ID: 951681934

View in Genome Browser
Species Human (GRCh38)
Location 3:25304028-25304050
Sequence ACTGAAGTCAAGATGGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951681934 Original CRISPR ACTGAAGTCAAGATGGGTCT AGG (reversed) Intronic
901024387 1:6271402-6271424 ACAGGAGACAAGAGGGGTCTTGG + Intronic
905312634 1:37060778-37060800 GCTGGAGTCAGGATGGATCTGGG - Intergenic
905899442 1:41571576-41571598 ACCCAAGTCAAGAAGGGACTTGG + Intronic
907797851 1:57735286-57735308 ACTGAAGTCCAGATAGGTGATGG - Intronic
908248035 1:62243262-62243284 ACTGAAATCCAGGTGGGTTTAGG - Intronic
908694146 1:66817935-66817957 TCTTAAGTCAAGATGCATCTTGG + Intronic
909128681 1:71707697-71707719 CCTGAAGTCAATATAGCTCTGGG - Intronic
909504658 1:76374774-76374796 ATTGAATTTAATATGGGTCTGGG - Intronic
915108466 1:153548579-153548601 ATGGAGGTTAAGATGGGTCTGGG - Intronic
919111571 1:193226071-193226093 AATCAACTCAAGATGGGTCAAGG - Intronic
919115085 1:193271629-193271651 AATCAACTCAAGATGGGTCAAGG - Intergenic
924069427 1:240260901-240260923 AATCAATTCAAGATGGGTCAAGG - Intronic
1063430776 10:5986204-5986226 ACAGAGGGCAAGGTGGGTCTGGG - Intergenic
1063500011 10:6544913-6544935 ACTTAAGACAATGTGGGTCTGGG - Intronic
1064586259 10:16842455-16842477 ATTGAGGTAAAGATGGCTCTGGG - Intronic
1065023797 10:21522845-21522867 ATTGAATTCAAGATGGGTCAGGG - Intronic
1066259522 10:33715561-33715583 CCAGAAGCCAAGATGGGCCTCGG - Intergenic
1069657700 10:70102305-70102327 ACAGCAGCCAAGATGAGTCTGGG + Intronic
1071816526 10:89237857-89237879 ACTGAATTAAAGATGTGTTTGGG - Intronic
1072016053 10:91347721-91347743 ACTGAAGTAAAAAGGGGTGTTGG - Intergenic
1072529312 10:96303774-96303796 ACTGAATTCAAGATATGGCTTGG + Intergenic
1073629134 10:105130595-105130617 ACTGAAGCCAATATTGCTCTGGG - Intronic
1073701349 10:105930500-105930522 AATCAACTCAAGATGGGTCAAGG + Intergenic
1080159887 11:29160888-29160910 ACTGAAGCCAAAAAGGATCTAGG - Intergenic
1081679478 11:44991639-44991661 TCAGTAGTCAAGATGGGACTGGG - Intergenic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1081974124 11:47220571-47220593 ACTGTAATGAAGATTGGTCTAGG + Intronic
1082044584 11:47714806-47714828 TCTGAAGTCAAGAGGGAGCTGGG - Intronic
1082670334 11:56028255-56028277 ACTGAAATCAAGATTGAACTAGG - Intergenic
1082743432 11:56936735-56936757 AGTTGAGTCAAGAGGGGTCTGGG - Intergenic
1086535533 11:87840310-87840332 TGGGAAGTCATGATGGGTCTTGG + Intergenic
1092978111 12:13765518-13765540 ACTGATGTCAAGATGGATGATGG + Intronic
1093392891 12:18644229-18644251 GCTGGTCTCAAGATGGGTCTGGG + Intronic
