ID: 951682760

View in Genome Browser
Species Human (GRCh38)
Location 3:25311607-25311629
Sequence GCAGCTGAGGGCTTCCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951682751_951682760 20 Left 951682751 3:25311564-25311586 CCCTATTGGTGGCAGATAGTGCC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 171
951682752_951682760 19 Left 951682752 3:25311565-25311587 CCTATTGGTGGCAGATAGTGCCA 0: 1
1: 0
2: 1
3: 6
4: 85
Right 951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 171
951682750_951682760 29 Left 951682750 3:25311555-25311577 CCAAACATTCCCTATTGGTGGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 171
951682749_951682760 30 Left 951682749 3:25311554-25311576 CCCAAACATTCCCTATTGGTGGC 0: 1
1: 0
2: 1
3: 9
4: 103
Right 951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 171
951682756_951682760 -1 Left 951682756 3:25311585-25311607 CCAGGTCAGTATTCACAGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951682760 Original CRISPR GCAGCTGAGGGCTTCCTCAA AGG Intronic
900114745 1:1023696-1023718 GTAGCTGAGGACTTGCTCTAGGG + Intronic
900777245 1:4594400-4594422 CCAGCTGGGGGCTGCCTCAGGGG - Intergenic
900915328 1:5634600-5634622 GCAGGTGAGCGGGTCCTCAAGGG - Intergenic
901879372 1:12185017-12185039 GCTGCTGGGCGCTTCCCCAAGGG - Intronic
902631108 1:17705283-17705305 GCTTTTGAGGGCTTCCTTAAGGG + Intergenic
904407219 1:30300192-30300214 GCAGCTGAGGGCTTTAGGAAGGG + Intergenic
905614468 1:39385488-39385510 GCAGCTCAGGGCATCCTAACAGG + Exonic
906012508 1:42542307-42542329 GCTGCTGAGGGTTTCTGCAAAGG - Intronic
911880989 1:103237689-103237711 GCAGCTGAGGGCCTCACCAGAGG - Intergenic
912985020 1:114418918-114418940 GCAGCTTAGGGGTTTTTCAAAGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
915683017 1:157600692-157600714 ACAGGTGAGGGCTTCCTATATGG - Intergenic
919101858 1:193105523-193105545 GCAGCTGAGCGCGTCCTCCCAGG + Exonic
921551309 1:216538543-216538565 GCAGCTGAGTAATTCCTCCAGGG + Intronic
922729278 1:227941583-227941605 GCAGCTGGGGCCGACCTCAAGGG + Intronic
924785843 1:247198544-247198566 GGATCTGATGGCTTTCTCAAGGG + Intergenic
1063499205 10:6537919-6537941 GCAGTTTAGCGCTTCCTCACCGG + Intronic
1067891961 10:50144945-50144967 GCACCTGAGGGGCTCCTCAGAGG - Intergenic
1067960827 10:50847113-50847135 CTAGCTGATGTCTTCCTCAAGGG + Intronic
1071113525 10:82190680-82190702 GCAGCTGAAAGCTTCCTCACTGG - Intronic
1072803931 10:98412331-98412353 GCAGCTGAAGTCCTCTTCAAGGG - Intronic
1073203979 10:101758869-101758891 CCTGCTGAGGGCTTCCTCTGAGG + Intergenic
1074973816 10:118565053-118565075 GCAGCTAAGACCTTCCTCAAAGG + Intergenic
1075027823 10:118999644-118999666 GTAGCTGAGCTCTTTCTCAAGGG - Intergenic
1075876025 10:125806390-125806412 ACAGCTGAGAGTTTCCTCTAAGG - Intronic
1076726374 10:132416074-132416096 GCAGCCCAGGGCTTCCACGAGGG + Intronic
