGAAGGGATGAGG - Intergenic
946098103 2:217292832-217292854 AAGCAAAAACAGAAAGAGGGAGG - Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946434718 2:219643966-219643988 CGGCAAAATGAAAAGAGGGGCGG + Intergenic
946679590 2:222199366-222199388 CAGGAAGAAGGGAAGGAGGGAGG + Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947682420 2:232046781-232046803 CCCCAAAATGGGAAGGAGGTGGG - Intronic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
949066818 2:241996004-241996026 AAGCACATTGAGAAGGAGGCTGG - Intergenic
1169041613 20:2500106-2500128 CAAGAAAATGAGGAGGTGGGGGG + Intronic
1169657785 20:7944121-7944143 CACCAAAAGGAGCAGGAGAGAGG + Intergenic
1169712441 20:8580056-8580078 CAGCCTAATGAGAAGGTGGTGGG + Intronic
1169922460 20:10749826-10749848 CTTCAAAATGGGAAGGAGTGGGG - Intergenic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1171261785 20:23740342-23740364 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1171270923 20:23816217-23816239 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1171393837 20:24818204-24818226 CAGCAATGTGAGAACGTGGGTGG - Intergenic
1173051610 20:39567736-39567758 CAGAAAAAAGAGAGAGAGGGGGG - Intergenic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1173750090 20:45469813-45469835 CAGCAGGCTGAGGAGGAGGGCGG - Exonic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174169820 20:48609274-48609296 CAACAAAATGAAGAGGAGAGCGG + Intergenic
1175065311 20:56279619-56279641 AAGAAAAATGAAAAGGAGAGGGG + Intergenic
1175245117 20:57577672-57577694 GAACAAGATGTGAAGGAGGGTGG + Intergenic
1176008624 20:62880216-62880238 CTCCAAACTGAGAGGGAGGGGGG + Exonic
1177588995 21:23137071-23137093 CAGCACAATCACAAGGGGGGGGG + Intergenic
1178109575 21:29356943-29356965 CATCAAAAGGGGAAGGAGAGGGG - Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179084869 21:38207641-38207663 AGGCAAAAAGGGAAGGAGGGAGG - Intronic
1180756792 22:18167988-18168010 CATCAAAAAGAGAAAGTGGGAGG - Exonic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1182143473 22:27982447-27982469 CGGCACAATAAGAAGGAGGAGGG - Exonic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183818550 22:40324817-40324839 AAGCAAAATTACAAGGTGGGGGG - Exonic
1183861215 22:40671591-40671613 CAGCTACCTGAGAAAGAGGGAGG + Intergenic
1184013905 22:41770939-41770961 CAGCAAGATGAGCAGGATGCTGG - Exonic
1184198618 22:42949190-42949212 CAGCAAAATGGGAATAAAGGTGG + Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184467167 22:44675605-44675627 CAGGAAACTGAGATGCAGGGAGG - Intronic
1184650416 22:45917047-45917069 CAGCAAAATGCAAAGGAGAGGGG - Intergenic
1184728211 22:46358226-46358248 CAGAAACATGAGTAGGTGGGAGG + Intergenic
1184881527 22:47307473-47307495 CAGCAAGAAGGGAAGGAGGCTGG - Intergenic
1184988805 22:48153902-48153924 CAGCAAAAAGATGAGCAGGGTGG + Intergenic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
950162937 3:10773641-10773663 CAACAAAATGAGTGGAAGGGAGG - Intergenic
951239766 3:20274111-20274133 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
951303546 3:21028489-21028511 CAGCAAAGTGAGATGGAGTCTGG + Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
952047105 3:29335871-29335893 AAACAAAATGAAAAAGAGGGAGG - Intronic
