ID: 951692460

View in Genome Browser
Species Human (GRCh38)
Location 3:25410861-25410883
Sequence CAAGTGGCTCTCTGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951692460_951692464 4 Left 951692460 3:25410861-25410883 CCTGCTCTGCAGAGAGCCACTTG 0: 1
1: 0
2: 4
3: 32
4: 313
Right 951692464 3:25410888-25410910 ATGTTTAGGAGCATACTACTGGG 0: 1
1: 0
2: 0
3: 9
4: 108
951692460_951692465 10 Left 951692460 3:25410861-25410883 CCTGCTCTGCAGAGAGCCACTTG 0: 1
1: 0
2: 4
3: 32
4: 313
Right 951692465 3:25410894-25410916 AGGAGCATACTACTGGGCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 135
951692460_951692461 -10 Left 951692460 3:25410861-25410883 CCTGCTCTGCAGAGAGCCACTTG 0: 1
1: 0
2: 4
3: 32
4: 313
Right 951692461 3:25410874-25410896 GAGCCACTTGCTCAATGTTTAGG 0: 1
1: 0
2: 0
3: 7
4: 134
951692460_951692463 3 Left 951692460 3:25410861-25410883 CCTGCTCTGCAGAGAGCCACTTG 0: 1
1: 0
2: 4
3: 32
4: 313
Right 951692463 3:25410887-25410909 AATGTTTAGGAGCATACTACTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951692460 Original CRISPR CAAGTGGCTCTCTGCAGAGC AGG (reversed) Intronic
900704629 1:4072566-4072588 CACGAGGCTCCCTTCAGAGCAGG + Intergenic
901405149 1:9040237-9040259 GAAGGCGCCCTCTGCAGAGCCGG + Intronic
902260280 1:15219841-15219863 CAAATGGCTCCATGCACAGCTGG - Exonic
903299810 1:22370764-22370786 CAAGTGGGTGTCTGCAGACTGGG - Intergenic
904239634 1:29135344-29135366 CCAGTGGCTTTGTGCAGGGCTGG - Intergenic
904346664 1:29876856-29876878 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
904477123 1:30772567-30772589 CTAGTTGCTTTCTGCTGAGCTGG + Intergenic
904556532 1:31368512-31368534 CAGGTGGCTGGCAGCAGAGCTGG - Intronic
904593941 1:31631233-31631255 CCAGTGGCTGACTCCAGAGCAGG - Intronic
904746884 1:32716798-32716820 CTAGGGCCTCTCTCCAGAGCTGG - Intergenic
906055961 1:42917131-42917153 CAGCTGCCTCTCTGCAGGGCAGG - Intergenic
907611284 1:55873949-55873971 CAAGTTGCTCTCTCCAGAATTGG - Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
909091089 1:71226895-71226917 AAAGTACCTCTCTGCAGTGCTGG - Intergenic
909973586 1:82020258-82020280 GAATTGGTTCTCTGAAGAGCAGG + Intergenic
911787238 1:101966398-101966420 CAAGTGGCTCTCTTGAGTGCAGG - Intronic
912041463 1:105396673-105396695 AAAGTGGCTCTCTGCAGAATGGG + Intergenic
915261923 1:154683007-154683029 AAAGTGGCTGTCTGCAAACCAGG + Intergenic
916323288 1:163530134-163530156 ACAGTGGCTCCCTGTAGAGCTGG + Intergenic
918484591 1:185015953-185015975 CAAGTGGCTATCTGAATAGCGGG - Intergenic
918941903 1:191010985-191011007 AAAGTGGCTGTCTGCAAACCAGG - Intergenic
918948330 1:191099991-191100013 AAGGTGGCTCTCTGCAAACCAGG + Intergenic
919193699 1:194256559-194256581 CAAGTGGCCCTCTCCAGTTCAGG + Intergenic
920200757 1:204258487-204258509 CAAGTGGTTCTCCCCAGAGCAGG + Intronic
920724247 1:208418785-208418807 CAGGGGACCCTCTGCAGAGCCGG - Intergenic
920928353 1:210364041-210364063 CATATGGCTCTGTACAGAGCTGG - Intronic