1097013744 12:55970997-55971019 ACTGACGTCAACGTGGGTCTTGG + Intronic
1097285207 12:57871956-57871978 ACTGAAGTGAGGAAGGGGCTGGG - Intergenic
1102202803 12:111069130-111069152 CCTGGAGTCAGAATGGGTCTGGG + Intronic
1102813465 12:115843656-115843678 AATGAAGTCATGATGGGTTAAGG + Intergenic
1108713196 13:53054371-53054393 GCTGTAGTCAATATGGGTATTGG + Intergenic
1109658194 13:65422061-65422083 AATCAACTCAAGATGGGTCAAGG + Intergenic
1109675182 13:65665891-65665913 ACTGTTCTCAAGATTGGTCTAGG + Intergenic
1110513277 13:76378879-76378901 ACTGAAATAAAGTTTGGTCTAGG + Intergenic
1111281203 13:86027651-86027673 ACTCAACTCAAGATGGATCAAGG - Intergenic
1111764553 13:92511810-92511832 GATGAAGTCAGGAAGGGTCTAGG - Intronic
1119568978 14:75653297-75653319 ACTGAGGTAAAGATAAGTCTGGG + Intronic
1120750557 14:88193702-88193724 ACTGAAGCCAAGAGGGGTTAAGG + Intronic
1121429818 14:93878937-93878959 ACTAAACTCAAGATCTGTCTTGG + Intergenic
1122409813 14:101520128-101520150 ACTGAGGTCAAGATGGAGCAGGG - Intergenic
1122672351 14:103382474-103382496 ACTTAACTCAAGATGCTTCTGGG - Intergenic
1123454246 15:20403661-20403683 AATGAACTCAAAATGGGTCAAGG - Intergenic
1124951754 15:34329232-34329254 AGTGAAGTCATGATGGCTCAGGG + Intronic
1125348740 15:38745563-38745585 ACTGGAGTCAAGTGGGGACTGGG + Intergenic
1127842195 15:62841214-62841236 ACAAAATACAAGATGGGTCTGGG - Exonic
1128521095 15:68375421-68375443 AATGGGTTCAAGATGGGTCTGGG + Intronic
1134397664 16:13880160-13880182 ACTGAAGACAAAATGAGGCTGGG + Intergenic
1137473946 16:48790366-48790388 AGTGAAGTCAAGCTGGTGCTTGG - Intergenic
1139701930 16:68713111-68713133 AATGAAGTCAAGATTGTTTTTGG + Intronic
1139803256 16:69541822-69541844 TCTGAAGAAAAAATGGGTCTGGG - Intergenic
1141316635 16:82968621-82968643 ACAGAAGGAGAGATGGGTCTTGG - Intronic
1143073143 17:4315402-4315424 AATGACGTCTAGTTGGGTCTTGG - Intronic
1146922576 17:36723140-36723162 ACTGAAGCTAAGTTGGGTGTGGG - Intergenic
1148606179 17:48930684-48930706 ACTGAAGCCAAAATAGGTGTGGG - Intronic
1149205791 17:54245040-54245062 ACTGCAGTCAAGATGTGGCCAGG - Intergenic
1151256965 17:72885428-72885450 AGTGAATGCAGGATGGGTCTAGG - Intronic
1153218055 18:2838174-2838196 ACTGATGGCAGCATGGGTCTGGG + Intergenic
1157181309 18:45500703-45500725 AGTGAAGTAAAGAAGGGGCTGGG - Intronic
1158677149 18:59530239-59530261 TCTGGAGTCAAGGTGGGTGTTGG + Intronic
1159145173 18:64445084-64445106 ACAGGAGTCATTATGGGTCTCGG - Intergenic
1159666836 18:71171651-71171673 ACAGAGGTAAAGATGGGTTTGGG - Intergenic
1163644125 19:18478721-18478743 TCTGAAGTCCAGTTGGGTCTGGG - Intronic
