ID: 951692241

View in Genome Browser
Species Human (GRCh38)
Location 3:25408513-25408535
Sequence GTCCCCACCCTAATTAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951692241_951692245 12 Left 951692241 3:25408513-25408535 CCTCCTCTAATTAGGGTGGGGAC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 951692245 3:25408548-25408570 CATATCAGACTGCAAATAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951692241 Original CRISPR GTCCCCACCCTAATTAGAGG AGG (reversed) Intronic
902446158 1:16465915-16465937 GGCCCCACCCTAAATCCAGGAGG + Intergenic
904775608 1:32904249-32904271 GTCCCCAACCTAATTCCAGAAGG - Intergenic
908922889 1:69217470-69217492 GTGCCAACCCTCAGTAGAGGAGG + Intergenic
908960623 1:69692901-69692923 GTCCCCACCCACATTAGGGAGGG - Intronic
909827709 1:80146362-80146384 GTGCCCACCCAGATTAAAGGTGG + Intergenic
910831831 1:91469167-91469189 GTGCCCACCCAAATTAACGGTGG + Intergenic
917469820 1:175316725-175316747 GTCCCCAACAGAATGAGAGGGGG - Exonic
921119496 1:212124518-212124540 GTTCCCACCCAAATTAAGGGTGG - Intergenic
922073035 1:222215312-222215334 GTTTGCACCCTAATTAAAGGGGG - Intergenic
924792258 1:247262812-247262834 GTCCCCACCCAAATTTCATGTGG + Intergenic
1062993004 10:1837379-1837401 GTGCCCACCCAAATTAAAGGTGG - Intergenic
1069191986 10:65503859-65503881 GTGCCCACCCAAATTAAGGGTGG + Intergenic
1076308099 10:129479208-129479230 GTCCCCACCCTAACTATTAGTGG - Intronic
1076594976 10:131619676-131619698 CTCCCCACCCTGCTCAGAGGTGG - Intergenic
1076595205 10:131620792-131620814 CTCCCCACCCTGCTCAGAGGTGG + Intergenic
1078897808 11:15613226-15613248 CTGCCCACCCTAATGAGAAGAGG + Intergenic
1081452654 11:43186940-43186962 GTGCCCACCCAGATTAAAGGTGG + Intergenic
1088846182 11:113670061-113670083 CTACTCACCCTAATGAGAGGAGG + Intergenic
1089835235 11:121364755-121364777 GTGCCCACCCAGATTAAAGGTGG + Intergenic
1090649057 11:128790706-128790728 GTCCACTGCCTTATTAGAGGTGG + Intronic
1097136281 12:56859052-56859074 GTGCCCACCCAGATTAAAGGTGG - Intergenic
1099360597 12:81695254-81695276 GTCCCCACCCTACTTTTATGTGG + Intronic
1101223096 12:102660932-102660954 GGGCCCACCCTAATTAGAGAGGG - Intergenic
1101534292 12:105603263-105603285 GTGCCCACCCAAATTACAGGTGG + Intergenic
1111454851 13:88467044-88467066 GTCCCCACCCTCCTGCGAGGAGG + Intergenic
1111623591 13:90755074-90755096 GTGCCCACCCGGATTAGAGGTGG + Intergenic
1112744787 13:102514488-102514510 GCCCCCACCCACATTAGAGAGGG - Intergenic
1115060017 14:29176365-29176387 GTGCCCACCCAAATTAAGGGTGG - Intergenic
1115941987 14:38620020-38620042 GTGCCCACCCAAATTAAGGGTGG - Intergenic
1116122702 14:40741104-40741126 GTGCCCACCCAGATTAGGGGTGG + Intergenic
1116527554 14:45925739-45925761 GTGCCCACCCAGATTAAAGGTGG - Intergenic
1117597206 14:57335411-57335433 GTGCCCACCCAAATTAAGGGTGG + Intergenic
1122208381 14:100159664-100159686 GCCCCCGCCCTAATCAGAGCTGG - Exonic
1125969107 15:43897758-43897780 GTCCCCACCCAAATCTGATGTGG + Intronic
1126336803 15:47593988-47594010 GTCCCCACCCAAATTTCATGTGG - Intronic
1130980021 15:88805946-88805968 GCCCCCTCCCCAATTAGAGAGGG + Intronic
1131699734 15:94921360-94921382 GTCCCCACCCAAATTTCATGTGG - Intergenic
1136928191 16:34394787-34394809 GTGCCCACCCAGATTAGGGGTGG + Intergenic
1136976383 16:35017017-35017039 GTGCCCACCCAGATTAGGGGTGG - Intergenic
1141386399 16:83625750-83625772 CTCCCCTCCCTAATTTCAGGGGG - Intronic
1147258066 17:39193957-39193979 GGCCTCACTCTAATTAGTGGTGG + Intronic