952453477 3:33452020-33452042 CATCAAAATGGGAAGGAGAGGGG + Intergenic
952596406 3:35023844-35023866 CAGTAGAATGAGAACCAGGGTGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953358616 3:42275724-42275746 CAGCAAAATGGGATGCAGTGTGG + Intergenic
954599221 3:51854603-51854625 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
954626315 3:52023865-52023887 CAGCCAGGGGAGAAGGAGGGAGG - Intergenic
955186223 3:56717816-56717838 CATCAAAATGGGAAGGAGAGGGG + Intergenic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956681381 3:71785011-71785033 CAGCAAGAGGAGCAGGAGTGGGG + Exonic
957255281 3:77827923-77827945 CAGCAAAAGGAAAAGGTGTGTGG + Intergenic
957771375 3:84696545-84696567 CAGCCAAATGAGAATGATGTTGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
959296816 3:104545819-104545841 CAGGACAATTAGAAGCAGGGTGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
961826614 3:129602457-129602479 CCGCAAAGGGAGAATGAGGGTGG - Intronic
962253139 3:133851556-133851578 GAGCAGAGTGAGAAGGAAGGAGG + Intronic
962366726 3:134791679-134791701 CAGCAGGAAAAGAAGGAGGGAGG - Intronic
962371424 3:134823860-134823882 CAGCAGAATGAGAAGAAAGCAGG + Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963021550 3:140876787-140876809 CATCAAAAGGAGAAGGAGAGGGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
964367812 3:155968439-155968461 GAACAAAAGGAGAAGGAGGTTGG + Intergenic
965139625 3:164816866-164816888 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966593436 3:181705100-181705122 CAGCAAAAAGGGAAGAAGGGTGG + Intergenic
966667725 3:182491067-182491089 CACAAAAATGAAAAGGAGTGTGG - Intergenic
966710721 3:182969735-182969757 CAGCAAAAAAAGCAGGGGGGAGG + Intronic
966998788 3:185311677-185311699 TAGCCAAATGAGAAGGAGAGGGG - Intronic
967277979 3:187795314-187795336 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
967336687 3:188352045-188352067 AAGAAAAATGACAAGGGGGGAGG - Intronic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967837981 3:193980581-193980603 CAGCAAAACAAGAGGGCGGGAGG + Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
970833063 4:20366148-20366170 GAGCAATAAGAGAGGGAGGGAGG - Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971445758 4:26746451-26746473 TAGTAAAATGAGAATGATGGAGG - Intronic
972703546 4:41517295-41517317 CAGCAAATTGCAAAGGAGGCTGG + Intronic
972847300 4:43005143-43005165 CAGGAAAAAGAGAGTGAGGGGGG - Intronic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
973818246 4:54638993-54639015 CAGCAAAATGAGGAGATGGGAGG + Intergenic
974453848 4:62100782-62100804 CAGGAAAATGGGAATTAGGGAGG - Intergenic
975060919 4:69998071-69998093 CAAGAAAATGAAAAAGAGGGAGG - Intronic
975112304 4:70641705-70641727 CAGAAAAATTAGGAGGATGGAGG + Intronic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
975595391 4:76044812-76044834 CATCAAAATGGGAAGGAGAGGGG - Intronic
976174138 4:82335451-82335473 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
976283604 4:83349278-83349300 GAGAAAAATGAGTAGGAGGATGG - Intergenic
976468666 4:85401583-85401605 CAGCAGGATCAAAAGGAGGGAGG - Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978362044 4:107940783-107940805 AAGGAAGATGAGAAGGAAGGGGG + Intronic
