ID: 951690227

View in Genome Browser
Species Human (GRCh38)
Location 3:25387367-25387389
Sequence CTGTAGGAAAGAGGGTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951690227_951690236 8 Left 951690227 3:25387367-25387389 CCAGATCACCCTCTTTCCTACAG 0: 1
1: 0
2: 2
3: 15
4: 197
Right 951690236 3:25387398-25387420 GGGTAGGAAACACATTGGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 152
951690227_951690235 3 Left 951690227 3:25387367-25387389 CCAGATCACCCTCTTTCCTACAG 0: 1
1: 0
2: 2
3: 15
4: 197
Right 951690235 3:25387393-25387415 CTTATGGGTAGGAAACACATTGG 0: 1
1: 0
2: 1
3: 5
4: 131
951690227_951690232 -8 Left 951690227 3:25387367-25387389 CCAGATCACCCTCTTTCCTACAG 0: 1
1: 0
2: 2
3: 15
4: 197
Right 951690232 3:25387382-25387404 TCCTACAGCACCTTATGGGTAGG 0: 1
1: 0
2: 1
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951690227 Original CRISPR CTGTAGGAAAGAGGGTGATC TGG (reversed) Intronic
901227626 1:7623397-7623419 CTGCAGGAGAGTGGGTGAGCTGG + Intronic
904915544 1:33967751-33967773 CTGAAGCAAAGAATGTGATCTGG - Intronic
905311069 1:37049345-37049367 GTTTAGGGAAGAGGGTGATAAGG + Intergenic
905358165 1:37399270-37399292 CTCAAGGAAAGAAGGTGATGGGG - Intergenic
907048794 1:51316039-51316061 CTGTGGGAAAGGGGCTGGTCAGG - Intronic
907219743 1:52897547-52897569 CTGTAGGCAATAGGGTGGGCTGG - Intronic
909228621 1:73058251-73058273 CTGTTGGAAAGACAGTGTTCCGG - Intergenic
913667202 1:121059211-121059233 CCGTAGGAAAGTGGATGGTCAGG + Intergenic
914018892 1:143846362-143846384 CCGTAGGAAAGTGGATGGTCAGG + Intergenic
914446838 1:147757750-147757772 TTGGAGGAGGGAGGGTGATCAGG + Exonic
915144220 1:153785295-153785317 CTGTAGGAAAGGGAGGGATGCGG - Intergenic
918675348 1:187277925-187277947 CTGTAATAAGCAGGGTGATCAGG + Intergenic
922157801 1:223053603-223053625 CTGCAGGAATGGGGGTGATGTGG + Intergenic
923799828 1:237197644-237197666 CTGTAGGAATGAGGGTGGAAGGG + Intronic
924565516 1:245195072-245195094 ATGTAGGAACCAGTGTGATCTGG + Intronic
924943290 1:248826998-248827020 ATGAAGGAAGGAAGGTGATCAGG + Intergenic
1063613251 10:7580915-7580937 CTGAAGGAAAAAGGGTGGCCAGG - Intronic
1065391160 10:25183291-25183313 CTGTAGGAAAGAGGAGGGTGTGG - Intronic
1070650131 10:78229354-78229376 CTGTAGGACAGAGGCTGGCCTGG + Intergenic
1070785765 10:79161342-79161364 CAGTAAGAAAGAGGGTGGGCAGG - Intronic
1070812335 10:79304742-79304764 CTGTGGGCAAGAGGATGGTCTGG + Intronic
1072838330 10:98741443-98741465 CTGAAGGAAGGAGGTTGATGGGG + Intronic
1073011230 10:100361300-100361322 CTCAAGGAAAGAGAGTTATCTGG - Exonic
1075169666 10:120101728-120101750 CTGGAGGAAAGATGATGAGCTGG + Intergenic
1077172562 11:1174473-1174495 CTGCAGGGAAGGGGGTCATCGGG - Intronic
