ID: 951687856

View in Genome Browser
Species Human (GRCh38)
Location 3:25364443-25364465
Sequence ATGTGGGCTTCACACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951687848_951687856 26 Left 951687848 3:25364394-25364416 CCTATGTACCTCCTTCCCAGAAT 0: 1
1: 0
2: 2
3: 20
4: 205
Right 951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
951687850_951687856 15 Left 951687850 3:25364405-25364427 CCTTCCCAGAATAATGCACATCT 0: 1
1: 0
2: 1
3: 25
4: 156
Right 951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
951687851_951687856 11 Left 951687851 3:25364409-25364431 CCCAGAATAATGCACATCTGCAA 0: 1
1: 0
2: 1
3: 25
4: 210
Right 951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
951687852_951687856 10 Left 951687852 3:25364410-25364432 CCAGAATAATGCACATCTGCAAA 0: 1
1: 0
2: 0
3: 31
4: 254
Right 951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
951687849_951687856 18 Left 951687849 3:25364402-25364424 CCTCCTTCCCAGAATAATGCACA 0: 1
1: 0
2: 1
3: 39
4: 260
Right 951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951687856 Original CRISPR ATGTGGGCTTCACACTCAGG AGG Intronic
902258509 1:15206498-15206520 AGGTGGACTTCACAGTCAGCTGG + Intronic
902712165 1:18247867-18247889 AAGTGGGATTCAAACTCTGGTGG + Intronic
903027052 1:20436859-20436881 CTGTGGGCCTCACACACAGTAGG - Intergenic
906818996 1:48909436-48909458 ATGTTGGCTTTAAACTCAGAGGG + Intronic
908119530 1:60972706-60972728 ATTTGGGGTTCACATACAGGTGG - Intronic
908736881 1:67285807-67285829 ATATGGGCTCCACAAACAGGCGG - Intergenic
909038179 1:70619083-70619105 ACATAGGCTCCACACTCAGGAGG + Intergenic
913449787 1:118985407-118985429 CTGTCGGCTCCAGACTCAGGCGG - Intronic
916556228 1:165896414-165896436 GCATGGGCTTCAGACTCAGGCGG - Intronic
920525534 1:206663440-206663462 ATGTGGGTTGAACACCCAGGAGG + Intronic
922886478 1:229024661-229024683 ATGAGGGCATCAGCCTCAGGTGG - Intergenic
923031945 1:230256090-230256112 ATGAGGGCTCCACTCTCATGGGG - Intronic
1063108534 10:3015076-3015098 AGGTGAGCTCCACACCCAGGTGG + Intergenic
1065504459 10:26415390-26415412 ATGTGACCTTCACACTCTAGTGG - Intergenic
1065853293 10:29809305-29809327 AGCTGGGATTCATACTCAGGCGG - Intergenic
1067525458 10:47035841-47035863 ACATGGGCTGGACACTCAGGGGG - Intergenic
1068118086 10:52756658-52756680 ATGTGGTTCTTACACTCAGGTGG + Intergenic
1068613080 10:59082208-59082230 TAGTGTGCTTCACACTCAGCTGG - Intergenic
1069593874 10:69657961-69657983 AGGTGTGCATCACACGCAGGTGG + Intergenic
1075466746 10:122657140-122657162 AGGTGGGCTGCCCAATCAGGAGG + Intergenic
1077062508 11:624076-624098 ATGTGGGCATCACCCTCGGGGGG + Intronic
1077194949 11:1274822-1274844 ATGAGGTCGTCACACTCAGAAGG - Exonic
1077459608 11:2702217-2702239 ATGTGGGGTTTACATTCTGGTGG + Intronic
1081746701 11:45478122-45478144 ATGTGGGGTTCAGACACTGGAGG - Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086764204 11:90674910-90674932 ATGTGGCCTTCCCAGCCAGGTGG + Intergenic
1087025602 11:93646417-93646439 ATGTGGGTTCTAGACTCAGGTGG + Intergenic
1089196744 11:116697910-116697932 GACAGGGCTTCACACTCAGGGGG + Intergenic
1091231497 11:133990843-133990865 TTGTGGGGTACACACTCTGGTGG - Intergenic
