ID: 951682588

View in Genome Browser
Species Human (GRCh38)
Location 3:25310001-25310023
Sequence AATACTACCATGCTGCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951682588_951682592 7 Left 951682588 3:25310001-25310023 CCTGTTAGCAGCATGGTAGTATT 0: 1
1: 0
2: 0
3: 7
4: 69
Right 951682592 3:25310031-25310053 CTGGCTCCTTATGGTTGAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 137
951682588_951682594 25 Left 951682588 3:25310001-25310023 CCTGTTAGCAGCATGGTAGTATT 0: 1
1: 0
2: 0
3: 7
4: 69
Right 951682594 3:25310049-25310071 GCAGGCCATGTGATGAAGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 150
951682588_951682590 -2 Left 951682588 3:25310001-25310023 CCTGTTAGCAGCATGGTAGTATT 0: 1
1: 0
2: 0
3: 7
4: 69
Right 951682590 3:25310022-25310044 TTGTCCTTGCTGGCTCCTTATGG 0: 1
1: 0
2: 2
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951682588 Original CRISPR AATACTACCATGCTGCTAAC AGG (reversed) Intronic
909524976 1:76612726-76612748 AAAACTAGCATGCTGTTAATAGG - Intronic
910004952 1:82385204-82385226 AATACTAAAATTCTGCTTACTGG + Intergenic
910065148 1:83143198-83143220 AATACAAGGATCCTGCTAACCGG + Intergenic
911221391 1:95251245-95251267 AATACAACTATGCTGATCACTGG + Intergenic
916077023 1:161207161-161207183 AATCCTACCATCCTGTTATCAGG - Intronic
919253939 1:195096949-195096971 AATACTACCCTGCTGAGACCTGG + Intergenic
920708149 1:208269948-208269970 AAAACTACCAGGCTGCTCTCTGG + Intergenic
922360983 1:224821179-224821201 ATTACAACCATGCACCTAACAGG - Intergenic
923922612 1:238585154-238585176 AAAAATATCATGCTGCTAACAGG - Intergenic
1066324857 10:34348163-34348185 AATTCTCCCATGCTGCTAATTGG - Intronic
1078061626 11:8049533-8049555 AATACCACCATGGTTCTAAAAGG - Intronic
1080121481 11:28682959-28682981 AATAGTACCAGCCTGATAACTGG + Intergenic
1081063468 11:38508579-38508601 AATATAACCAAGCTGCTAATTGG - Intergenic
1083445705 11:62706795-62706817 AATGCTACCACGCTGGGAACAGG - Intronic
1087107093 11:94421587-94421609 AATACTAACATGTTGCTTCCAGG - Intronic
1093439260 12:19174189-19174211 AATAGTACCATGCCCCTTACAGG - Intronic
1096302856 12:50447153-50447175 AGTACTAACATGCTGCTCAGTGG + Intronic
1114744730 14:25135223-25135245 AATTCTACAATGCAGCTACCAGG + Intergenic
1120412324 14:84173398-84173420 AATATTACCATTATGCTTACAGG + Intergenic
1123190931 14:106569240-106569262 AATACTACCAAGCCGTTAAAGGG - Intergenic
1123486917 15:20749094-20749116 AATACTAATATGCTGTTGACGGG + Intergenic
1123543404 15:21318150-21318172 AATACTAATATGCTGCTGACGGG + Intergenic
1124243019 15:28046721-28046743 ACTACCACCATGCTGCCAAGTGG + Intronic
1130106153 15:80930036-80930058 GGGACTACCATGCTGCTCACAGG - Intronic
1202951724 15_KI270727v1_random:45277-45299 AATACTAATATGCTGTTGACGGG + Intergenic
1133943526 16:10329740-10329762 AACACTACCATCCTGCTACCCGG + Intronic
1138064810 16:53929619-53929641 AATACTACCATTCTGACAAACGG - Intronic
1138956681 16:61979436-61979458 AATTCTACCATCTTGCAAACAGG + Intronic
1153793451 18:8600862-8600884 AAAACTACCATGCTGGGCACAGG - Intergenic
1157521419 18:48348000-48348022 ATTGCTACCATGCTGCTCCCTGG - Intronic
927093983 2:19733898-19733920 GTTACTTCCATGCTGCTTACCGG + Intergenic