1077440324 11:2565881-2565903 CTGGAGGAAGGAGGGTGCTGTGG + Intronic
1080454406 11:32405190-32405212 CTGTTGGTCAGAGGGTGATGTGG - Intronic
1081177592 11:39947525-39947547 TTGGAGGAAAGAGGGTACTCTGG - Intergenic
1082633719 11:55571080-55571102 TTGGAGGAAAGAAGGTGATGTGG - Intergenic
1083755854 11:64791328-64791350 CTGCAGGGAAGAGGCAGATCTGG - Intronic
1085236247 11:75017676-75017698 CTGTCTGAAAGAGGTTGACCTGG + Intronic
1086424237 11:86668735-86668757 CTGTATGACAGAGGGTGGTCAGG - Intronic
1087995396 11:104800442-104800464 CGTTAGGAAAGAGTGTAATCTGG + Intergenic
1090364394 11:126193444-126193466 CTTGGGGAAAGAGGGTGCTCGGG + Intergenic
1090984094 11:131750545-131750567 TTGTAGCAAAGGGGGTGGTCAGG - Intronic
1092236907 12:6816081-6816103 CTATAAGAAAGAGGGGGAACAGG + Exonic
1094558497 12:31527086-31527108 CGGTATGAGAGAGGGTGATATGG + Intronic
1096874416 12:54616001-54616023 ATGTAGGAAATTGGGTGCTCTGG - Intergenic
1097727483 12:63091520-63091542 CAGTAGGAAAGATGGGGATTGGG + Intergenic
1099940615 12:89183735-89183757 ATGTTGGAAACAGGGTGGTCAGG - Intergenic
1100608426 12:96170624-96170646 CAGGAGGAAAGAGGCTGGTCCGG + Intergenic
1101236624 12:102796163-102796185 CTGTAGAGAAGAGGATGATCTGG + Intergenic
1101574726 12:105986885-105986907 CTGTAAGAATGAGGATAATCAGG + Intergenic
1102050095 12:109855958-109855980 CTGGAGGAGAGAAGGTGCTCGGG - Intronic
1104417451 12:128607076-128607098 GTGTAGGTGAGAGGGTGATATGG + Intronic
1105299453 13:19119001-19119023 GAGGAGGAAAGAGGGTGATGGGG + Intergenic
1105867670 13:24474956-24474978 AGGTAGGAAGGAGGCTGATCTGG - Intronic
1108259742 13:48644624-48644646 CTGAAGGAAAGAGGAAAATCAGG + Intergenic
1111267171 13:85831716-85831738 CAGTAGGAAAGCCTGTGATCAGG + Intergenic
1112740500 13:102467592-102467614 CTGTAGGATAGAATGTCATCCGG + Intergenic
1116586794 14:46716401-46716423 CTGTAGAAGGGAGGGTGAACAGG - Intergenic
1116779372 14:49219201-49219223 TTGTAGGAAAGATATTGATCAGG - Intergenic
1118780197 14:69002922-69002944 TGGAAGGAAAGAGGTTGATCAGG - Intergenic
1119002884 14:70898938-70898960 CTGTGGGAGAGAGGGTGGTGTGG + Intergenic
1120738345 14:88079976-88079998 ATTTAGGAAAGAGTGTGATTGGG - Intergenic
1121628755 14:95407136-95407158 CTGCATGAAAGAGGTTGAACTGG + Intergenic
1122061103 14:99137239-99137261 CAGGAGGAAAGACGGTGATGTGG - Intergenic
1122102912 14:99427858-99427880 CTGTCGGGAAGAGGGGGATCTGG + Intronic
1123931829 15:25175628-25175650 CTGGAGAAAGGTGGGTGATCAGG + Intergenic
1125739999 15:41955898-41955920 GTGGAGGCAAGAGTGTGATCTGG - Intronic
1125899979 15:43336910-43336932 CTATAGGATAGAGGATGATATGG + Intronic
1126339547 15:47624053-47624075 CTGAATGACAGAGGGGGATCAGG - Intronic