1076915685 10:133422221-133422243 GCAGCTGACGGCCTGCTCAGTGG - Exonic
1077225351 11:1437018-1437040 GCTGCTGAGGGCTGCCTGGATGG + Intronic
1078640563 11:13091815-13091837 GCAGCTGTGGGCTTCACCTAGGG - Intergenic
1078665352 11:13320369-13320391 GAAGCTGAGGGCACCCTCAAAGG - Intronic
1081494158 11:43589846-43589868 GCAGCTGATAACTTGCTCAAGGG - Intronic
1084229186 11:67738519-67738541 ACAGCTCTCGGCTTCCTCAAAGG - Intergenic
1084332359 11:68437680-68437702 GGAGAAGGGGGCTTCCTCAAGGG + Intronic
1084510892 11:69603021-69603043 GCAGCTGAAGGCTTCCTCCTAGG + Intergenic
1084688277 11:70710141-70710163 GCTGCTGAGCGCCTCCTCAGTGG + Intronic
1085616110 11:78000211-78000233 GCAGCTCAGTGCTTGCTCGATGG - Intergenic
1085735725 11:79037255-79037277 GTAGTTGAGGGCTGCCTCATAGG - Intronic
1090275716 11:125417891-125417913 GGAGCTGAGGGCTCACTCCAGGG + Intronic
1091352790 11:134911050-134911072 GCAGCATAATGCTTCCTCAAAGG + Intergenic
1092012571 12:5127060-5127082 GCAGCTGGGCCCTTCCTGAAGGG + Intergenic
1095599875 12:44002296-44002318 GAAGCTGAGGGCCTCCCTAATGG + Intronic
1096584854 12:52613474-52613496 TCAGCTGAGTGCATCCTCCAGGG + Intronic
1096880335 12:54662724-54662746 CCAGCTCAGGACTTCCTAAAAGG + Intergenic
1099508331 12:83505464-83505486 GTAGTTGGGGCCTTCCTCAAGGG - Intergenic
1100090184 12:90958586-90958608 AGAACTGTGGGCTTCCTCAACGG + Intergenic
1100531354 12:95464597-95464619 TCAGCTGAGGAATTTCTCAAGGG - Intergenic
1101753994 12:107607003-107607025 GCAGCTGTGGGCTTCATCCAAGG - Intronic
1102448986 12:113026454-113026476 GCAGAAGAGGGCTACCTCACAGG + Intergenic
1102634022 12:114307034-114307056 GCAGCTGGGGGCCTCATCAGTGG - Intergenic
1102681657 12:114694677-114694699 GCAGCTGAGGGGTTCATCCTGGG - Intergenic
1102816175 12:115868264-115868286 GCAGAAGAGGGCTACCTCACAGG - Intergenic
1103231461 12:119334634-119334656 GCCGAGGAGGGCTTCCTCATTGG - Intergenic
1107538623 13:41362778-41362800 GCTGCTGAGGACTGCCTCAGGGG - Intronic
1108082068 13:46747065-46747087 GCACCTCTGGGCTTCCTCAGGGG + Intronic
1111882862 13:93980427-93980449 ACAGCTTAGGACTTCCTAAAAGG + Intronic
1112330772 13:98475600-98475622 GGGGCTGCGGGCTTCCTCATTGG - Intronic
1116226978 14:42165180-42165202 GTAGCAGAGGCCTTCCTCTAGGG + Intergenic
1118316345 14:64728408-64728430 GGGGCAGAGGGCTTCCTCAGTGG - Intronic
1124118650 15:26869413-26869435 GCAGGCGAGGACTTGCTCAATGG - Intronic
1128127751 15:65205400-65205422 GCAGCTGAGCACTTGCTCCAGGG + Exonic
1128943817 15:71808621-71808643 GAAGCTGAGGCCATCCTCCATGG - Intronic
1135206074 16:20484890-20484912 GCAGCTGAGATCCTCCTCCAGGG - Intronic
1138816289 16:60206595-60206617 ACAGCAGAGGCCTTCCTCTAAGG - Intergenic
1140641116 16:76974568-76974590 GGAGTTCAGGGCTTCCTGAATGG - Intergenic
1146628936 17:34456151-34456173 GCAGCTTAGGCCTTCCAGAAGGG - Intergenic
1147705347 17:42421955-42421977 GCGGGTGAGGGTGTCCTCAAGGG + Intronic
1148805312 17:50260926-50260948 AAAACTGAGGGCTTCCTCGAGGG - Intergenic