978972237 4:114822599-114822621 GAGCAAACTGAAAAGGTGGGTGG + Intergenic
979263196 4:118671712-118671734 CATCACAGTGAGATGGAGGGAGG + Intergenic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
979610593 4:122685017-122685039 CAGCCAAATGAGGAGGTGGGCGG + Intergenic
979621808 4:122806492-122806514 CAGTGAAATAAGAAGCAGGGGGG + Intergenic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
980751468 4:137095491-137095513 CAGCAAAATTAGGAGTAGGAAGG + Intergenic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981767149 4:148263838-148263860 TAGCAAAATGTGAAGGAGTTAGG - Intronic
982216211 4:153084689-153084711 CAACCAAATGAGAAGGAGCAGGG - Intergenic
983066960 4:163222241-163222263 CAGGAAAATGAGAATTAAGGAGG - Intergenic
984908780 4:184652849-184652871 AAGAAAAAAGAAAAGGAGGGAGG + Intronic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985695273 5:1336651-1336673 CAGCAAACAGAGAAAGAGGTTGG + Intronic
985861742 5:2476877-2476899 GAGAGAAATGAGAGGGAGGGAGG + Intergenic
986758741 5:10860822-10860844 CAGCAAAATGAGAGGCACAGAGG - Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987043477 5:14085104-14085126 GAGGACAATGAGAAGGAAGGAGG - Intergenic
987216909 5:15747102-15747124 CAGAAAGATGAGAAGGGAGGTGG + Intronic
987570627 5:19653658-19653680 CAGCAAAATGAGATGGCCTGGGG - Intronic
987890291 5:23867671-23867693 GAGGAAGATGAAAAGGAGGGAGG - Intergenic
987930996 5:24398960-24398982 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988665840 5:33326509-33326531 AAGCAAAATGAAAGGGAGGAAGG - Intergenic
989437303 5:41429703-41429725 TAGAAATATGATAAGGAGGGAGG + Intronic
989555174 5:42786144-42786166 CAAAAAATTGAGGAGGAGGGAGG - Intronic
989592234 5:43121929-43121951 CAGCAACGTGAAAAGAAGGGGGG - Exonic
989957750 5:50375718-50375740 CATCAAAATGGGAAGGAGAGGGG + Intergenic
990755424 5:59064108-59064130 AAGGAAAGAGAGAAGGAGGGAGG + Intronic
991603777 5:68379870-68379892 CAGCCAATTGCAAAGGAGGGTGG + Intergenic
991645389 5:68795827-68795849 CATCAAAATGGGGAGGTGGGAGG - Intergenic
992475417 5:77097142-77097164 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
992689032 5:79225493-79225515 GAGGAAAATGAGAAGGAAGCTGG - Intronic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993729304 5:91403719-91403741 CACCAAAATGAAAAGCAGGAGGG + Intergenic
994539963 5:101081940-101081962 TAACAAAAAGGGAAGGAGGGAGG - Intergenic
995099461 5:108280906-108280928 CAGTAAAAAGAGAAAGAGAGAGG + Intronic
995229801 5:109746417-109746439 GAGCAAAATGACAAGGAGACAGG - Intronic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995583004 5:113620427-113620449 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996311211 5:122107866-122107888 CAGCAAAATGTGGAGGAAGCAGG - Intergenic
996673508 5:126148336-126148358 CAGGAGGATGAGGAGGAGGGGGG - Intergenic
996911665 5:128663058-128663080 CAGCAAGATGTTAAGGAGGGAGG + Intronic
997183456 5:131857703-131857725 CAGCAAAGTGAGGTGGAGGAAGG - Intronic
997379079 5:133422335-133422357 TGGCAAAAGGAGAAGCAGGGAGG + Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
998526888 5:142850715-142850737 CAGCCTAATGAGAAGGGAGGAGG - Intronic
998771935 5:145555747-145555769 CAAGAAAAAGAGAAGGATGGAGG + Intronic