1128162731 15:65434857-65434879 CAGTGGAAAAGAGGGTGGTCAGG - Intergenic
1130424126 15:83777705-83777727 CTGTTGGAAAGAAGGTGCTCTGG - Intronic
1132019731 15:98350139-98350161 ATGGAGGAAAGAGGGGAATCAGG + Intergenic
1132329696 15:101003790-101003812 CTGGAGCTAAGAGGGTGATATGG - Intronic
1132614967 16:835855-835877 ATTAAGGAAAGAGGGTGAACAGG + Intergenic
1134319809 16:13152494-13152516 CTTTAGGAAGGAGGGAGATGAGG + Intronic
1140045463 16:71437707-71437729 GTGGGGGAAAGGGGGTGATCAGG - Intergenic
1142481095 17:218703-218725 CTGTATGAAAGAGGGTTAACGGG - Intronic
1142739931 17:1925943-1925965 CTGTAGGAAGAAGGATGATGGGG + Intergenic
1144100295 17:11937036-11937058 CTGCAGGAAAAAGAGTCATCAGG + Intronic
1145184963 17:20786094-20786116 CTCAAGGAAAGAGAGTTATCTGG - Intergenic
1145722704 17:27088556-27088578 GTGGGGGAAAGAGGGTGATGAGG - Intergenic
1147431603 17:40374764-40374786 CTTTATGAAATAGGGTAATCTGG + Intergenic
1149972830 17:61236233-61236255 CTGTAGGAAAGTGGGAGGACAGG + Intronic
1150853879 17:68732145-68732167 GTGAAGGACAGAGGGTTATCAGG + Intergenic
1151658071 17:75504850-75504872 CTGTAGGTAAGAGGGTGCGGGGG + Exonic
1156570476 18:38246508-38246530 CAGCAGGAAAGAGGGTGAAAGGG + Intergenic
1156699947 18:39814308-39814330 TTGGAGGAAAGAGGGTACTCTGG + Intergenic
1156842595 18:41627356-41627378 GTGTAGGTAACAGGGAGATCAGG - Intergenic
1158409985 18:57197237-57197259 CTGTGGGCAAGAGGGTGCACTGG - Intergenic
1166828869 19:45626505-45626527 CTGGAGTTAAGAGGGTGACCGGG - Intronic
1168585278 19:57586685-57586707 TTGTAGGAAAGAGGATGATCTGG + Intronic
925216292 2:2098557-2098579 CACTAGGGAGGAGGGTGATCTGG + Intronic
925410546 2:3637430-3637452 ATGTAGGAAGGAGGGCGGTCGGG + Intronic
925904240 2:8529743-8529765 CTGTAGGAAAGTGTGTGGTCAGG - Intergenic
927039403 2:19213132-19213154 CAGAAGGGAAGAGGCTGATCAGG + Intergenic
927188867 2:20502250-20502272 GTGATGGAAGGAGGGTGATCTGG - Intergenic
927342638 2:21999715-21999737 CAATAGTAAAGAGGGTGATCAGG - Intergenic
936247187 2:110838588-110838610 CTGTAGGAATGAGGAAGAGCAGG + Intronic
936519501 2:113202615-113202637 CTGTAGGAAGGAGGCTGGGCCGG + Exonic
937049950 2:118880404-118880426 CTGGAAGACAGAGGATGATCTGG + Intergenic
937079969 2:119133806-119133828 CTATAGGAAAAAGGGTGCTTAGG + Intergenic
937437332 2:121891231-121891253 CTGAAGGGAAGAGGGTGTCCTGG + Intergenic
939527003 2:143307586-143307608 ATGAGGGAAAGAGGTTGATCTGG + Intronic
939869883 2:147515243-147515265 CAGTAGGAAAGAGCATGAGCTGG - Intergenic
941299342 2:163782012-163782034 CTGTAGGAAAGAGTGTGAATGGG + Intergenic
942956574 2:181781074-181781096 GAGTTGGAAAGATGGTGATCTGG + Intergenic
944165161 2:196710804-196710826 CTGTAGGATAGAAGGAGATTTGG + Intronic