921803759 1:219431401-219431423 AAAGTGGCTGTCTGCTGAGGTGG + Intergenic
921982215 1:221271284-221271306 CATGTGTCTGTCTGCAGAGCTGG - Intergenic
922062367 1:222104704-222104726 CAAGTGGCTCCCTGTGCAGCAGG + Intergenic
923545077 1:234918054-234918076 CAGGTCGCTGCCTGCAGAGCAGG + Intergenic
1062803328 10:396023-396045 CAAGGGGCTCTCAGCTGAGGGGG + Intronic
1063965191 10:11340900-11340922 CACATGACGCTCTGCAGAGCAGG + Intergenic
1065633343 10:27705200-27705222 CAAGTAGCTCTCTGTAGGCCCGG - Intronic
1066265763 10:33774396-33774418 GAAGTGGCCCTCTGCAGATGGGG - Intergenic
1066272538 10:33837560-33837582 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
1066703569 10:38155156-38155178 CAAGAGGATCTCTGCAGGGCAGG + Intergenic
1066987208 10:42478112-42478134 CAAGAGGATCTCTGCAGGGCAGG - Intergenic
1067077852 10:43198254-43198276 CAGATGCCCCTCTGCAGAGCAGG + Intronic
1067120938 10:43471608-43471630 AAAATGGCTCTCAGCAGAGAGGG + Intronic
1067211426 10:44262825-44262847 CAGCTGGCTTTCTCCAGAGCAGG + Intergenic
1067797593 10:49332040-49332062 CAGGTGGCTCTGCGCAGGGCTGG - Intergenic
1067807781 10:49405152-49405174 CCAGTGCCTCCCTGCAGTGCTGG + Intergenic
1068015915 10:51516159-51516181 AAAGTGGCTCTCAGGAGAGAAGG + Intronic
1068521051 10:58077843-58077865 CTAGAGGCTCTAGGCAGAGCTGG + Intergenic
1068765289 10:60756508-60756530 CGAGTGGATCTCTTGAGAGCAGG + Intergenic
1069568250 10:69478145-69478167 CAGGTGGCAGTGTGCAGAGCAGG + Intronic
1069568252 10:69478164-69478186 CAGGTGGCAGTGTGCAGAGCAGG + Intronic
1069568257 10:69478183-69478205 CAGGTGGCTGTCTGCAGGGTGGG + Intronic
1070152185 10:73811718-73811740 CAAGCGGCCCTCCGCAGTGCCGG + Intronic
1070249705 10:74763385-74763407 CAAGTGGTTCCAAGCAGAGCAGG - Intergenic
1071149768 10:82620385-82620407 GAAATGGCTCTCGGCAGAGAGGG + Intronic
1071676159 10:87658520-87658542 CAAGTGTCTGTCTGGAAAGCTGG + Intergenic
1073268090 10:102240602-102240624 GAAGTGGGTCTCTCCGGAGCGGG - Intronic
1074341778 10:112638179-112638201 CAAGAAGCTCTCTGAACAGCTGG + Intronic
1075074648 10:119342765-119342787 GAAGTGGCTCTTGGCAGCGCAGG + Intronic
1075209299 10:120477682-120477704 CAAGGGGCTCACTGTAGAGAGGG - Intronic
1075943810 10:126414529-126414551 CTAGTGGCTCTCAGAGGAGCTGG + Intergenic
1076502662 10:130949522-130949544 CAAGAGGCTCCCAGCACAGCCGG - Intergenic
1076823839 10:132957450-132957472 CACATGGCTCTCAGCAGGGCTGG - Intergenic
1077356364 11:2120731-2120753 AAATTGGTTCTCTGCAGAGTCGG - Intergenic
1077549382 11:3193320-3193342 CAAGGGGCTCTATGGAGAGGAGG - Intergenic
1078953298 11:16160350-16160372 TAAGTGGCTCTCTGCAGCTCAGG + Intronic
1081718091 11:45265585-45265607 AAAATGGCTCTCTGCAAACCGGG - Intronic
1081909835 11:46693897-46693919 TAAATGGCTCTCTGGAGAGGGGG - Intronic
1083298753 11:61729134-61729156 AGAGAGGCTCTCTGGAGAGCCGG - Intronic
1083524742 11:63352210-63352232 AAAGTGGCTGACTGCAGACCAGG - Intronic