1149081809 17:52666800-52666822 AGAGGTGAGTGCTTCCTCAAAGG + Intergenic
1149422042 17:56520628-56520650 CCAGCTGAGGGCTTCCTCACGGG + Intergenic
1150490715 17:65572742-65572764 ACAGCTGAGGGTGTCCCCAAGGG - Intronic
1150621622 17:66812124-66812146 GAAGCAGAGGGCATGCTCAATGG - Intergenic
1151745146 17:76007940-76007962 GCAGCGGAGGGCGGCCTCGATGG + Exonic
1152756287 17:82088425-82088447 GCCGCCGAGGACTTCCCCAACGG - Exonic
1153756438 18:8288291-8288313 GCAGCTGAGAGCTTCATCATTGG + Intronic
1156401631 18:36745092-36745114 GCTGCTGAGGCCTGCTTCAAGGG + Intronic
1159312358 18:66725826-66725848 GTAGCTGAGGCCCTCCTCCAGGG + Intergenic
1160919124 19:1511771-1511793 GCAGCTGAGGGCCTCTTCTAGGG - Intronic
1162027056 19:7900378-7900400 GAAGCTGAGGATTTCCTCGATGG - Exonic
1162248484 19:9423063-9423085 GCACCTCAGTGCTTGCTCAATGG + Intronic
1162762535 19:12897152-12897174 GCAGCTGTGGGCTGAGTCAACGG + Intronic
1163731745 19:18953614-18953636 GTAGCTGAGGGGTTCCTGCAGGG + Intergenic
1166001071 19:39877791-39877813 CCACCTGAGAGCTTCTTCAAGGG - Exonic
1166003852 19:39894050-39894072 CCACCTGAGAGCTTCTTCAAGGG - Exonic
1168291403 19:55359414-55359436 GCAGCTGAGGCCTTCCGGGATGG + Exonic
1168315697 19:55483879-55483901 GCAGCTGAGGAGTTGCTCACTGG + Exonic
926610257 2:14939695-14939717 ACTGCTGAAGGATTCCTCAATGG + Intergenic
927862677 2:26569937-26569959 GGAGCTCAGGGCATGCTCAAAGG + Intronic
929420458 2:41784734-41784756 GCCTCTGAGTGCTTCCTCATTGG - Intergenic
933690311 2:85174672-85174694 GCACCTGAGAGCCTCCTCATGGG + Intronic
939864808 2:147460837-147460859 ACAGCTGAGGGCTTTTTAAAAGG + Intergenic
944444944 2:199779895-199779917 ACAACTGAGGGCTTCTTCCAGGG + Intronic
944669691 2:201984655-201984677 CCAGCTGAGGGCCTCATCAAAGG - Intergenic
945037995 2:205720739-205720761 ACTCCTGAGGGCCTCCTCAATGG - Intronic
947517996 2:230823731-230823753 GCAGCTGAGGGCTGCTTCTGGGG - Intergenic
947566524 2:231197807-231197829 CCATCTTAGGGCTTCTTCAAAGG + Intergenic
1168986467 20:2053201-2053223 GCGGCTTAGGACTTCCTCCAAGG - Intergenic
1171106259 20:22435658-22435680 GCAGCTGAGGCTTCCCTGAAGGG - Intergenic
1171424043 20:25038639-25038661 GCAGGTGAGGGCTTCCTGCAAGG - Intronic
1172194670 20:33083732-33083754 GCAGCTGATGGCATCCTCGCAGG + Exonic
1174056212 20:47800224-47800246 GGAGCTGAGGGCTTCCTGCTGGG + Intergenic
1174181202 20:48676174-48676196 TCAGGTGAGGGCCTCCTCAGGGG - Exonic
1175573979 20:60046630-60046652 GCAGCTTGGGGCTCCCACAATGG + Intergenic
1175732883 20:61366053-61366075 GCAGCTCATGGCTTCCCCAGTGG + Intronic
1176231708 20:64036331-64036353 GCAGCTGTGGGCCTCCTCTAGGG + Intronic
1176985482 21:15431248-15431270 GTAGCTGAGGTCAACCTCAAGGG + Intergenic
1178306869 21:31498457-31498479 GCAACTGTGGGTTTCCTTAAGGG - Intronic
1178671707 21:34596505-34596527 TCAGCTGAGGGCCTTCTCGAAGG + Intronic