998915350 5:147005585-147005607 CATCAAAAGGGGAAGGAGAGGGG + Intronic
999035419 5:148343500-148343522 CAGCCAAAACAGAAGTAGGGTGG - Intergenic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999721925 5:154405011-154405033 AAGAAAAATGAAGAGGAGGGAGG + Intronic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1001456808 5:171868576-171868598 CAGCAAAATTGGAAGGGGAGAGG + Intronic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1002085881 5:176775037-176775059 CAGCAAACTGAGGAGGAGGGAGG - Intergenic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002372419 5:178765878-178765900 CACCAAGATGGAAAGGAGGGAGG + Intergenic
1002408555 5:179055167-179055189 CAGCCAAATGAGGAGTTGGGAGG + Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003256055 6:4475836-4475858 CAGCAAACTGAGAAGATGGTGGG + Intergenic
1003376236 6:5580298-5580320 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1003854113 6:10254637-10254659 AAGCAAACTGAGGAGGAGAGGGG + Intergenic
1003942394 6:11043155-11043177 GAGCAAAATCAGATGGAGTGGGG + Intronic
1004331861 6:14728982-14729004 GAAAAAAATGGGAAGGAGGGAGG + Intergenic
1004798494 6:19116728-19116750 AACCAAAATTAGAAGGAGGAAGG + Intergenic
1004878640 6:19983368-19983390 AAGGAAAATGAGAGCGAGGGTGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1006184908 6:32176030-32176052 CAGCAGAAAGGGAGGGAGGGAGG - Intronic
1006716862 6:36126007-36126029 AAGCAAAATTACAAGGAGGCAGG - Intergenic
1006979398 6:38134784-38134806 CAGCAAAATGTGAAGTGGTGAGG - Intronic
1007281430 6:40715138-40715160 CAGCAAACAGAGAAATAGGGAGG - Intergenic
1007322307 6:41036426-41036448 CAACAAATTGAGAAGGTGGAAGG + Intronic
1007502052 6:42305760-42305782 CAGGAAAATGGAGAGGAGGGAGG + Intronic
1007521086 6:42452245-42452267 GAGCAAAAAGAGGGGGAGGGCGG + Intergenic
1008004014 6:46390931-46390953 CAGCCAAATGAGTGGCAGGGGGG + Intronic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1009407296 6:63327868-63327890 CATCAAAATGGGAAGGAGAGGGG - Intergenic
1010704334 6:79089806-79089828 AAGGAAAAAGAGAGGGAGGGAGG - Intergenic
1010863617 6:80944453-80944475 CAGTAAAATGAGTAGGAGCTGGG - Intergenic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012689892 6:102297206-102297228 CAGCAAAGGGAGATGGGGGGGGG - Intergenic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1012852231 6:104460905-104460927 CAGCAAAATGATAATGATTGGGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013480210 6:110546520-110546542 CAGGAAGATGAGGAGGAAGGGGG - Intergenic
1013564423 6:111342859-111342881 CAGCAAAATGAGAGGCTGGAAGG + Intronic
1014453745 6:121613321-121613343 CAGTAGAATGAAAAGAAGGGTGG + Intergenic
1014997242 6:128164064-128164086 GAAGAAAATGAGAAGGAGTGAGG - Intronic
1015064775 6:129011206-129011228 GAGCAAAAAGAGAAGGAGAGAGG - Intronic
1015788841 6:136945953-136945975 CAGTGAAATGAGAACGTGGGTGG - Intergenic
1015935345 6:138402831-138402853 AAGAGAAATGGGAAGGAGGGTGG - Intergenic
1016010233 6:139131934-139131956 AAACAAAATGAAAAGGAGGAAGG - Intergenic
1016491555 6:144609920-144609942 CAGCAAAATTAGCAGAAAGGGGG + Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017315977 6:153031917-153031939 CAGCAAAGTGTGAAAGAGGAAGG + Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018304878 6:162444545-162444567 TAGGAAGAGGAGAAGGAGGGAGG - Intronic
