ID: 951684261

View in Genome Browser
Species Human (GRCh38)
Location 3:25326652-25326674
Sequence AGGTGCCAACAGATCCACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951684261_951684263 -5 Left 951684261 3:25326652-25326674 CCCTAGTGGATCTGTTGGCACCT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 951684263 3:25326670-25326692 CACCTTTTGTTGTCAATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 99
951684261_951684267 15 Left 951684261 3:25326652-25326674 CCCTAGTGGATCTGTTGGCACCT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 951684267 3:25326690-25326712 TGGAATCTCTCCTGAAACATTGG 0: 1
1: 0
2: 2
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951684261 Original CRISPR AGGTGCCAACAGATCCACTA GGG (reversed) Intronic
904437585 1:30508623-30508645 AGGTGACACCAGAGCCACCAGGG - Intergenic
908980067 1:69945266-69945288 AGGTGTCAACAGCACCACAATGG - Intronic
909407444 1:75307309-75307331 AGGTGCCAACAGAACCACAGAGG - Intronic
911097924 1:94070539-94070561 ATGTGACTACAGCTCCACTAAGG + Intronic
911482718 1:98464491-98464513 ACCTGGAAACAGATCCACTAGGG + Intergenic
916794858 1:168156601-168156623 AGGTGCCAAAACATACACTGGGG - Intergenic
918177114 1:182056512-182056534 CGGCACCAACAGATCCACTCCGG - Exonic
921161720 1:212477439-212477461 AGATGCCAAGAGACCCACAAAGG - Intergenic
923456479 1:234169601-234169623 TGGGGCCCACAGCTCCACTACGG + Intronic
1068246686 10:54380754-54380776 AGCTGCGAGCAGATACACTAAGG + Intronic
1070603195 10:77879864-77879886 AGGTGCCTACAGACACACAAGGG + Intronic
1071203903 10:83252482-83252504 CCGTTCCCACAGATCCACTAGGG + Intergenic
1073053084 10:100681699-100681721 AGGAGCCATCAGCTCCTCTAGGG + Intergenic
1075591279 10:123693383-123693405 AGGTGCAAAGAGGTCCACTTTGG - Exonic
1075805950 10:125188963-125188985 CAGTGCCAACAGAGCCACTGGGG - Intergenic
1077178251 11:1200259-1200281 AGGCGCCAACAGTCCCACCAGGG - Intronic
1081745755 11:45471305-45471327 AGGTGCCACCAGACACACTTAGG + Intergenic
1083157809 11:60836079-60836101 AGATGCCGTAAGATCCACTAAGG + Intergenic
1084614498 11:70226627-70226649 GGGTGACAACAGAGCCACAAAGG + Intergenic
1085276618 11:75304276-75304298 ATGTCACAACAGATCCACTATGG + Intronic
1088562632 11:111131224-111131246 AGGTGCCGACCGAGGCACTAAGG + Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1096473625 12:51895074-51895096 GGGTTCCACCAGATCCACCACGG - Intergenic
1097222779 12:57460651-57460673 GGGAGGCAACAGAGCCACTAGGG + Intronic
1100136020 12:91554333-91554355 AGGTGCCACCACATCCAGCATGG - Intergenic
1102885894 12:116521546-116521568 AGGTGCACACAGACCCACTTTGG + Intergenic
1103279847 12:119748204-119748226 AGGAGTCCACAGATCCACTTTGG + Intronic
1103961820 12:124613734-124613756 AGGGGCCCACAGACCCACAAAGG - Intergenic
1108664244 13:52613847-52613869 AGGTGCCAAGACATACACTGGGG + Intergenic
1109302908 13:60608022-60608044 AGGTGCCAACAGACCACCTGTGG + Intergenic
1111860910 13:93704681-93704703 ATGTGCCAACAGACTCACTTTGG - Intronic
1117447934 14:55822490-55822512 TGGTGCCAGCAGATCGATTAGGG + Intergenic
1117567754 14:57013103-57013125 AGGTGCCAGGAAATCCAATAGGG - Intergenic
1119529506 14:75349802-75349824 AGGAGATAACAGAGCCACTAGGG + Intergenic
1119785001 14:77306396-77306418 AGGTACCATCATATCCACTCAGG + Exonic
1122814072 14:104303736-104303758 AGTTGCCACCAGCTCCACTTGGG - Intergenic
1123871959 15:24584589-24584611 ATGTGCCATCAGAGCCACCAAGG + Intergenic
1128451978 15:67811112-67811134 ATGTTCCAACAGGTCCACTGGGG + Intergenic
1129665711 15:77578357-77578379 AGGAGCCAAGAGGACCACTAAGG - Intergenic
1130236876 15:82143727-82143749 AGGTGCTAGCAGACTCACTAAGG - Intronic
1131615625 15:94014467-94014489 AGATGCCAACAGATCGGCTTTGG + Intergenic
1132759879 16:1503488-1503510 TGGTGCAAACAGCTCCACTGCGG - Intronic
1133387889 16:5385414-5385436 ATGTCCCAAAAGATACACTAAGG - Intergenic