1179588198 21:42387344-42387366 ACAGCTGAGAGCTTCCCCATTGG - Intronic
1182044301 22:27262413-27262435 CCAGCTGCGGGCTTCCAGAAAGG - Intergenic
1183061102 22:35336809-35336831 GGAGGTGCGGGCTTCCTCCAGGG + Intronic
1183573997 22:38675390-38675412 GGAGCTGGGGGCGGCCTCAAAGG + Intergenic
1183965006 22:41436371-41436393 GTAGCTGAGGCCTTCCACAAAGG + Exonic
1184151738 22:42643564-42643586 GCAGCTGAGGCCTCGCTCCATGG + Intronic
950108724 3:10404946-10404968 CCTGCTGTGTGCTTCCTCAATGG + Intronic
950428274 3:12936278-12936300 GCAGTTGAGGGCATCGTCGATGG + Exonic
950443345 3:13022503-13022525 GCAGCTGAGCTTTTCCTCACCGG - Intronic
951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG + Intronic
952039583 3:29246142-29246164 CCAGCTAAGCTCTTCCTCAATGG - Intergenic
952958777 3:38576867-38576889 GGAGCTTAGGGCTCCCTGAAGGG + Intronic
960086287 3:113594980-113595002 GTTGCTGAGGGCTTCTTAAAAGG - Intronic
964163295 3:153671584-153671606 GCAGCAGAGGGTGTCCTGAAGGG - Intergenic
968551182 4:1224034-1224056 GCAGCCGTGGGCTTCCTCCGTGG - Intronic
968801471 4:2745974-2745996 GCAGCTGGGGGCCCCCTCACTGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
972142282 4:35975776-35975798 GCAGCTGAGAGCTGTCTGAAGGG - Intronic
976528364 4:86119750-86119772 TCAGCTGAGGTCATCCTCAAAGG - Intronic
980106997 4:128597674-128597696 GCAGCTGGGATCTTCTTCAAGGG + Intergenic
984003760 4:174283827-174283849 TCCGCTGAGAGCCTCCTCAATGG - Exonic
985702310 5:1380926-1380948 GAAGCAGAGGGCTGCCTCATGGG + Intergenic
985940150 5:3128844-3128866 ACAGCTGAGGTTTTACTCAATGG - Intergenic
987092939 5:14523502-14523524 AAATCTGAGGGCTTCATCAAGGG - Intronic
987866552 5:23547545-23547567 CCAGCTGATGGCTTCATCATAGG - Intergenic
992423279 5:76628097-76628119 GTAGCTGAGTTTTTCCTCAAGGG - Intronic
992473838 5:77083246-77083268 GCAGCAGTGGGCTTCCCCATGGG - Intronic
994251593 5:97542338-97542360 GGAGCTGAAGGGCTCCTCAAGGG + Intergenic
995164081 5:109016997-109017019 TCTGCTGAGGGCTTTCTCACTGG - Intronic
995705103 5:114980458-114980480 TCAGCTCAGGGCTCACTCAAGGG + Intergenic
997434499 5:133864726-133864748 GGGGCTGAGGCCTTCCTCAAAGG + Intergenic
1003276231 6:4655649-4655671 GCAGCTGAGGGCAGCCCGAAGGG + Intergenic
1003307672 6:4944466-4944488 ACAGCTGAGGGCATCCCTAAAGG + Intronic
1003340219 6:5213484-5213506 GTGGCTGTGGGCTTCCTCACTGG + Intronic
1005256376 6:24007694-24007716 GGAGATGAGGGATTCCTCAGGGG - Intergenic
1007052084 6:38841935-38841957 GCAGATCAGGGCTTAGTCAAGGG + Intronic
1007211199 6:40194597-40194619 TCAGCTGAGGCAATCCTCAAGGG + Intergenic
1007942666 6:45797234-45797256 GCAGCTCAGGGCAGCCTCACAGG + Intergenic
1009838825 6:69040560-69040582 GAAGCCGAGGGAGTCCTCAATGG + Intronic
1010099854 6:72091174-72091196 GCAGGTGAGGGCTTTCTCTGAGG - Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1013010485 6:106115703-106115725 GCGGCTGAGGTTTTCCTCAAAGG + Intergenic