1097644880 12:62224514-62224536 ATGAGGGCTTCACTCTCATTCGG + Intronic
1099074285 12:78085658-78085680 GTGTGGGCTGAACATTCAGGAGG + Intronic
1100020352 12:90061989-90062011 ATGTGTGACTCACCCTCAGGAGG + Intergenic
1101145234 12:101834480-101834502 TTGTGGGATTTACACTCTGGAGG + Intergenic
1101833081 12:108274492-108274514 ATGTGGGGTTGACAGTCAGCAGG + Intergenic
1102913023 12:116732811-116732833 ATGTGGGCTTTAAAATCAGGTGG + Intronic
1105291266 13:19055251-19055273 CTGTGGGATTCTCACTGAGGAGG - Intergenic
1106101106 13:26695684-26695706 CTGTGGCTTTCACACTTAGGTGG + Intergenic
1106561114 13:30847088-30847110 ATGAGGGCTACACACTCAGTGGG - Intergenic
1107819300 13:44271938-44271960 ATGTGGGCATAGCACTCAGGAGG - Intergenic
1108925635 13:55740090-55740112 ATGAGGGCTTCTCACTTCGGTGG - Intergenic
1114849235 14:26362997-26363019 ATGTATGCTTCAGAGTCAGGTGG + Intergenic
1117748513 14:58896766-58896788 AATTGGTCTTCACATTCAGGAGG - Intergenic
1119031423 14:71195821-71195843 AGGTGGGCTCCACTCTCACGTGG + Intergenic
1119485756 14:74985345-74985367 CTGTCAGCTTCATACTCAGGGGG + Intergenic
1121691105 14:95877389-95877411 ATGTGGGTTTGACATGCAGGCGG + Intergenic
1122345022 14:101053333-101053355 ATGTGGACTTTACATTCTGGTGG + Intergenic
1122578859 14:102758794-102758816 ATGTGGACTTCTCACACAGGGGG - Intergenic
1122775001 14:104113195-104113217 AAGGGGGCTTCACACTCTGGTGG + Exonic
1124219344 15:27835738-27835760 ATGAGGGCCTCACACTGACGGGG - Intronic
1124393440 15:29280276-29280298 CTGGGGGCTCCTCACTCAGGGGG - Intronic
1127641542 15:60920401-60920423 ATGTGGGCTTCACATACAAATGG - Intronic
1128187004 15:65651005-65651027 ATGCGGGGCTCACACTCAAGAGG + Intronic
1129482195 15:75835870-75835892 AGGAGGGCTTCCCACTCTGGAGG + Intergenic
1129683024 15:77668916-77668938 ATGTGGTCTTCAGACACATGTGG + Intronic
1130331648 15:82926764-82926786 ATGAGGGCTTCACCCTCATGGGG + Intronic
1131108493 15:89750291-89750313 TCGTGGGCTCCACTCTCAGGGGG + Intronic
1132596057 16:750691-750713 AAGTGGGCTGCACTCTCCGGAGG + Intronic
1137744813 16:50812789-50812811 ATGTGGTTTTCACCCTCTGGGGG - Intergenic
1138335643 16:56250734-56250756 ATGTTAACTTCACTCTCAGGTGG + Intronic
1138344612 16:56312190-56312212 ATGTGGGCTCCGGAGTCAGGCGG + Intronic
1138346137 16:56321388-56321410 GTGTTGGCTGCACACTCAGAGGG + Intronic
1140193873 16:72840649-72840671 CTGTGGGCTTCAGAGTAAGGTGG - Intronic
1141476885 16:84280036-84280058 ATGTGGGGCTCACACACAGCAGG - Intergenic
1142354335 16:89595225-89595247 ATGTAGGCATCACACTCTGAAGG + Intronic
1144949220 17:18985038-18985060 GTGTGGGCTCCAAGCTCAGGAGG + Intronic
1147115892 17:38299374-38299396 ATGCGTGCATCACCCTCAGGAGG - Exonic
1148413784 17:47490250-47490272 ATGCGTGCATCACCCTCAGGAGG + Intergenic
1150567953 17:66359527-66359549 ATGTGGGCCTGAAACTCTGGAGG + Intronic
1150638656 17:66934285-66934307 AGCTGGGATTCAAACTCAGGAGG + Intergenic
1150769073 17:68026041-68026063 ATGTTGGCTTCACACCCTGAAGG + Intergenic
1151145343 17:72035292-72035314 ATGTGGACTTTGCTCTCAGGTGG - Intergenic
1157588904 18:48824323-48824345 ATGAGGGCTGCACACACAGGAGG + Intronic
1159346539 18:67214030-67214052 ATGTGGGCTTCAGAGTGAAGAGG - Intergenic
1160426310 18:78781470-78781492 ACGTGGGCTGGACTCTCAGGCGG + Intergenic