1148467318 17:47872816-47872838 GGCCCCAGCCTGATTAGAGCCGG + Intergenic
1151100529 17:71550911-71550933 ATGCCCAGACTAATTAGAGGAGG + Intergenic
1151382691 17:73736526-73736548 GTCCCCACCCAAATCTCAGGTGG + Intergenic
1152212291 17:79009126-79009148 GTCCCCACACTAACCAGAGGGGG + Intronic
1152212307 17:79009178-79009200 GTCCCCACACTAATCAGAGCGGG + Intronic
1152212323 17:79009231-79009253 GTCCCCAAACTAATTAGAAGGGG + Intronic
1155724170 18:29058338-29058360 GTCCCTACCTTAAATAAAGGGGG - Intergenic
1158803148 18:60936987-60937009 GTCCCCACCCAAATCTCAGGTGG - Intergenic
1163562757 19:18030157-18030179 TTCCCCACCCTGGCTAGAGGTGG - Intergenic
1165850944 19:38849990-38850012 GTCCCTCCCCCAATGAGAGGCGG - Exonic
1167636492 19:50658928-50658950 GTCCCCACCCCCCTTACAGGTGG + Exonic
926453426 2:13035694-13035716 GTGCCCACCCAGATTAAAGGTGG + Intergenic
930091686 2:47535465-47535487 AGCCCCACCCCCATTAGAGGAGG - Intronic
932713053 2:74081925-74081947 GCCCCCACCCTCTTGAGAGGTGG + Intronic
936989984 2:118353006-118353028 TTCCCCACTCTAAATTGAGGAGG + Intergenic
940471776 2:154110646-154110668 GTGCCCACCCTGATTAAGGGTGG + Intronic
940550436 2:155148528-155148550 GTGCCCACCCAAATTAAGGGTGG + Intergenic
940855974 2:158729054-158729076 GTCCCCCAGCTAATTAGAGCTGG + Intergenic
941474090 2:165926696-165926718 GTGCCCACCCAAATTAAGGGTGG - Intronic
944845999 2:203668314-203668336 GTGCCCACCCAGATTAGGGGTGG - Intergenic
1169134699 20:3190263-3190285 GCCCCCACTCAAATTAGAAGTGG - Intergenic
1169653115 20:7891934-7891956 CTCTCCACCCTACTCAGAGGAGG + Intronic
1170586411 20:17737734-17737756 GTGCCCACCCAAATTAAGGGTGG - Intergenic
1170861607 20:20109587-20109609 GTGAGCACCCTAGTTAGAGGGGG - Intronic
1175190855 20:57211363-57211385 AGCCCCACCCAAGTTAGAGGAGG + Intronic
1175808336 20:61843967-61843989 GTCCCCCTCCTCATTACAGGAGG + Intronic
1177581077 21:23022124-23022146 GTCCCCACCCACATTAGGGTGGG - Intergenic
1183645082 22:39120854-39120876 GTGCCCACCCAGATTAAAGGTGG - Intronic
1184778129 22:46633382-46633404 GTCCCCACCTTCATTAGGTGGGG - Intronic
949941382 3:9157404-9157426 GTCCCCACCCTAATCTCACGTGG - Intronic
951692241 3:25408513-25408535 GTCCCCACCCTAATTAGAGGAGG - Intronic
954083182 3:48224340-48224362 GTCCCCATCCTAGTCAGAGGAGG - Exonic
955055153 3:55448095-55448117 AGCCCCACCCTCATGAGAGGAGG + Intergenic
955748421 3:62163202-62163224 GTCCCCACCCAAATCTCAGGTGG - Intronic
967516088 3:190370767-190370789 GTGCCCACCCAAATTAAGGGTGG - Intronic
969915062 4:10482748-10482770 GTGCCCACCCAAATTAACGGCGG + Intergenic
970364153 4:15341742-15341764 GCCCCCACCCTATTTGGAGTGGG + Intronic
970445653 4:16121345-16121367 GTCCCCACCCTGAGTTGAGCAGG - Intergenic
971685128 4:29756079-29756101 GTGCCCACCCAGATTAAAGGTGG - Intergenic
971890033 4:32507958-32507980 GTCCCCACCCAAATCAGGGGAGG + Intergenic
973874415 4:55201909-55201931 GTGCCCACCCAGATTAAAGGTGG - Intergenic
974574902 4:63706019-63706041 GTGCCCACCCAGATTAAAGGTGG + Intergenic
974687011 4:65243460-65243482 GTGCCCACCCACATTAAAGGTGG - Intergenic
976284711 4:83360375-83360397 GTGCCCACCCAGATTAAAGGTGG - Intergenic
980290757 4:130845763-130845785 GTCCACACCCTTATTAGGGAGGG - Intergenic
982898100 4:160960333-160960355 GTGCCCACCCACATTGGAGGTGG - Intergenic
985139316 4:186822320-186822342 GACCACAGCCTGATTAGAGGGGG - Intergenic
985910973 5:2882607-2882629 TTCCCCACCCTAATTTTAGTGGG + Intergenic
986127348 5:4895380-4895402 GTCCCCACCCAGATTAAGGGTGG + Intergenic