1013468274 6:110436776-110436798 GCAGCTGATACATTCCTCAATGG + Intronic
1013605864 6:111747306-111747328 GCAGATGAGGTCTTGCTGAAAGG + Intronic
1014990076 6:128063987-128064009 GCAGACGTGGGCCTCCTCAAAGG - Intronic
1018383442 6:163281312-163281334 GGAGCCAAGGGCTTCTTCAATGG - Intronic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1018818762 6:167356383-167356405 ACAGCTGAGGGTTTCTTCCAAGG + Intronic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1021663290 7:22944187-22944209 GCTCCTTAGGTCTTCCTCAACGG + Exonic
1022143014 7:27509512-27509534 GAAGCAGAGGGCTTACTCATGGG - Intergenic
1024095506 7:45979486-45979508 GCATCTGTGGTCCTCCTCAAGGG + Intergenic
1026788361 7:73316244-73316266 GCAGCTTAGTGCTTCATAAATGG - Intronic
1028387425 7:90272946-90272968 GCAGCTGAAGGCAGCCTCACAGG + Intronic
1032101880 7:128986728-128986750 GCTGCTGTGGGCTTGCTAAAAGG - Exonic
1033457707 7:141517612-141517634 GGAGCTGGGAGCTTCCTCTAAGG - Intergenic
1035787013 8:2269642-2269664 GCAGCTAAGTGCTTCCTCTATGG + Intergenic
1035787113 8:2270166-2270188 ACAGCTAAGTGCTTCCTCTATGG + Intergenic
1035805694 8:2451550-2451572 ACAGCTAAGTGCTTCCTCTATGG - Intergenic
1035805794 8:2452074-2452096 GCAGCTAAGTGCTTCCTCTATGG - Intergenic
1036831855 8:12026800-12026822 ACAGCTCTGGACTTCCTCAAAGG - Intergenic
1036904776 8:12699051-12699073 ACAGCTCTGGGCTTCCTCAAAGG - Intergenic
1037516029 8:19633071-19633093 CCAGCTGAGGGCTTTTTAAAAGG + Intronic
1042507224 8:69573474-69573496 GCAGCTGAGGCCATCATCCAAGG - Intronic
1045072170 8:98519364-98519386 GTTGCTGAGGGCTTACTAAAGGG + Intronic
1047559768 8:125973795-125973817 GCTGCTGAGGCCGTCCTCACTGG - Intergenic
1049596138 8:143484206-143484228 ACATCTGAGGACTTCCTCACTGG + Intronic
1049851009 8:144830167-144830189 GCAGCAGAGGGCTTAGTCACAGG - Intronic
1051239171 9:15033922-15033944 CCAGCTGAGCCCTTCCTAAATGG + Intergenic
1053202664 9:36163438-36163460 GAGGCTGAGGGCTTCCTCTGGGG - Exonic
1055925555 9:81507276-81507298 GCGGCTGAAGGGGTCCTCAAGGG - Intergenic
1056115098 9:83434028-83434050 GCAGCAGAGGGCTTCCTGTCTGG + Intronic
1057172284 9:92970029-92970051 GCGGCTCAGGGCTTCTTAAAGGG + Intronic
1057342271 9:94213614-94213636 GCGGCTGATAGCTTCCTCATTGG + Intergenic
1059465986 9:114469212-114469234 GCAGGTGTGGCCTTCCTCAGGGG + Intronic
1059898823 9:118899311-118899333 CCAGCTGAGGGCTTACTTACTGG + Intergenic
1062583422 9:137238084-137238106 GCAGGTGAGGCCTCCCACAAAGG + Intergenic
1187647829 X:21368411-21368433 TCTTCTGTGGGCTTCCTCAATGG + Intergenic
1188388562 X:29591671-29591693 ACAGCAGAGGGCTTCCCCCAAGG - Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1190084415 X:47382964-47382986 GCAGCTGTGGGATCCCTGAAGGG - Intronic
1190735193 X:53251133-53251155 GCAGTTCAGGGCTTCGTCGATGG + Exonic
1194410832 X:93555635-93555657 GCAGCAGAGGCCTTCCCCACTGG + Intergenic
1196501142 X:116383968-116383990 GCAGGTGACTGCTTCCTTAATGG + Intergenic