1083636463 11:64123489-64123511 CAAGTGGCTATCTGCATAGCAGG + Intronic
1083667579 11:64284303-64284325 CAGGCCCCTCTCTGCAGAGCTGG + Exonic
1084175297 11:67419653-67419675 CAGGTGGCTCTCACCTGAGCAGG - Exonic
1089213718 11:116822985-116823007 CAAGTGGCTCACAGGAGAGCTGG - Intronic
1093755801 12:22850699-22850721 AAAGTGGCTTTCAGCAGAGAAGG + Intergenic
1094208986 12:27870596-27870618 CCACTGGCTCTCTGAAGTGCTGG - Intergenic
1097342573 12:58455593-58455615 CAAGAGGCTCAGAGCAGAGCAGG - Intergenic
1097746599 12:63310475-63310497 GGAGTGGCTCTCAGCAGAGAGGG + Intergenic
1097891013 12:64777987-64778009 CAGGTGGATCTCTTGAGAGCAGG - Intergenic
1100594561 12:96060833-96060855 AAAGTGGCTCTCTGCAGAAAGGG + Intergenic
1102940114 12:116933348-116933370 CACATGGCTCTCTACAAAGCAGG - Intronic
1104040864 12:125129692-125129714 CAAGAGGCTCTGGGCAGAGGTGG - Intronic
1104167619 12:126249174-126249196 CCAGTGGCTTACTTCAGAGCTGG + Intergenic
1104351552 12:128048350-128048372 GAATTGGGTATCTGCAGAGCTGG - Intergenic
1104733763 12:131123419-131123441 CAGGTGACTCTCAGCACAGCTGG + Intronic
1104833695 12:131772880-131772902 GAAGTGGCTCTCAGCAGAAAGGG + Intronic
1104969265 12:132523853-132523875 CACGTGGCTTCCTGCAGAGGTGG + Intronic
1106111661 13:26783080-26783102 CAAGTGGGTGTTTGCAGAGCAGG + Intergenic
1106627377 13:31434453-31434475 GAAGTGGCTCTCAGCAGAAAGGG + Intergenic
1106689206 13:32095860-32095882 CAGATGGCTCTCTTCTGAGCTGG + Intronic
1107037055 13:35912609-35912631 GAAGTTGCTCTCAGCAGAGAGGG - Intronic
1107294394 13:38894337-38894359 GAAGTGGCTCTCAGCAGATGGGG - Intergenic
1107383416 13:39881522-39881544 ATAGTGGCTATCTGGAGAGCTGG + Intergenic
1108548930 13:51523517-51523539 AAAGTTGTTCTCAGCAGAGCTGG - Intergenic
1109152426 13:58860898-58860920 GAAGTAGCTCTCAGCAGATCAGG + Intergenic
1109883035 13:68506982-68507004 AAAGTGGCTCTCGGCAGAGAGGG - Intergenic
1110278690 13:73667816-73667838 AAAGTGGCTCTCTGCAGCAAAGG - Intergenic
1110582885 13:77152738-77152760 GAAGTGGCTCTCAGCAGAAGGGG - Intronic
1111607857 13:90563942-90563964 GAAGTGGCTCTCAGCAGGGAGGG - Intergenic
1111726248 13:92013269-92013291 GAAATGGCTCTCAGCAGAGAGGG + Intronic
1112197872 13:97243095-97243117 CAAGTGACTATCTGCAGCGGTGG + Intronic
1113116938 13:106884634-106884656 CAAGAGGATTTCTGCAGCGCTGG + Intergenic
1113882431 13:113635218-113635240 CAAGGTGCTCACTGCAGAGCTGG + Intronic
1114627089 14:24136790-24136812 AAGGTGGATCTCTGCAGACCTGG - Intronic
1116509071 14:45721113-45721135 CAAGTGATTCTCTGTAGTGCTGG - Intergenic
1116526357 14:45910605-45910627 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
1116683241 14:48004191-48004213 AAATTGGCTTTCTGGAGAGCTGG - Intergenic
1116909603 14:50445792-50445814 CAAGTGGATCACTTCAGATCAGG - Intronic
1119913321 14:78371389-78371411 GAAGTGGCTCTCAGCAGAAGGGG - Intronic
1120856591 14:89217794-89217816 GAAGTGGGTCACTGCAAAGCTGG - Intronic