986235337 5:5904452-5904474 GTGCCCACCCAGATTAAAGGTGG - Intergenic
987151656 5:15046768-15046790 GTGCCCACCCAAATTAAGGGTGG - Intergenic
987246520 5:16054535-16054557 GTCTCCACCCTCATTGAAGGTGG - Intergenic
988058740 5:26137852-26137874 AACCCCACCCTAATTAGACATGG + Intergenic
988084965 5:26463426-26463448 GTCCCCACCCAAATTTCATGTGG + Intergenic
988615723 5:32772979-32773001 GTCCCCATCCTAGCTAGGGGTGG + Intronic
988785397 5:34562016-34562038 GTGCCCACCCAAATTAAGGGTGG + Intergenic
990371455 5:55123264-55123286 TTCTCCAGCCTAATCAGAGGTGG - Intronic
994531180 5:100973853-100973875 GTGCCCACCCTAATTAAGGATGG - Intergenic
994646693 5:102479064-102479086 GTCCCCACCCTAATCTCATGTGG + Intronic
994836970 5:104867190-104867212 GTGCCCACCCTATTAAGGGGTGG - Intergenic
996101590 5:119450475-119450497 GTTCCCCCAATAATTAGAGGTGG - Intergenic
997147963 5:131458163-131458185 GTCCCCACCCAAATTTCACGTGG + Intronic
997722255 5:136088590-136088612 CTCCCCACCCAAACCAGAGGTGG - Intergenic
998487513 5:142516134-142516156 GTCCCCACCCAAATTTTATGTGG + Intergenic
1003688394 6:8327334-8327356 GTCCTGACCCTAATTAGACCTGG - Intergenic
1008399628 6:51049669-51049691 CTCCCCACCCTAGGAAGAGGAGG + Intergenic
1009533596 6:64852269-64852291 GTCCCCACCCAGATTAAGGGTGG - Intronic
1012920419 6:105216768-105216790 GTTCCCACCCAGATTAAAGGTGG + Intergenic
1014175831 6:118330359-118330381 GTGCCCACCCGGATTAAAGGTGG + Intergenic
1015502642 6:133950356-133950378 GTGCCCACTCAAATTAAAGGTGG - Intergenic
1016564392 6:145437055-145437077 GTCCCCACCCAAATTTCATGTGG + Intergenic
1017382976 6:153851266-153851288 GTGCCCACCCAAATTAAGGGTGG - Intergenic
1017475129 6:154782859-154782881 GTGCCCACCCAGATTAAAGGTGG + Intronic
1019547388 7:1585087-1585109 GTCCCCACCCTATTCTCAGGTGG + Intergenic
1021215462 7:17910946-17910968 GTTCTGACACTAATTAGAGGTGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1032630263 7:133643376-133643398 GTGCCCACCCAAATTAAGGGTGG + Intronic
1034897459 7:154886618-154886640 GTCCCCACCCTAAGCAGCGCTGG + Intronic
1035877626 8:3208700-3208722 GTGCCCACCCAAATTAAGGGTGG - Intronic
1037695701 8:21222035-21222057 GTCCCCACCCAGATTAAAGGTGG - Intergenic
1040973982 8:53169804-53169826 GTCCCCAGCCTAACTTCAGGGGG - Intergenic
1048457953 8:134594999-134595021 GCCTCCACCATAATTTGAGGTGG - Intronic
1050482240 9:6099289-6099311 GTGCCCACCCAAATTAAAGGTGG - Intergenic
1052211090 9:25904437-25904459 GTCCTCACCCTTGTTAGTGGTGG - Intergenic
1053180370 9:35962907-35962929 CACCCCATCCCAATTAGAGGTGG + Intergenic
1053189187 9:36047235-36047257 GTCCCTACCCTCATTAGACTGGG - Intronic
1054802309 9:69362727-69362749 GTGCCCACCCAGATTAAAGGTGG - Intronic
1058020308 9:100079146-100079168 GTGCCCACCCAGATTAGGGGTGG - Intronic
1059311324 9:113390725-113390747 GTCCCCACCCTGTTGAGAAGTGG + Intronic
1186116374 X:6308823-6308845 GTGCCCACCCTGATTAATGGTGG - Intergenic
1186455328 X:9706147-9706169 GTCCCCACCCAAATCTCAGGTGG - Intronic
1188230493 X:27656992-27657014 GTGCCCACCCAAATTAAGGGTGG - Intronic
1189841754 X:45086892-45086914 GCCCCCACCCCAATTAAAGGGGG + Intronic
1193607394 X:83585032-83585054 TTCCCCAACCTCATTAGAGAGGG + Intergenic
1196372363 X:114994110-114994132 GTGCCCACCCAAATTAAGGGTGG + Intergenic
1197420193 X:126228848-126228870 GTACCCACCCAGATTAAAGGTGG - Intergenic
1199040569 X:143110945-143110967 GTACCCACCCAGATTAAAGGTGG - Intergenic
1201301847 Y:12512243-12512265 GTGCCCACCCAGATTAAAGGTGG - Intergenic