1018342958 6:162870883-162870905 AAGAAACAAGAGAAGGAGGGAGG - Intronic
1018569163 6:165188633-165188655 AAGCAACAGGAAAAGGAGGGTGG - Intergenic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020150913 7:5680997-5681019 CAGCAGCATGAGAGGGAGTGAGG - Intronic
1020914876 7:14180363-14180385 GAAAAAAATCAGAAGGAGGGTGG - Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021117040 7:16755242-16755264 CACCAACAGGAGAAGGAGGTTGG + Intronic
1022268647 7:28784462-28784484 AAGCAAAATGAGCAGGAGGGAGG - Intronic
1022311696 7:29202467-29202489 CAACAAAATGGGAAGGTGGAAGG + Intronic
1022841181 7:34165425-34165447 CTGCAAAATGTGAAGAATGGAGG - Intergenic
1023314394 7:38920429-38920451 AAGCACAATGAAAAGGTGGGAGG - Intronic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024300373 7:47882883-47882905 CAGCAAGAAGAGAAGCAGCGAGG + Intronic
1024409734 7:49026474-49026496 CAGCCAAATGAGGAGGTGGGAGG - Intergenic
1024654814 7:51442669-51442691 CAGGAAAATAAGAATTAGGGAGG + Intergenic
1024946886 7:54817357-54817379 CAGGAAGACGAGAAGCAGGGAGG - Intergenic
1025760514 7:64385491-64385513 CAGCTGAATTAGAAAGAGGGAGG - Intergenic
1025798307 7:64760416-64760438 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1026585077 7:71649370-71649392 CAGCCAAATGAGGAGATGGGAGG + Intronic
1026670832 7:72389261-72389283 GGGCAAAATGAGAAAGAGGCAGG - Intronic
1026962832 7:74420054-74420076 AAGGAAGAAGAGAAGGAGGGAGG - Intergenic
1026990182 7:74580686-74580708 GAACAGAATGAGCAGGAGGGGGG + Intronic
1027174779 7:75896409-75896431 CTGCAGAATGAGAAAGAGTGAGG + Intergenic
1027456723 7:78401468-78401490 CAACAAAATGAGAGAGAGAGGGG - Intronic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1028109297 7:86919966-86919988 CAGTAAAATGAGGAAGAGAGAGG + Intronic
1028231858 7:88315396-88315418 CATCTAAGTGAGAAGGAAGGTGG - Intergenic
1028235510 7:88356565-88356587 CAGCAAAATCACAGGGAGTGGGG - Intergenic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028742589 7:94292806-94292828 GAGGAAAATGAGAAAGAAGGAGG - Intergenic
1029312439 7:99679612-99679634 CACCAAAATTAGAAGGTGGATGG + Intronic
1029314576 7:99699752-99699774 CACCAAAATTAGAAGGTGGCTGG + Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029782280 7:102747487-102747509 CACCAAAAGAATAAGGAGGGAGG + Intergenic
1030114589 7:106053674-106053696 CAGAAAGAAGGGAAGGAGGGAGG - Intergenic
1031575239 7:123408067-123408089 AAGCAAAATTAGAAGGCAGGAGG - Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032269283 7:130388896-130388918 CAGGAGAATGGGAAGGAGTGGGG - Intergenic
1032280733 7:130498797-130498819 CAGCTATATCAGAAGGAGTGAGG + Intronic
1032966971 7:137108885-137108907 CCCCAAAATGGGAAGGTGGGAGG - Intergenic
1033573204 7:142654792-142654814 AACCAAAAAGAGAAGAAGGGAGG + Intergenic
1033600012 7:142882587-142882609 CAGGAACATGAGCTGGAGGGAGG - Intronic
1033667042 7:143451427-143451449 CACCAAAATCCCAAGGAGGGTGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034579557 7:152030888-152030910 CATCAAAACGGGAAGGAGAGGGG - Intronic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1037308986 8:17535300-17535322 AAGCTCAGTGAGAAGGAGGGCGG - Intronic