1121670735 14:95709118-95709140 CAGGTGCCTCTCAGCAGGGCTGG - Intergenic
1122942122 14:104986092-104986114 CTCGCGGCTCTCTCCAGAGCAGG + Exonic
1124123662 15:26914808-26914830 CATGGGGCACTCTGCAGAGATGG - Exonic
1124343670 15:28906564-28906586 CAAGTTGCTCTCTGGACAGGTGG + Intronic
1124684905 15:31774230-31774252 CAAGGTGCTCTCTGCAGCCCAGG + Intronic
1128258691 15:66216846-66216868 CAAGTGGCTCTCTGTAGCTGAGG - Intronic
1128555469 15:68628842-68628864 CAAGAGGCTTTCTGCTGAGAGGG + Intronic
1128695885 15:69762527-69762549 CAAGAGGTCCTCGGCAGAGCTGG + Intergenic
1128980209 15:72180221-72180243 CAGGGCACTCTCTGCAGAGCCGG - Intronic
1130509801 15:84580218-84580240 CTAATGGCTTTCTGCAGAGGAGG - Intergenic
1132048280 15:98584858-98584880 CAAGTGTCTCTCTGTAGCCCAGG + Intergenic
1133116218 16:3579276-3579298 CACCTGGTTCTCAGCAGAGCGGG - Intergenic
1133695652 16:8260080-8260102 GAAGTGGCTCTCAGCAGAAAGGG - Intergenic
1134346648 16:13397912-13397934 GAAGTAGCTCTCAGCAGAGCGGG + Intergenic
1138384781 16:56628721-56628743 CTAGTAGCTCACTCCAGAGCTGG + Intergenic
1138936940 16:61738077-61738099 GAAGTGGCTCTCTCAAGAGAGGG + Intronic
1140040893 16:71407049-71407071 GAAGAAGCTCTCTGCAGAGGTGG - Intergenic
1141218890 16:82050500-82050522 TAAGTTGTTCTCTGCAGAGTAGG + Intronic
1141631626 16:85291178-85291200 CCAGGGTCTCTCAGCAGAGCTGG + Intergenic
1142066125 16:88064130-88064152 CAGGGGGCTCTCTTCAGAGACGG + Intronic
1142662671 17:1442082-1442104 CAAGTGGATCTCTGGAGCTCAGG - Intronic
1143225964 17:5303467-5303489 CAAGTGGATCTCTTCAGGACAGG - Intronic
1145165623 17:20611560-20611582 CAACTGGCTCTCTGCAGAAAGGG + Intergenic
1145988726 17:29065284-29065306 CAAGTGGCTCTGTGCTGCCCAGG - Intergenic
1147124015 17:38352946-38352968 CAAGAGGCCTTCTGGAGAGCTGG + Exonic
1147538450 17:41335705-41335727 CGTGTGCCTCTCTGCACAGCAGG + Intergenic
1148079504 17:44960002-44960024 CCACCGGCTCGCTGCAGAGCCGG - Exonic
1150932086 17:69596019-69596041 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
1155017865 18:21863449-21863471 GAAATGGCTCTCAGCAGAGAGGG + Intronic
1155849365 18:30752167-30752189 CAAGTTGATCTCTGCTGGGCTGG - Intergenic
1156309786 18:35911331-35911353 AAAGTGGCTATCTGCAAGGCAGG + Intergenic
1156506494 18:37599058-37599080 GGAGTGGCTTTCTGAAGAGCTGG - Intergenic
1156760538 18:40583687-40583709 GAAGTAGCTCTCTGCAGATGGGG + Intergenic
1157146487 18:45168024-45168046 AAACTGGCTCTCTGTCGAGCTGG - Intergenic
1158211114 18:55051451-55051473 AAAATGGCTGTCTGCAAAGCAGG - Intergenic
1161152175 19:2715380-2715402 CATGTGGGTCTCTCCACAGCGGG - Exonic
1161368224 19:3893524-3893546 CACTTAGCCCTCTGCAGAGCCGG - Intronic
1162106258 19:8371509-8371531 CAAGAGCCTCTCTGGTGAGCAGG + Exonic
1163034162 19:14561961-14561983 CCACTGGCTCTGTGCAGGGCGGG + Intronic
1163833380 19:19558641-19558663 CAAATTGCTCTCTGCAGAGCAGG + Intergenic
1163974715 19:20840075-20840097 CCATTAGCTCTATGCAGAGCAGG - Intronic