1164778957 19:30877199-30877221 ACAGAAGTACAGATGGCTCTTGG + Intergenic
1167035038 19:46990133-46990155 AATGAAGTTAACATGGGTCTAGG + Intronic
925624592 2:5829978-5830000 ACTTAAGGTAAGATGGGACTTGG + Intergenic
925656550 2:6156069-6156091 TCTGATGTCTAGCTGGGTCTGGG - Intergenic
926481045 2:13395545-13395567 AATGAACTCAAAATGGGTCAAGG + Intergenic
928948439 2:36792603-36792625 ACTGATGTGAAGTTTGGTCTGGG - Intronic
933240261 2:79913206-79913228 ACTGAAGTTAAGAATGGCCTAGG + Intronic
933366093 2:81356132-81356154 ACTGAGGGCAAGAAGGGTCAGGG - Intergenic
933539445 2:83619775-83619797 ACTGAAGTAAAGTTTGCTCTTGG - Intergenic
933844043 2:86310992-86311014 ACTTCAGTCTAGAAGGGTCTAGG + Intronic
935079720 2:99780719-99780741 AGAGAAGTCAAGATGAGTCCAGG - Intronic
935139970 2:100344363-100344385 ATTCAACCCAAGATGGGTCTTGG + Intergenic
936501431 2:113069920-113069942 ACAGAAGTTAATATTGGTCTTGG + Intronic
938652478 2:133398010-133398032 ACTGTAGTCAAGCAGGCTCTGGG + Intronic
939297049 2:140280391-140280413 GTTGAAGACAAGATGAGTCTAGG + Intronic
939602252 2:144207446-144207468 ACTGGAGGCAAGATGGGCATTGG + Intronic
939847568 2:147267401-147267423 ACTGAAGTCAAGGTGAAACTGGG - Intergenic
939965837 2:148609565-148609587 ACTTAAGTCACTTTGGGTCTTGG - Intergenic
942311477 2:174660967-174660989 ACTGAAGTCAAGAGGGGCGAGGG + Intronic
944153223 2:196584241-196584263 ACTGAGGTGGAGATGAGTCTAGG + Intronic
946285040 2:218696596-218696618 ACTGAGGTACAGATGGATCTTGG + Exonic
947444230 2:230151064-230151086 ACTGCAGCCAAAATAGGTCTGGG + Intergenic
1172213748 20:33219198-33219220 AAAGAAGTCAAAATGGGGCTGGG - Intronic
1172354084 20:34267282-34267304 ACTGAAGGGAAGAGTGGTCTGGG + Intronic
1174731762 20:52924987-52925009 ACTGAAGTGATGTTGGTTCTTGG + Intergenic
1176999813 21:15598342-15598364 AATCAACTCAAGATGGATCTAGG + Intergenic
1177750053 21:25270031-25270053 AATGAACTCAAGATGGATCAAGG + Intergenic
1178808731 21:35861416-35861438 AATAAAGTCAAGATGGAACTTGG - Intronic
1179057517 21:37949752-37949774 ACTCAAGGCTAGATGGGACTTGG + Intergenic
1180134674 21:45854805-45854827 ACTGAAATGAAGCTGGGTGTGGG + Intronic
1182576048 22:31273605-31273627 ACTAAAATCAACATGGGTGTAGG + Intronic
951295052 3:20923328-20923350 AATCAATTCAAGATGGGTCAAGG + Intergenic
951681934 3:25304028-25304050 ACTGAAGTCAAGATGGGTCTAGG - Intronic
953875210 3:46662687-46662709 CCCGAAGGCAACATGGGTCTTGG - Intergenic
954709408 3:52497878-52497900 ACTGGAGTGAAGATGGGTTTGGG + Intronic
956514858 3:70035263-70035285 ACTGACTTCAAGAAGGGGCTGGG - Intergenic
957538020 3:81531438-81531460 TCTGAAGCCAACATGGTTCTGGG + Intronic