944435131 2:199680903-199680925 AAGTAGGAAAGAGAGTGAGCAGG - Intergenic
947634104 2:231671515-231671537 CTGCAGGAAGGAGGGTGAGGTGG - Intergenic
947865926 2:233397722-233397744 CTGTAGGGTGGAGGGTGAACTGG + Intronic
948725483 2:239931243-239931265 CTGCAGGAAAGAAGCTGTTCCGG + Intronic
1169555303 20:6743273-6743295 GAGTAGGGAAGAAGGTGATCAGG - Intergenic
1169780666 20:9306612-9306634 CCCAAGGAAAGAGGGTGAGCAGG - Intronic
1172343744 20:34180126-34180148 ATGTAGGGAAGAGGCTGATGAGG + Intergenic
1172749807 20:37243010-37243032 CTATAGGTAAGAGGATGATGTGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173074853 20:39808025-39808047 CTGTAGGAAAGAGGGGAAAATGG - Intergenic
1173179734 20:40796773-40796795 CTGTAGGAAAGAAGGGGATCTGG - Intergenic
1173222142 20:41139008-41139030 CTGTGTGAAGGAGGGAGATCAGG + Intronic
1174660922 20:52212292-52212314 CTCTAGGCAGGAGAGTGATCCGG - Intergenic
1176143930 20:63557164-63557186 CTGGAGGAGAGAGGGAGCTCAGG - Intergenic
1178740354 21:35194285-35194307 CTGTAGGTAAGATGGTGATATGG - Intronic
1179331702 21:40408696-40408718 CTGTAGGAATGAGTGGGCTCGGG - Intronic
1180083306 21:45496577-45496599 CTGTAGGACAGTGGGTGCCCTGG - Intronic
1182893158 22:33836128-33836150 CTGTAGGAAGCAGGCTGAACTGG - Intronic
1183676937 22:39304424-39304446 CTTTAGGCAATAGGGTGATCTGG - Intergenic
1183856817 22:40640214-40640236 GTGTGGGAAAGAGGGTGAAGTGG - Intergenic
951687746 3:25363425-25363447 TTGTAGGAAAGAAGGTTTTCAGG - Intronic
951690227 3:25387367-25387389 CTGTAGGAAAGAGGGTGATCTGG - Intronic
952340540 3:32442008-32442030 CTGTCGGTAAGAGAGTGGTCTGG + Exonic
952512137 3:34068521-34068543 CTGGAGCCAAGAGGGTGTTCTGG + Intergenic
952778941 3:37074773-37074795 CTGTAGGAAACAGTGTGCTTAGG + Intronic
953816441 3:46162354-46162376 TTGGAGGAAAGAGGGTCCTCTGG + Intergenic
954224330 3:49172613-49172635 CTGGAGGAAAGAGGGAAAACAGG - Intronic
955859575 3:63313360-63313382 CTGGAGGAAAGAGTGGGAGCGGG - Intronic
958838500 3:99173460-99173482 TTGGAGGAAAGAAGGTGCTCTGG - Intergenic
958891246 3:99785533-99785555 CTGGAGGAAAGAAGGTGTTATGG + Intronic
963296859 3:143556241-143556263 GTGTAAGAAAGAGGGTGAGGGGG + Intronic
963612404 3:147486709-147486731 CTGTAAGAGAGATGGTGATCAGG - Intronic
968728592 4:2259537-2259559 CTGTAGTCAAGAGGGAGGTCGGG + Intronic
969263936 4:6052087-6052109 CTGAAGGAAAGAGGGAGGGCTGG + Intronic
971132922 4:23833694-23833716 CTGCTGGATGGAGGGTGATCAGG - Intronic
971196511 4:24475476-24475498 CTGTAGGAAGGAGGGGGAGTTGG - Intergenic
971311795 4:25531467-25531489 CTGTAGGAAGGTGGGAGGTCTGG - Intergenic
975827977 4:78339566-78339588 CTGTGAGACAGAGGGAGATCTGG + Intronic
977917243 4:102607746-102607768 CAGCAGGTAAGATGGTGATCTGG + Exonic