932529857 2:72517594-72517616 AATACTACTATGCTGTGAAATGG - Intronic
937369367 2:121286755-121286777 AATATTCCCATTCTCCTAACAGG - Intergenic
938757595 2:134395084-134395106 TATACTACCATGCAGAAAACAGG - Intronic
940222421 2:151366252-151366274 AACAGTTCCATGCTGCTAAGAGG + Intronic
1168945293 20:1749596-1749618 AATACTTACATGCTGCTAATGGG + Intergenic
1170159896 20:13300186-13300208 AATGCTATCATTCTGCTAAACGG + Exonic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1181010314 22:20036493-20036515 AAGACTACCATGGTGCTGATGGG + Intronic
1181951861 22:26559813-26559835 AATAGAACCATGCTGTTAAGTGG - Intronic
951682588 3:25310001-25310023 AATACTACCATGCTGCTAACAGG - Intronic
954607658 3:51926259-51926281 AATACAACCATGCTGGAAAATGG + Intergenic
960571272 3:119187606-119187628 ACTACTTCCATCCTACTAACTGG - Intronic
967512645 3:190329849-190329871 AATACTAACATCCTTCTAACTGG - Intronic
971791868 4:31180196-31180218 AATACCACTCTCCTGCTAACAGG - Intergenic
974911510 4:68127327-68127349 AATACTGACATGCTGCTACAGGG - Intronic
979711391 4:123783956-123783978 AATAATCAAATGCTGCTAACTGG + Intergenic
981974772 4:150712768-150712790 AATACTACCAAGCTACAAAACGG + Intronic
984230493 4:177092212-177092234 AAGACAAACATGCTGCTACCAGG + Intergenic
986268143 5:6208152-6208174 AATACTATCATGCTGCAGGCAGG - Intergenic
986798735 5:11238155-11238177 AGTTAGACCATGCTGCTAACAGG + Intronic
988343780 5:30011271-30011293 AAGAGCACCTTGCTGCTAACAGG - Intergenic
994540724 5:101092844-101092866 AGTACTACTAGGCTACTAACAGG + Intergenic
1000395301 5:160768664-160768686 AAAACTACGATGCTGTTAATTGG - Intronic
1011575631 6:88795233-88795255 AATACTACCATCAGACTAACAGG + Intronic
1014583986 6:123175794-123175816 AAAACTAGCATCCTGCTAAGTGG - Intergenic
1015106860 6:129547012-129547034 AATATCACCATGCTAATAACTGG + Intergenic
1016886194 6:148961942-148961964 AATACCACCATGCTACCATCAGG - Intronic
1020987959 7:15159670-15159692 AATACTAACAGGCTGCAAATGGG + Intergenic
1022066172 7:26860042-26860064 AATACTTTAATGCTGGTAACAGG + Intronic
1024117621 7:46208751-46208773 AAAACTACCATGCTGCTCCTTGG + Intergenic
1026812771 7:73482674-73482696 CATACTACTATGCTTCTAAGTGG - Intronic
1027278959 7:76591550-76591572 AATACAAGGATCCTGCTAACGGG - Intergenic
1030974979 7:116110515-116110537 AATATTTCCATGCTGTTAAATGG + Intronic
1047352815 8:124092063-124092085 GATACAACCATGCTGCTTGCTGG + Intronic
1047922435 8:129649251-129649273 GAAACTATCATGCTGCTAATTGG + Intergenic
1047994684 8:130323140-130323162 AATACTACCATGCCATCAACAGG - Intronic
1049055105 8:140230259-140230281 AATAATATCCTTCTGCTAACAGG - Intronic
1051835536 9:21333831-21333853 AGCAATACCATGCTGGTAACGGG + Exonic
1053729943 9:41043599-41043621 ATTACTACCATGGTGATAAAGGG + Intergenic
1054698558 9:68388468-68388490 ATTACTACCATGGTGATAAAGGG - Intronic
1059880215 9:118679917-118679939 GATACTAGCATGCTTCTATCTGG - Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1188756286 X:33968457-33968479 GCTACTACCATGATGCTGACTGG + Intergenic
1197900993 X:131371771-131371793 AATACTAGCAACCTGCTAAATGG + Intronic
1198708463 X:139475674-139475696 AATTAGACCATGCTGCTAAAGGG - Intergenic
1199172198 X:144745013-144745035 AATAATACAAAGCTGGTAACAGG + Intergenic