1163468352 19:17482731-17482753 GTGTGGGCTTTGCACTCAGTAGG + Intronic
1164398235 19:27884941-27884963 ATGTAGGCTTCAGTCCCAGGTGG + Intergenic
1167717409 19:51152695-51152717 ATCAGGGCTTCACACACAGAGGG + Intronic
925158292 2:1663605-1663627 CTCTGGGCTGCACAGTCAGGTGG + Exonic
930172682 2:48267476-48267498 GTGTTGTCTTCCCACTCAGGTGG - Intergenic
931711907 2:64995210-64995232 AGCTGGGCTTCAAACCCAGGTGG - Intronic
932381510 2:71287852-71287874 ACTTGGTCTACACACTCAGGTGG - Intronic
934068862 2:88365319-88365341 ATGTGAGCATCACCCTCAGGAGG + Intergenic
934770678 2:96906112-96906134 AGGTGGGCAGAACACTCAGGCGG - Intronic
937706276 2:124924402-124924424 ATGAGGGCTCCACACTCAGAAGG + Intergenic
938556789 2:132431722-132431744 GTGTGGACTTCACATTCAGTGGG + Intronic
939787919 2:146539410-146539432 AAGTGGGGATCACATTCAGGAGG - Intergenic
940121173 2:150268008-150268030 TTGTAGGCTTAACACTCAAGAGG + Intergenic
941824797 2:169883196-169883218 CTGAGGGCTTCACACTGAGACGG + Intronic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
947232279 2:227900668-227900690 ATGTGTGCCTGAAACTCAGGTGG + Intronic
947342752 2:229157115-229157137 AGGAGGGCCTCACACTCAGAAGG + Intronic
947365258 2:229388021-229388043 AGGCTGGCTTCAGACTCAGGAGG + Intronic
948342111 2:237261971-237261993 ATGTAGGCTTCACCTTCTGGAGG - Intergenic
1169197894 20:3693193-3693215 AGGTGGCATTCAAACTCAGGAGG + Intronic
1170109529 20:12790018-12790040 AAGTGAGCTTCACCCACAGGTGG + Intergenic
1172706800 20:36887949-36887971 GTGTGACCTTCACATTCAGGGGG + Intronic
1175374211 20:58513846-58513868 ATCTGGGCTTCCCAGCCAGGTGG + Intronic
1175520425 20:59599306-59599328 ATGTCGGCTTCACAGGCACGGGG - Intronic
1177456128 21:21342455-21342477 CTGTGGGCTGCAAGCTCAGGTGG + Intronic
1177910325 21:27023160-27023182 ATGTGGGCTTCAGACCCTGAAGG + Intergenic
1178507235 21:33171860-33171882 ATCTGGGCTTCTCACTCAGCAGG + Intergenic
1178595197 21:33947191-33947213 TTGAGGGGTTCACACTCTGGGGG + Intergenic
1179728651 21:43354834-43354856 ATGGGGTGGTCACACTCAGGTGG - Intergenic
1181748058 22:24969727-24969749 ATGTGGGCTTTATACTGAGGCGG + Intronic
1181833803 22:25585176-25585198 ATGGGTGTTTCCCACTCAGGAGG + Intronic
1182000365 22:26914893-26914915 CTGTGGGGTTTACACTCAGTGGG + Intergenic
1182356123 22:29722936-29722958 ATGAGGGCTTCCCAGCCAGGCGG + Intronic
950718848 3:14868280-14868302 ATGTGGCCATGAGACTCAGGTGG - Intronic
951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG + Intronic
954153658 3:48672731-48672753 ATATAGGCTTCACACACAAGTGG - Intergenic
955919860 3:63944097-63944119 ATGTGAGCTTAACTCTCAAGTGG - Intronic
957831780 3:85530832-85530854 ATGTGGTCTTCAAAATCAAGTGG + Intronic
961005803 3:123404614-123404636 CAGTGGCCTTCCCACTCAGGAGG - Intronic
961627170 3:128272126-128272148 GTGTGGGCCACACACTCAGGTGG + Intronic
963113535 3:141706558-141706580 ATGTGGACTTGTCACCCAGGAGG - Intergenic
968492707 4:898905-898927 ATGTGGGCTTCACAATTGTGTGG - Intronic
968495540 4:913399-913421 CTTTGGGCTTCACACTCCTGTGG - Intronic
970825937 4:20274667-20274689 CTGTGGATTTCACACTCAGAAGG - Intronic
977180444 4:93867061-93867083 GTGTGGGCTTCTCAGTCATGCGG + Intergenic