957554788 3:81752587-81752609 GCTGAAGGCAAGATGAGTCCTGG - Intronic
958040759 3:88223044-88223066 ACTGAACTCAAGAGGTGGCTTGG + Intergenic
958433132 3:94065328-94065350 CCTGAAGGGAAGCTGGGTCTTGG + Intronic
958444491 3:94198380-94198402 AACCAACTCAAGATGGGTCTAGG - Intergenic
958599096 3:96270604-96270626 ACTGAAGTCATCATTGGTTTTGG - Intergenic
959913736 3:111793626-111793648 CCTGAAGTCAGCATGGGACTAGG + Intronic
962791797 3:138817989-138818011 GCTTAAGTCAAGATGGGGCTGGG + Intronic
964080294 3:152746073-152746095 AGTGAAGCAAAGTTGGGTCTGGG + Intergenic
964892366 3:161552389-161552411 ACAGAAGTTCAGATGGGACTGGG + Intergenic
965477354 3:169173474-169173496 ACTGAATTTAAGATGCCTCTGGG - Intronic
967233524 3:187363748-187363770 ACTGAAGTCAAGATAGATTTGGG - Intergenic
969037501 4:4266599-4266621 ACTGAACTCAAGATGCTGCTTGG + Intergenic
976157570 4:82163508-82163530 AATGAACTCAAGATGGATCAAGG + Intergenic
976315145 4:83652092-83652114 ACTGCATTCAAGATGAATCTTGG + Intergenic
976763721 4:88577414-88577436 ATTGTAGTCAATATGGGTTTTGG - Intronic
977381888 4:96285784-96285806 AATGAGGTGAACATGGGTCTAGG - Intergenic
979184629 4:117772752-117772774 CCTGAAGCCAACATGGCTCTGGG - Intergenic
980482515 4:133405271-133405293 ACTGAAGTAAAGAAGTGCCTTGG - Intergenic
980543646 4:134229047-134229069 ATTCAAGTCAAGATGGCTCAAGG - Intergenic
980925337 4:139131076-139131098 GCTCAAGTCACCATGGGTCTTGG + Intronic
982469101 4:155764971-155764993 CCAGAAATCAAGCTGGGTCTTGG + Intronic
983249492 4:165327919-165327941 ACTGGAGTGAAGGTGGGCCTAGG + Intronic
984537347 4:180993311-180993333 ACAGAACTCAAGATGGGTAGAGG - Intergenic
987440247 5:17946911-17946933 AATTAACTCAAGATGGGTCAAGG - Intergenic
989689697 5:44126318-44126340 AATCAACTCAAGATGGGTCAAGG + Intergenic
992107236 5:73459829-73459851 AGTGAAGACAAGATTGGTCAAGG - Intergenic
992150367 5:73896573-73896595 ACAGAAGTTAAGATGAGCCTTGG + Intronic
992865233 5:80951251-80951273 GGTGAAGCCAAGATGGCTCTAGG - Intergenic
995632731 5:114151345-114151367 ACTGGAGTAAAGAAGGGGCTGGG - Intergenic
997763544 5:136475054-136475076 AATCAACTCAAGATGGGTCAAGG - Intergenic
997835635 5:137190833-137190855 ACTGAGGTCAAGATGGAGCAGGG + Intronic
998665898 5:144297370-144297392 TCTGAAGTCAGGATGGGTTCAGG + Intronic
1000304662 5:159984388-159984410 ACAGAAGTCAAGAATGCTCTAGG - Intergenic
1002964541 6:1950433-1950455 AGCCAAGTCAAGATGGGTTTGGG - Intronic
1003238777 6:4323127-4323149 ACTGAAGCCAAGGTGGGGCTGGG - Intergenic
1005307137 6:24524746-24524768 AGTGAAGGCAATTTGGGTCTAGG + Intronic
1006446647 6:34083555-34083577 GCGGAAGGCAAGATGGGTCTTGG + Intronic