1037530959 8:19773001-19773023 CAGGGAGATGAGAAAGAGGGTGG + Intergenic
1037704700 8:21309400-21309422 GAGCAAACCGAGAGGGAGGGAGG - Intergenic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038639202 8:29310356-29310378 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1038914594 8:32006625-32006647 GAGCCACATGAGAAGGAAGGTGG + Intronic
1039124833 8:34189753-34189775 CAGCAAAAGGAAAAGAAGAGGGG - Intergenic
1039133334 8:34292702-34292724 GAACAAAATTAAAAGGAGGGAGG + Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039862300 8:41469255-41469277 CAGAAAGAAGAAAAGGAGGGAGG - Intergenic
1040999709 8:53438625-53438647 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1041098130 8:54369853-54369875 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1042361407 8:67887467-67887489 CAACATATTGAGAAGGAGGATGG - Intergenic
1043232760 8:77823362-77823384 AAGCAAAATGAGGTGGTGGGCGG + Intergenic
1044262804 8:90147547-90147569 GAGCAAAATGAGATGCAGAGGGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045097757 8:98816164-98816186 CAGGAAAAGGAAAAGGATGGAGG + Intronic
1045132143 8:99164928-99164950 CATCAAAACGGGAAGGAGAGGGG - Intronic
1045435596 8:102160473-102160495 CAGCCAAGTTAGAAGGAGAGGGG - Intergenic
1045729447 8:105218293-105218315 CAGGGACATGAAAAGGAGGGAGG + Intronic
1045951587 8:107857387-107857409 AAGCAAAATGACAAAGAGAGAGG + Intergenic
1046761017 8:118020835-118020857 CATTAAAGTTAGAAGGAGGGTGG - Intronic
1048526698 8:135209275-135209297 CAGCAAAGTGAGAAGTTGGAGGG + Intergenic
1049069896 8:140348268-140348290 TAGTCAAATGAGCAGGAGGGAGG + Intronic
1049442727 8:142616645-142616667 CAGCAAGCTGACAAGGAGGCAGG + Intergenic
1049594849 8:143478497-143478519 CAAAAAAATAAGAAGGAGCGGGG - Intronic
1050764191 9:9112022-9112044 CAGCAAAATGAGAAGAAAAATGG - Intronic
1052682655 9:31714264-31714286 CAGCATAATGATTAGAAGGGTGG - Intergenic
1052977063 9:34419193-34419215 CAGCAAAATAAGAAGGTGTGTGG + Intronic
1053014350 9:34653703-34653725 CAGCAAGAGGGAAAGGAGGGTGG - Intronic
1055142344 9:72889847-72889869 CAGAAAAGTAAGAAGGAAGGTGG - Intergenic
1055153242 9:73028812-73028834 CATGAAAATGTAAAGGAGGGGGG - Intronic
1055247802 9:74267983-74268005 TATCAAATTGAGAAGGAGTGGGG - Intergenic
1055591022 9:77813946-77813968 TAGCAAAGTGAGAAGCAGAGAGG + Intronic
1056391614 9:86146391-86146413 CAGCAAAAGGAGATGGGGTGGGG - Intergenic
1056422495 9:86442952-86442974 AAGGAAAGAGAGAAGGAGGGAGG - Intergenic
1056554455 9:87677158-87677180 CAATAAATGGAGAAGGAGGGAGG - Intronic
1057419819 9:94902325-94902347 CAGCAAACTGAGCTGGAGTGGGG + Intronic
1057437983 9:95059588-95059610 CAGAAAGATGAGGAGCAGGGAGG + Intronic
1058462364 9:105195041-105195063 CAGCAAAGAGAGAGGGAAGGGGG - Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061865726 9:133490965-133490987 GAGCAAAAGGTGGAGGAGGGAGG + Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185755441 X:2649823-2649845 AGGGAAAGTGAGAAGGAGGGAGG + Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1187217515 X:17291249-17291271 TAGCAATATGAGGAGCAGGGTGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188451386 X:30310729-30310751 CAGCAAAAAAAGAAAGAGGGAGG - Intergenic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1189478482 X:41375221-41375243 CAGCCAACTGGGCAGGAGGGTGG - Intergenic