1166445846 19:42856739-42856761 CAAGCTGCTCTCTGTAGAGGAGG + Intronic
1166482787 19:43187494-43187516 CAAGCTGCTCTCTGTAGAGGAGG + Intronic
1166485262 19:43206628-43206650 CAAGCTGCTCTCTGTAGAGGAGG + Intronic
1167274459 19:48528146-48528168 CAAGGGGGTCTCTCCAGATCTGG + Intergenic
1167647571 19:50713939-50713961 CAAGGGGGTCTCTGAAGGGCGGG + Exonic
1167708377 19:51095256-51095278 CATGGGGGTCTCTGAAGAGCTGG - Intergenic
1167882448 19:52471324-52471346 CAATAGGCTCTCTGCAAACCAGG - Intronic
1168554026 19:57323148-57323170 GAAGTGGCTTTCTGCATAGGAGG + Intronic
925299998 2:2805018-2805040 CACGTGGCTCACAGAAGAGCAGG + Intergenic
925384423 2:3452261-3452283 CAGCTGGCTCCCTGCAGAGAGGG + Intronic
925464636 2:4095974-4095996 CAAGTGGCTTTGTGGAGAGCTGG + Intergenic
928996975 2:37303218-37303240 GAAATGGCTCTCAGCAGAGTGGG - Intronic
931479095 2:62621927-62621949 TAAGCTGCTCTCTGCAGAGCCGG + Intergenic
931633550 2:64322418-64322440 CCAGGGGATCTCTGCAGATCTGG + Intergenic
931891343 2:66675886-66675908 AAAGTGGTTCTCTGAACAGCAGG + Intergenic
932126328 2:69148349-69148371 GAGGTGACACTCTGCAGAGCAGG - Intronic
932597921 2:73105774-73105796 CACCTGGCCCTGTGCAGAGCAGG + Intronic
933178873 2:79207671-79207693 GAAGTGGCTCCCTGCAGAGCTGG + Intronic
933317943 2:80737403-80737425 TCAGTGGCTCTCTTCAGAGCTGG - Intergenic
933943646 2:87266130-87266152 CATGTTGCCCTCTGCAGAGTGGG - Intergenic
934662660 2:96151385-96151407 CAAGGGGTTTTCAGCAGAGCTGG - Intergenic
935447095 2:103168210-103168232 CAAGTGGCTCCTGGCAGGGCGGG - Intergenic
936006168 2:108891258-108891280 TAAGTGGATCTCTGCACATCTGG + Intergenic
936012509 2:108933947-108933969 CCAGAGGCTCTCAGCAGGGCTGG + Intronic
936018433 2:108976887-108976909 GAAGTGGCTGACTCCAGAGCTGG - Intronic
937695737 2:124806482-124806504 GGAGTGGGTCTCTGTAGAGCTGG + Intronic
937835171 2:126464157-126464179 AAAATTGCTCTCTGCTGAGCGGG - Intergenic
937944820 2:127323172-127323194 CAAGTGGATCACTGGAGATCAGG + Intronic
938229855 2:129648945-129648967 TAAGGGGCTCTCTACAGAGTGGG - Intergenic
938639802 2:133266608-133266630 CAAGGCGCGCGCTGCAGAGCCGG + Intronic
938662571 2:133502883-133502905 GAGGTGGCTCCCTGCAGAGGAGG + Intronic
939060793 2:137419455-137419477 GAAATAGCTCTCTGCAGAGATGG + Intronic
939750215 2:146034891-146034913 CAGGAAGCTCTTTGCAGAGCTGG + Intergenic
940360493 2:152791129-152791151 CAAGTAGCTCTCAGCAGATGGGG - Intergenic
940599897 2:155845481-155845503 GAAGTAGCTCTCAGCAGAGAGGG - Intergenic
940622896 2:156135115-156135137 CAAGTGGCTCCCAGGAGAGAAGG - Intergenic
942482913 2:176407936-176407958 CAAGTGACTCCCTGCTGAACAGG - Intergenic
943664664 2:190596514-190596536 TCAGGGGCCCTCTGCAGAGCAGG + Intergenic
945033125 2:205683261-205683283 AAGGTGGCTCTTTCCAGAGCTGG - Exonic
945040075 2:205736554-205736576 CAAGTGGGTCTTTGCACAGGTGG - Intronic
945425388 2:209694421-209694443 CAAGGGGCTTTCTCCAGTGCAGG - Exonic
946191199 2:218009089-218009111 CAAGTGGCTGGCTCCATAGCTGG + Intergenic