1007781905 6:44259201-44259223 ACTGAAGCCAGGCAGGGTCTGGG - Exonic
1008426688 6:51366501-51366523 ACTGAAGTCAAGGTCAGCCTTGG - Intergenic
1008954064 6:57195504-57195526 ACTGTAATCAAGGTTGGTCTGGG + Intronic
1010596524 6:77769883-77769905 CCTGAAGCCAACATGGCTCTGGG - Intronic
1016322039 6:142856882-142856904 ACGGAAGTCCAGGTTGGTCTCGG - Intronic
1016764761 6:147779742-147779764 ACTGAAGGGAAGATGGATGTGGG + Intergenic
1018841240 6:167518569-167518591 GCTGAAGTCAAGGGGGGTCAGGG - Intergenic
1018860358 6:167706800-167706822 ACTGAAGTAAAGCTGGCTGTAGG - Intergenic
1019307726 7:343889-343911 ACTGACTTCAACATGGGCCTGGG - Intergenic
1020904933 7:14052900-14052922 ACTGAAGGCTAGATGGGTTAGGG + Intergenic
1033314526 7:140286606-140286628 ACTGAAGTCCTGTTGGGTCAGGG - Intergenic
1033946313 7:146723108-146723130 AATCAAGGCAAGATGGGTGTTGG + Intronic
1038001087 8:23391795-23391817 ACTGAGGTCAGGAGGGGTTTGGG + Intronic
1038670091 8:29576297-29576319 ACTGAAGTCAAGTGGAGACTTGG + Intergenic
1038903218 8:31867543-31867565 ACATAATTCAAGGTGGGTCTTGG + Intronic
1040928760 8:52713663-52713685 GCACAAGTCAAGATGCGTCTTGG + Intronic
1041561383 8:59223303-59223325 ACTGAAGTTAAGATTTGTATTGG + Intergenic
1041864694 8:62558056-62558078 AATCAACTCAAGATGGGTCAAGG - Intronic
1042628837 8:70793077-70793099 ACTGAAGTCAAAATGGTTCAAGG - Intergenic
1042793321 8:72633065-72633087 ACTGAAGTCAAGATGGCAGCAGG + Intronic
1044305955 8:90641550-90641572 ACTGGAATCAGGATGTGTCTGGG + Intronic
1046823615 8:118662665-118662687 ACAAAAGTCAATATGGCTCTGGG - Intergenic
1048032365 8:130644810-130644832 AGTGAAGTCAAGAAGGGTCCAGG - Intergenic
1049061356 8:140278546-140278568 GCAGTAGTCAAGATGGGCCTGGG + Intronic
1049324264 8:142013914-142013936 TCTGCAGTCAAGATTGGTCAGGG + Intergenic
1052981972 9:34456929-34456951 ACAGCAGCCAAGATGGGCCTCGG - Intronic
1055077508 9:72231154-72231176 CATGAAGTCAAGATAGGGCTGGG + Exonic
1061219525 9:129242216-129242238 ACGGAAGACAAGGTGGGGCTGGG + Intergenic
1061436748 9:130568092-130568114 TCAGAATTCCAGATGGGTCTGGG - Intergenic
1189393727 X:40601774-40601796 ACTGAAGTCAGTGTGGGACTTGG + Intronic
1190057705 X:47191276-47191298 ACTAAAGTCAAGGCGGGACTGGG + Intronic
1193439552 X:81522241-81522263 ACTGAAGACAAAATGGAGCTGGG - Intergenic
1195461582 X:105132075-105132097 ACTGAAGTATAGATGGCACTTGG + Intronic
1197656875 X:129126352-129126374 ACTGAAGGCTATATGGGTCCAGG - Intergenic
1201759867 Y:17525045-17525067 ACTGAAGAAAAGAGGTGTCTTGG - Intergenic
1201841687 Y:18380945-18380967 ACTGAAGAAAAGAGGTGTCTTGG + Intergenic