977919706 4:102629391-102629413 CTGTTGGAATGAAGGTGAACTGG - Intergenic
979321758 4:119332871-119332893 CTGCAGTAAATAGGGTGCTCAGG - Intergenic
979673364 4:123384629-123384651 CAGTAGGAAAGAGGATGAAGGGG - Intergenic
981930813 4:150187500-150187522 CAGTACTAAAGAGGGTGGTCAGG - Intronic
983239735 4:165218474-165218496 CTGCAGTAAATAGGGTGCTCAGG - Intronic
988521304 5:31947790-31947812 CTGGAGGATAGAGTGTGACCTGG + Intronic
991665222 5:68993099-68993121 CTGGAGGAAAGAGAGTGAGGGGG + Intergenic
993452723 5:88092512-88092534 CTATAGGACAGAGGGTGGCCTGG - Intergenic
996228764 5:121034532-121034554 CTCTAGGAAAGATGGTTATTGGG + Intergenic
996551244 5:124732759-124732781 GTGTGGGAAAGAGGGTGGTTGGG - Intronic
996663278 5:126028317-126028339 TTGGAGGAAAGAAGGTGCTCTGG - Intergenic
997207343 5:132057479-132057501 TTGAAGGAAAGAGGGGGATGGGG - Intergenic
998444082 5:142185370-142185392 CTTCAGGAACCAGGGTGATCAGG - Intergenic
998956933 5:147448218-147448240 CTCTAGGCTAGAAGGTGATCAGG + Intronic
998974658 5:147631412-147631434 CTGTATGAAAGAAGGTGTTAAGG - Exonic
1000140439 5:158398116-158398138 CTCTGGGGAAGAGGGTTATCAGG - Intergenic
1002474226 5:179454754-179454776 CAGTATGAAACAGGGTGGTCAGG - Intergenic
1002581049 5:180209498-180209520 CTTGAGGAGAGAGGGTGAACTGG - Intergenic
1004762127 6:18678694-18678716 CTGAAGAAAAGAGGTTGATTTGG - Intergenic
1004776950 6:18857955-18857977 CTGTTGGAAAGAGTGTAATTTGG + Intergenic
1005300365 6:24464737-24464759 CAGTGGGAAAGAGGGTTCTCTGG - Intronic
1006109859 6:31737955-31737977 TTGTTGGACAGAGGGTGATGAGG - Intronic
1006516421 6:34548131-34548153 GGGTAGGAAAGCGGGTGATGTGG - Intronic
1006527399 6:34618731-34618753 CTGTAAGGAAAAGGGTGATGGGG - Intronic
1006824649 6:36925832-36925854 GTGTGGGAAAGAGGGTTGTCAGG + Intronic
1006898063 6:37483291-37483313 TGGGAGGAAAGAGGGTGATAGGG + Intronic
1013413028 6:109898418-109898440 TGCTAGGAAAGAGGGTCATCAGG - Intergenic
1015453505 6:133397975-133397997 CTGTAAGAAACATGGTGATATGG - Intronic
1018171630 6:161147948-161147970 CTGGGGTCAAGAGGGTGATCTGG + Intronic
1022982280 7:35615440-35615462 CAGTGGGAAAGAGGAGGATCTGG + Intergenic
1023815000 7:43942986-43943008 CTGTAGGAAAGTGGATGGTCAGG - Exonic
1025229117 7:57188204-57188226 TAGTAGGAAAGAGGGTGAGAGGG - Intergenic
1027305519 7:76892321-76892343 CTGTAGGAAGGTGGGGGAGCTGG + Intergenic
1028922905 7:96326638-96326660 TGGTAGGAAAGAGGGTAATCTGG - Intergenic
1029128835 7:98314586-98314608 GTGTTGGAAGGAGGGTGATGAGG + Intronic
1029807045 7:103009133-103009155 GTGTAGGAAGGAGTGTGATATGG + Intronic
1030300319 7:107968003-107968025 CAGGAGCAAAGAGGGTGATGGGG + Intronic
1032087911 7:128893345-128893367 CTGAAGGAATGAGGCAGATCTGG + Intronic