978620233 4:110629796-110629818 AAATGGTCTTCACCCTCAGGAGG - Intronic
982922197 4:161289997-161290019 TTGTGGTCCTCACTCTCAGGTGG - Intergenic
984023260 4:174511994-174512016 TTGTTGGCTTCAGACTAAGGAGG + Intronic
986431222 5:7683103-7683125 GTGTGGGCTTCAAAGTCATGAGG + Intronic
993054533 5:82967206-82967228 ATGTGCTCTTCACATTCAGTAGG - Intergenic
995206195 5:109484125-109484147 AGGTGGGCATCAAACTCAAGTGG + Intergenic
1001899683 5:175415974-175415996 ATGTGGGCTTTAGAATCAGACGG + Intergenic
1012423735 6:99092457-99092479 ATGATGGCTTCAGAGTCAGGGGG - Intergenic
1019905172 7:4057093-4057115 AGGTGTGCTTCAGACCCAGGTGG - Intronic
1020134231 7:5577496-5577518 ATGTGGGCCTCCCACTTGGGAGG - Intergenic
1020262782 7:6539991-6540013 ATATGGGCATAGCACTCAGGTGG - Intronic
1021236699 7:18151208-18151230 AGGTGGCTTTCTCACTCAGGGGG + Intronic
1021605432 7:22405029-22405051 AGTTGGGCCTCACACTCATGTGG - Intergenic
1023964143 7:44953295-44953317 AAGTGGGCTGCCCACTCAAGAGG - Intergenic
1023968030 7:44973424-44973446 CTCTGGGCTGCCCACTCAGGTGG - Intronic
1024727077 7:52210435-52210457 ATATGGACTTCAGAATCAGGAGG - Intergenic
1028041347 7:86058459-86058481 CTGTGGGCTTTTCACTGAGGAGG + Intergenic
1032535590 7:132660642-132660664 ATGTGGGCTTTTTATTCAGGTGG - Intronic
1032710750 7:134458618-134458640 AAGTGGGCTTCACAGACCGGTGG - Intronic
1032853784 7:135817247-135817269 ATGTGGGCTTCAAAGTCAACAGG + Intergenic
1036107645 8:5857748-5857770 ATGTGGCCATCACACATAGGAGG + Intergenic
1036719803 8:11163614-11163636 ATGTGGTCGAGACACTCAGGAGG + Intronic
1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG + Intergenic
1038334271 8:26633862-26633884 GTCTGTGCTTCACACACAGGGGG + Intronic
1038781716 8:30573873-30573895 ACCTGGGCTTCAGACTCAGCTGG + Intergenic
1039274046 8:35915388-35915410 ATGAGGGCTGCATACTCTGGAGG + Intergenic
1039874697 8:41575845-41575867 ATGTTGGCTTCCCACTCAGAGGG + Intergenic
1043024054 8:75044579-75044601 AAGTGGGGCTCAAACTCAGGTGG + Intergenic
1044836268 8:96298424-96298446 ATTGGGCCTTCACACTCAGTGGG + Intronic
1045492626 8:102681813-102681835 ATGTGGGCCTCACACTCTAAAGG - Intergenic
1046761415 8:118025268-118025290 CTGTGGGCTTCACCATGAGGAGG + Intronic
1049439582 8:142602976-142602998 ATGTGGGCTTTACCCAGAGGTGG + Intergenic
1052025283 9:23567211-23567233 ATTGAGGATTCACACTCAGGTGG - Intergenic
1057690304 9:97277917-97277939 GTGTGGGCCTCACAGTTAGGTGG + Intergenic
1058721676 9:107769913-107769935 ATGAGCTCTTCACACTCAGGAGG + Intergenic
1061226319 9:129283013-129283035 CAGTGGGCTTCAAAGTCAGGCGG - Intergenic
1062679479 9:137770706-137770728 ATGTAGGCCTCACACCAAGGAGG + Intronic
1185614347 X:1411711-1411733 AGGAGGTCTTCACACTGAGGAGG - Intronic
1188849438 X:35113808-35113830 ATTTGGGTTTCACACACAAGAGG - Intergenic
1189162405 X:38823172-38823194 ATGATGGTTTCACACTAAGGTGG + Intergenic
1190830175 X:54052539-54052561 AAGTGGGCTTCACTCATAGGTGG - Intergenic
1192805552 X:74505602-74505624 ATGTTGGCTCCACCGTCAGGGGG - Intronic
1192998614 X:76539293-76539315 ATGTGGGCTCCAGTCCCAGGTGG - Intergenic
1195502894 X:105623534-105623556 ATGTGGGCATCACAGACAGAAGG - Intronic
1198669277 X:139061338-139061360 ATGAGGGATTCACCCTCATGAGG + Intronic