946551907 2:220810911-220810933 CAACTGGCTTCCTCCAGAGCAGG + Intergenic
947251636 2:228112652-228112674 AAAGGGGCTGTCTGCAGACCAGG + Intronic
947763512 2:232621172-232621194 TGAGTGGCTGTCTGCATAGCAGG + Intronic
948092424 2:235305675-235305697 TGAGGGGCTGTCTGCAGAGCTGG + Intergenic
948272776 2:236687035-236687057 AAACTGGCTCCCAGCAGAGCTGG + Intergenic
948940109 2:241191206-241191228 CAAGCGGCCGCCTGCAGAGCTGG + Exonic
1168758135 20:329957-329979 GAAGTGGCTCTCTGCAGCTGCGG - Exonic
1168759034 20:336021-336043 CAAGGGTCTCTGTGTAGAGCTGG + Intergenic
1169068494 20:2707690-2707712 TAGGTGGCTCTTTCCAGAGCTGG - Intronic
1169324533 20:4664608-4664630 AAAGTGGCTCTCAGCAGGACAGG + Intergenic
1170597437 20:17816654-17816676 CAAATGGCTCGCTGGAAAGCCGG + Intergenic
1170621421 20:17999661-17999683 CCTGTGGCTCTCTGCAGTGCTGG - Intronic
1171225424 20:23438472-23438494 CAAGTGGCCCTCGGCAGCTCAGG + Intergenic
1173663145 20:44747730-44747752 CACCTGGCTCTCTGCAAGGCTGG - Intronic
1174511153 20:51053807-51053829 CCAGTGTCTCTCCCCAGAGCAGG + Intergenic
1175775162 20:61648490-61648512 AAAGTGGGGCTCGGCAGAGCTGG - Intronic
1175908750 20:62394664-62394686 CAAGTGGCTCTGTCCACAGGAGG + Intronic
1176050760 20:63118365-63118387 CATGTCGCTCTCTGCATTGCTGG + Intergenic
1176192380 20:63818157-63818179 CAAGGGGCCCTTTGTAGAGCTGG + Intronic
1179102337 21:38365295-38365317 CAAATGGTTCTGTGCAGACCAGG + Intergenic
1179800184 21:43808085-43808107 CAGGTGGGCCTCTGCAGAGGGGG - Intergenic
1183389770 22:37538927-37538949 TAAGTGGCTGTCAGCAGGGCAGG + Intergenic
1183842065 22:40507130-40507152 CAAGTGGATCACTTCAGTGCAGG + Intronic
1184925680 22:47635316-47635338 CAAGTGTGAATCTGCAGAGCTGG - Intergenic
1185055052 22:48575216-48575238 CAGGGGCCTCACTGCAGAGCCGG - Intronic
1185098398 22:48824128-48824150 CGAGGCGCTCTCTGCAGAGAAGG + Intronic
1185238321 22:49727303-49727325 CAAGAGGCTCCTGGCAGAGCTGG - Intergenic
949227403 3:1711156-1711178 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
949675432 3:6447902-6447924 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
949970880 3:9403025-9403047 CAAAGGGCTCTTTGCACAGCAGG + Intronic
950479377 3:13235237-13235259 ACAGTGGCTCCCTGGAGAGCTGG - Intergenic
951651374 3:24955156-24955178 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
951692460 3:25410861-25410883 CAAGTGGCTCTCTGCAGAGCAGG - Intronic
951954544 3:28240533-28240555 AAAGTGGGTCTCTGCTCAGCAGG - Intergenic
952868817 3:37878982-37879004 CTAGGCCCTCTCTGCAGAGCTGG - Intronic
953260989 3:41338967-41338989 CAAGTGGCCCTCCCCAGAGTAGG - Intronic
956962906 3:74423437-74423459 CAAGTGTCTCTCTGCAGCTGGGG + Intronic
957210102 3:77248212-77248234 AAAGTGGCTCTCAGCAGAAAGGG - Intronic
961406605 3:126684108-126684130 CAAGTGGATGTCTGCTCAGCCGG - Intergenic
961563585 3:127747682-127747704 CAAGTGGCTGTCTACAGACTTGG + Intronic