1190536517 X:51433594-51433616 GAGAAAAATCAGCAGGAGGGGGG - Intergenic
1190739927 X:53281851-53281873 CAGAAAATTGAGATGGAGAGAGG + Intronic
1192314301 X:70040056-70040078 CTGCAAAATGAGCTGGAGGCTGG - Intergenic
1192552317 X:72064355-72064377 CAGCAGAATGAAAAGGAGACAGG + Intergenic
1192869861 X:75175086-75175108 CATAAAAATGGGAAGGAGAGGGG - Intergenic
1193607676 X:83588563-83588585 CAGCAGAATGAGATGGAGTTTGG - Intergenic
1194135935 X:90141704-90141726 CAGCAAAATAATGAGGGGGGTGG - Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194349896 X:92813263-92813285 CAGCAAAATTAGGTGGAGAGGGG + Intergenic
1194912057 X:99657459-99657481 CAGCAAATTGAGGAGCAGGGGGG + Intergenic
1195731829 X:107976246-107976268 GAGGGAAATGAGAGGGAGGGAGG + Intergenic
1196126967 X:112111412-112111434 CATCAAAAGGGGAAGGAGAGAGG - Intergenic
1196505225 X:116434456-116434478 TAGCCAAATGAAGAGGAGGGTGG + Intergenic
1196753670 X:119139362-119139384 CAGGAAAGTGGGAAGGTGGGAGG + Intronic
1197034151 X:121854184-121854206 CAGCAAAGTGATATGGTGGGTGG - Intergenic
1197356728 X:125444879-125444901 CAGCACAATGAGGAGGAATGAGG - Intergenic
1197628781 X:128833843-128833865 CAGCAAAATGGGAGGTGGGGTGG + Intergenic
1198080132 X:133231865-133231887 AAAAAAAAAGAGAAGGAGGGAGG + Intergenic
1198150180 X:133900631-133900653 CAACAAAATGATAAGGAGGAAGG + Intronic
1198673050 X:139102313-139102335 CTGCAAAATGAGAATGATGCTGG + Intronic
1198683682 X:139205965-139205987 AAGAAAAGAGAGAAGGAGGGAGG + Intronic
1199538737 X:148933513-148933535 AAGCCAAATGAGAAGGATGGTGG + Intronic
1199606337 X:149582565-149582587 CAGGACAATGATCAGGAGGGCGG + Exonic
1199632785 X:149786803-149786825 CAGGACAATGATCAGGAGGGCGG - Exonic
1199767872 X:150953873-150953895 AAGAAAACAGAGAAGGAGGGGGG - Intergenic
1199832001 X:151556832-151556854 CATCAAAATGGGAAGAAGAGGGG - Intergenic
1199854511 X:151749732-151749754 CACCAAAAGAAGAAGGAGTGTGG - Intergenic
1200481689 Y:3711780-3711802 CAGCAAAATAATGAGGGGGGTGG - Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201271802 Y:12263118-12263140 CATCAAAAGGGGAAGGAGTGGGG - Intergenic
1201487963 Y:14511702-14511724 CATCAGAATGGGAAGGAGAGGGG + Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic
1201782931 Y:17743279-17743301 AAGAAAGATGAGAGGGAGGGTGG + Intergenic
1201818622 Y:18162708-18162730 AAGAAAGATGAGAGGGAGGGTGG - Intergenic
1202089732 Y:21177432-21177454 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1202126828 Y:21575731-21575753 CAACAAAATGTGAGGGAGGGTGG + Intergenic
1202192247 Y:22257539-22257561 CATCAAAAGGGGAAGGAGAGGGG - Intergenic
1202258273 Y:22942697-22942719 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1202271639 Y:23079543-23079565 CATCAAAATGGGAAGAAGAGGGG - Intergenic
1202294387 Y:23341139-23341161 CATCAAAATGGGAAGAAGAGGGG + Intergenic
1202411263 Y:24576455-24576477 CATCAAAAGGGGAAGGAGAGGGG + Intergenic
1202424636 Y:24713287-24713309 CATCAAAATGGGAAGAAGAGGGG - Intergenic
1202446153 Y:24956798-24956820 CATCAAAATGGGAAGAAGAGGGG + Intergenic
1202459518 Y:25093617-25093639 CATCAAAAGGGGAAGGAGAGGGG - Intergenic