1140056111 16:71527154-71527176 TGGTGCCAACATATCAGCTATGG + Intronic
1141030788 16:80586552-80586574 AGGTGCTATCAGAACTACTATGG + Intergenic
1141837044 16:86548091-86548113 AGGTGCCACCAGAGCGACTGGGG - Intronic
1146289493 17:31597578-31597600 AGATGGCAACAGATTCACAATGG - Intergenic
1148806725 17:50267524-50267546 AGGTGCTAACAGGGCCACTGGGG + Intergenic
1149630332 17:58116654-58116676 ATGTGCCAGGAAATCCACTAAGG - Intergenic
1156384421 18:36592837-36592859 AGATGCTAACAGATTCACTGTGG - Intronic
1159264372 18:66061212-66061234 AACTGCCAACATTTCCACTAAGG + Intergenic
1162725851 19:12689411-12689433 ACGTGCCCACAGACCCACCAAGG - Exonic
1166419899 19:42628540-42628562 TGGTGCCAGCTGATCCACCAAGG - Intronic
927338839 2:21957125-21957147 AGATGCCCTCAGATCCACTTTGG + Intergenic
929965816 2:46535856-46535878 AGTGGCCAAAACATCCACTATGG + Intronic
948425894 2:237886411-237886433 AGGTGTCATCAGATCCTCTGGGG - Intronic
1174551520 20:51365985-51366007 AGTTGCCAACAGAGGCACTCTGG + Intergenic
1175575330 20:60056593-60056615 AGCTGCCCACAGAGCCACCATGG - Intronic
1178688983 21:34735154-34735176 AGGTGCCACCAGATGCCCAAAGG + Intergenic
1179839903 21:44065287-44065309 AGGAGCCAACAGACCCCGTATGG - Intronic
1182759354 22:32709417-32709439 AAGTTCCAACTGATCCACTTGGG - Intronic
1182881880 22:33740713-33740735 AGGTGCAAACCAAACCACTATGG + Intronic
951684261 3:25326652-25326674 AGGTGCCAACAGATCCACTAGGG - Intronic
954478314 3:50770838-50770860 AGATGCCAAGAAATACACTATGG + Intronic
955054949 3:55446760-55446782 AGGGGCCAGCAGATCAACCAGGG - Intergenic
973116047 4:46460766-46460788 AGGTGCCAACAAATACAATAGGG + Intronic
973929201 4:55772873-55772895 AGGAGACATCAGATCCAGTAAGG + Intergenic
978692026 4:111525161-111525183 AGATTCCAACTGAGCCACTACGG - Intergenic
985615746 5:919948-919970 AGAGGCCAAGACATCCACTAAGG - Intergenic
988563245 5:32299634-32299656 AGGTGCCCACAGGCTCACTAAGG + Intronic
989434169 5:41391703-41391725 AGGTGCCAGCAGAGCCACAGTGG + Intronic
992596084 5:78348634-78348656 AGGTGTGAACAGATCCACACTGG + Intergenic
992731419 5:79673557-79673579 AGGTGCCAAGACATACACTAGGG - Intronic
994115667 5:96059155-96059177 AGGTGGGAGCAGATCCACCAAGG - Intergenic
1007822786 6:44573212-44573234 AAGTGTGACCAGATCCACTATGG - Intergenic
1008573293 6:52835584-52835606 AGCTGCCAACAGTTCCATTCAGG + Intronic
1008575632 6:52857630-52857652 AGTTGCCAACAGTTCCATTCAGG + Intronic
1008584550 6:52936970-52936992 AGGGGCCAACAGAACCACAAAGG - Intergenic
1011156846 6:84342775-84342797 AGATGCCAACAGATTCATTGTGG + Intergenic
1011938895 6:92817818-92817840 AGATGCCAACAGAAGCATTAAGG + Intergenic
1014799335 6:125759890-125759912 AGATGCCGACAGATCCACAAAGG + Exonic
1016953908 6:149608280-149608302 AGAAGCCAGCAGAGCCACTAAGG + Intronic
1020284433 7:6669861-6669883 ATGTGCCAACAGATAAAATAAGG - Intergenic
1021595085 7:22306818-22306840 AGGTGCCAAGACATGCACTGAGG - Intronic
1022198187 7:28090028-28090050 AGGTACCATCAAATCCAGTATGG + Intronic
1029096952 7:98093215-98093237 GAGTTCCAAAAGATCCACTATGG - Intergenic
1038148283 8:24918225-24918247 AGGTGCCAAGGGATCCAGGAAGG + Exonic
1045589951 8:103582440-103582462 AGGTGCCAACATAGCCACAGGGG + Intronic
1048011271 8:130458114-130458136 AGGTGCAAACAGAACCACTGAGG - Intergenic
1049003987 8:139843355-139843377 AGGTGCCTGCAGAACCACAAGGG + Intronic
1059122938 9:111658919-111658941 ATGAGGAAACAGATCCACTAAGG - Intronic
1059356921 9:113707082-113707104 AGGAGCCAAAAGACCCACCACGG - Intergenic
1186692048 X:11988313-11988335 AGGTGCCAAGAAATACATTAGGG + Intergenic
1189735905 X:44069314-44069336 TGCTGCAAACAGATCCACCAAGG + Intergenic
1190000508 X:46682113-46682135 AGATGCTAACAGACCCACAAAGG + Intronic
1193161749 X:78236486-78236508 AGGTGCCAAAACATACACTGTGG - Intergenic
1195582890 X:106528766-106528788 AGGTGCCCACACATCCATTTAGG + Intergenic
1197484092 X:127025518-127025540 AGCTGTCAACAGAACCACTTTGG + Intergenic