ID: 951684155

View in Genome Browser
Species Human (GRCh38)
Location 3:25325762-25325784
Sequence CCAGTAGGGTACCTTCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951684151_951684155 -5 Left 951684151 3:25325744-25325766 CCACTTGTGGAAGCAGGACCAGT 0: 1
1: 0
2: 2
3: 10
4: 124
Right 951684155 3:25325762-25325784 CCAGTAGGGTACCTTCAGTTTGG 0: 1
1: 0
2: 1
3: 5
4: 56
951684146_951684155 15 Left 951684146 3:25325724-25325746 CCCTTTTTTCCTGGTCATGGCCA 0: 1
1: 0
2: 5
3: 20
4: 280
Right 951684155 3:25325762-25325784 CCAGTAGGGTACCTTCAGTTTGG 0: 1
1: 0
2: 1
3: 5
4: 56
951684149_951684155 6 Left 951684149 3:25325733-25325755 CCTGGTCATGGCCACTTGTGGAA 0: 1
1: 0
2: 3
3: 12
4: 83
Right 951684155 3:25325762-25325784 CCAGTAGGGTACCTTCAGTTTGG 0: 1
1: 0
2: 1
3: 5
4: 56
951684147_951684155 14 Left 951684147 3:25325725-25325747 CCTTTTTTCCTGGTCATGGCCAC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 951684155 3:25325762-25325784 CCAGTAGGGTACCTTCAGTTTGG 0: 1
1: 0
2: 1
3: 5
4: 56
951684143_951684155 29 Left 951684143 3:25325710-25325732 CCACTGGTTCTTCTCCCTTTTTT 0: 1
1: 0
2: 6
3: 97
4: 923
Right 951684155 3:25325762-25325784 CCAGTAGGGTACCTTCAGTTTGG 0: 1
1: 0
2: 1
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951684155 Original CRISPR CCAGTAGGGTACCTTCAGTT TGG Intronic
901643612 1:10705285-10705307 CCAGTAGGATCCCCTCGGTTTGG - Intronic
902671533 1:17977801-17977823 CCAGGAGGCCACCTTCAGGTTGG + Intergenic
908082552 1:60596937-60596959 CCAGTAGGGTACCTGGGGGTAGG - Intergenic
914263250 1:146017258-146017280 ACAGTATGGTACATTCAGATGGG - Intergenic
915812015 1:158923169-158923191 CCAGTAGGCTTTCTCCAGTTGGG - Intergenic
918072832 1:181145949-181145971 CCAGTGGAGTCCCTTCAGCTTGG + Intergenic
1069577846 10:69543607-69543629 CCAGTAGGGCAGCTGCAGCTTGG - Intergenic
1080821910 11:35815435-35815457 TCAGTAGGGTAGTTTCAGGTGGG + Exonic
1083243623 11:61408635-61408657 CCAGAAGTTTTCCTTCAGTTGGG + Intronic
1085302066 11:75464527-75464549 CCAGGTGGGTCACTTCAGTTGGG + Intronic
1088461840 11:110091550-110091572 CCAGTAGGATACTCTCAGCTGGG + Intergenic
1097168803 12:57100502-57100524 CCAGCAGGTTACCTTCCTTTGGG - Intronic
1100841210 12:98613176-98613198 CCTGAGGGGTCCCTTCAGTTAGG + Intergenic
1113251973 13:108463227-108463249 CTAGTAGGGAACTTTCACTTTGG + Intergenic
1114278750 14:21170462-21170484 CCAGCAGGGAACCCTCAGGTTGG + Intergenic
1120840896 14:89084006-89084028 CCATTAGCCTCCCTTCAGTTTGG + Intergenic
1126146936 15:45483493-45483515 CAATTAGGTTGCCTTCAGTTTGG + Exonic
1131604291 15:93884637-93884659 CCAGTAGGGCAGCTTCTGTTTGG - Intergenic
1139573853 16:67829295-67829317 CCAGCAGGGCAGCTTCAGCTGGG - Intronic
1151546628 17:74797283-74797305 CCTGAAGGGTTCCTTCTGTTCGG - Intronic
