ID: 951690879

View in Genome Browser
Species Human (GRCh38)
Location 3:25395561-25395583
Sequence CATAATCCTACATTTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11486
Summary {0: 1, 1: 31, 2: 550, 3: 7267, 4: 3637}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951690877_951690879 5 Left 951690877 3:25395533-25395555 CCAATTATTCATAGGTTTGGTTG 0: 1
1: 73
2: 214
3: 434
4: 978
Right 951690879 3:25395561-25395583 CATAATCCTACATTTCTTGGAGG 0: 1
1: 31
2: 550
3: 7267
4: 3637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951690879 Original CRISPR CATAATCCTACATTTCTTGG AGG Intronic
Too many off-targets to display for this crispr