1032650434 7:133872115-133872137 CTGGAGGAAAGGTGGGGATCAGG + Intronic
1033303270 7:140205331-140205353 CTGATGGAAAGAGGGAGAACAGG + Intergenic
1033799200 7:144880663-144880685 CTGGAGGATAGTGGGTGATAAGG - Intergenic
1034408689 7:150924568-150924590 GTGTAGGAAAGAGGAAGAGCAGG + Intergenic
1037372440 8:18194290-18194312 CTGTAGGGGAGAGGGTGAGGTGG + Intronic
1037381152 8:18286629-18286651 CTTTAGGAAGTATGGTGATCAGG + Intergenic
1037450548 8:19012765-19012787 GTGTAGGGAAGACGGAGATCTGG - Intronic
1037916638 8:22777182-22777204 CAGAAGGAAAGAGGGAAATCGGG - Intronic
1039003497 8:33007913-33007935 CTGTATGATAGAGTGAGATCCGG + Intergenic
1041956604 8:63562948-63562970 GTGTAGGGAAGTGGGTGAACAGG - Intergenic
1041995006 8:64044262-64044284 CTGTAGTCAAGAGGGTGGTATGG + Intergenic
1042154795 8:65832838-65832860 CAGTAGGAAATAAGGAGATCTGG - Intronic
1042360755 8:67880405-67880427 CTGTAGGAAAGATAGAGATTGGG + Intergenic
1043301777 8:78743686-78743708 CTGGAGGAAAGAGGGCACTCAGG + Intronic
1044564997 8:93653163-93653185 CTGCAAGAAAGAGGGAGAGCTGG - Intergenic
1045029102 8:98117826-98117848 CAGAAAGAAAGATGGTGATCTGG + Intronic
1048766694 8:137852320-137852342 CTGGAGGAAAGATTGTGAGCAGG - Intergenic
1050852888 9:10310497-10310519 GTTTAGGAAAGAGGTTGATGAGG + Intronic
1055639750 9:78310483-78310505 GCGTAGGAAAGAGGGGGCTCAGG + Intronic
1055867525 9:80833209-80833231 CTGGAGGAAAGAAGATGACCTGG + Intergenic
1055931002 9:81559844-81559866 CTGTAGGGAGGAGAGGGATCTGG - Intergenic
1056573664 9:87838007-87838029 CTGGAGGAGAGAGGCTGATTGGG - Intergenic
1056631067 9:88293544-88293566 CTGTAGGAATAGGGGTGAACAGG - Intergenic
1057866810 9:98687847-98687869 CTGTAGGAAGGAGGGTGAAGGGG + Intronic
1060225433 9:121787213-121787235 CTGTAGGAAAGAGCGGGGTGGGG - Intergenic
1185468721 X:370204-370226 CTCTAGCAAAGAGGGAGAACTGG + Intronic
1186399687 X:9246115-9246137 CTGTTGGCAAGAGGATGCTCTGG - Intergenic
1186535582 X:10343828-10343850 CAGTAGGAAAGTGGGAGACCTGG + Intergenic
1188715272 X:33452340-33452362 CTGTAGAAAAGAGGATGGTGTGG - Intergenic
1188723426 X:33551299-33551321 TTGGAGGAAAGTGGGTGCTCTGG + Intergenic
1189536147 X:41937143-41937165 CTGTAGGAGAGAATGAGATCAGG + Intergenic
1190379572 X:49827244-49827266 CTGTAGGAGAGAGGGAGAGAAGG + Intergenic
1195341464 X:103910916-103910938 CTGGAGGAAACATGGTGACCAGG + Intergenic
1195430365 X:104782343-104782365 CTGTAGAAAAGAGAATGATCTGG + Intronic
1196043059 X:111226686-111226708 CTGCTGGAAAGAGGGTAAACTGG + Intronic
1196203986 X:112918337-112918359 CTGTAGGAAAGAGAGGGAGGGGG - Intergenic
1199401041 X:147398613-147398635 CTGTAGAAAAGTTGGAGATCAGG + Intergenic
1200409760 Y:2849569-2849591 CTGGAGGACAGAAGGTGATGGGG + Intronic