1151935122 17:77256716-77256738 CCAGGAGGGTAGGTTCAGGTGGG + Intergenic
1155438682 18:25839036-25839058 ACAGTTGGGTTCATTCAGTTGGG + Intergenic
1156717567 18:40029420-40029442 CCAGTAGGGGACCTTCATAAAGG + Intergenic
1161552176 19:4919684-4919706 ACAGTAGGAGACCTTGAGTTAGG + Intronic
1163244321 19:16083504-16083526 CCAGTAGGGTGCCTTCTCCTCGG + Intronic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
928238102 2:29562893-29562915 TAAGTAGGGTACCTTCTATTTGG + Intronic
936541669 2:113356711-113356733 CCTGTAGGGTCCCTTCAGCAAGG + Intergenic
941348820 2:164405897-164405919 CCAATAGGGGACCTTCAATAAGG + Intergenic
1170733078 20:18990659-18990681 CCAGTAGGATCCCTTTAGTAGGG - Intergenic
1178613994 21:34114197-34114219 CAAGTAGGGTACCTTCATTTTGG + Intronic
1181640031 22:24191455-24191477 CCAGCAGGGGACCTGCAGCTGGG - Intergenic
1182533132 22:30977660-30977682 CAAGCAGGGTACCTTCAGAAAGG - Intergenic
950554477 3:13686833-13686855 CCAGAAGGAAACCCTCAGTTGGG + Intergenic
951684155 3:25325762-25325784 CCAGTAGGGTACCTTCAGTTTGG + Intronic
952981689 3:38741192-38741214 CCAGTAGGTCACCTCCAGCTTGG + Intronic
958645161 3:96861006-96861028 CCAGGAGGGAACCTGTAGTTTGG + Intronic
964754150 3:160079180-160079202 CCAGTTGGGTAACTCCAGATGGG - Intergenic
976817077 4:89161434-89161456 GCAGAAGGGTACTTTCAGTGGGG - Intergenic
980089385 4:128426339-128426361 CCAGTAGGTTTCATTCAGCTGGG + Intergenic
985776464 5:1846629-1846651 CCAGCAGGCTACCTTCATGTTGG + Intergenic
990544146 5:56805543-56805565 CCAAAAGGGGACCTTCAGATGGG + Intergenic
992015277 5:72568747-72568769 TCAATAGTGTACATTCAGTTTGG - Intergenic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1007909461 6:45499030-45499052 ACAGTAGGGTACCATCAGTGTGG + Intronic
1017982640 6:159414804-159414826 CCAACAGGGTAACTTCTGTTTGG + Intergenic
1023622749 7:42089432-42089454 CCAGTAGGTTGCCATCAATTTGG - Intronic
1023981986 7:45075737-45075759 CCAGCATGGCACCTCCAGTTCGG - Intronic
1028052104 7:86201679-86201701 CCTCTAGAGTACTTTCAGTTAGG + Intergenic
1031486960 7:122338625-122338647 CCATTAGGGTATTTTCACTTTGG - Intronic
1032283933 7:130527072-130527094 CCAGTAGAGTAGCTTCAGGTAGG + Intronic
1040358839 8:46645539-46645561 GCAGGAGGGTAACATCAGTTAGG - Intergenic
1040378743 8:46851679-46851701 GCAGTAGGGTAACATCACTTAGG - Intergenic
1044862885 8:96540524-96540546 TCTGTATGGTAACTTCAGTTGGG + Intronic
1052831039 9:33216041-33216063 GCAGAAGGGTCCCTTGAGTTTGG - Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1055861389 9:80753749-80753771 CAATTAGGGTTCCTTCAGCTTGG + Intergenic
1057127742 9:92632593-92632615 CCAGTTGGGTACGTTGATTTAGG - Intronic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1195447744 X:104973033-104973055 CCAGTAGGGACCTTTCAGTTAGG + Intronic