961580357 3:127875776-127875798 CATGTGGCTCTCTGGGGAGAGGG - Intergenic
961617363 3:128193365-128193387 GGTGTTGCTCTCTGCAGAGCAGG + Intronic
962119616 3:132548091-132548113 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
962474361 3:135742380-135742402 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
963378826 3:144503827-144503849 CAAATGGCTCTCAGCAGAGAGGG + Intergenic
963379469 3:144509099-144509121 CAAGTGGTTATCAGCAGGGCTGG + Intergenic
963604894 3:147405608-147405630 CAACTAGCTCTCTGGGGAGCAGG - Intronic
963827097 3:149968363-149968385 AATGTGGCTGTCGGCAGAGCTGG - Exonic
964920540 3:161890752-161890774 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
965039700 3:163490567-163490589 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
965123641 3:164595664-164595686 AAAATGGCTCTCAGCAGAGAGGG + Intergenic
965890891 3:173512358-173512380 AAAGTGGCTCTCAGTAGAGAGGG + Intronic
966958428 3:184908769-184908791 GAAATGGCTTTCTGCAGAGAGGG + Intronic
966977369 3:185096855-185096877 GAAGCGGCCCTCTGCAGTGCAGG - Intronic
967383672 3:188888468-188888490 CAAATGGCTATATTCAGAGCTGG - Exonic
968801202 4:2744235-2744257 CAGGTGGCTCTCCCCACAGCAGG + Intronic
969122664 4:4921342-4921364 CCAGTGGCTGTCTGCTGTGCAGG - Intergenic
969245594 4:5930680-5930702 CCTCTGGCTCTCTCCAGAGCCGG + Intronic
971427325 4:26529493-26529515 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
971806568 4:31365782-31365804 CCAGTGGCACTCTGCACAGAGGG + Intergenic
971959822 4:33471341-33471363 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
972698601 4:41472294-41472316 GAACTGGCTTTCTGCAGAGTTGG - Intronic
973014976 4:45126734-45126756 CAGGTGGCTATCTGCAAACCCGG + Intergenic
975510683 4:75191359-75191381 CATGTGGCTCTCTACTAAGCTGG + Intergenic
977220477 4:94332217-94332239 GAAATGGCTCTCAGCAGAGAGGG - Intronic
977306299 4:95327790-95327812 GAAGTGGCTCTCAGCAGAAGGGG - Intronic
978174584 4:105714252-105714274 CAGGTGCCACTCTGCAGAGAGGG - Intronic
979188119 4:117824325-117824347 AAAGTGGCTCTCAGCGGAGAGGG - Intergenic
983286947 4:165751915-165751937 GAAGAGGGGCTCTGCAGAGCTGG + Intergenic
983485251 4:168324796-168324818 CAAATGAATCTCTGCAGAGGAGG + Intergenic
983697866 4:170554616-170554638 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
984271900 4:177557734-177557756 GAAGTAGCTCTCTGCAGATGGGG - Intergenic
984660323 4:182367276-182367298 CAAGAGGATCTCTCCAGATCGGG - Intronic
985821514 5:2163909-2163931 CAAGAGGAGTTCTGCAGAGCAGG - Intergenic
986029819 5:3883521-3883543 CAAGGGGCTCTCTTCTGAGGTGG - Intergenic
987985121 5:25135947-25135969 CAAGTGGATCACTTGAGAGCAGG + Intergenic
988166416 5:27595928-27595950 CAAGTGGTTCTGTGAAGAGATGG + Intergenic
990683864 5:58278016-58278038 AAAGTGGCTCTCAGCAGAGAGGG - Intergenic
991164295 5:63544430-63544452 CAAGGGGGCTTCTGCAGAGCTGG + Intergenic
992205930 5:74430272-74430294 GAAGTGGCTCTCAGTAGAGAGGG - Intergenic
994884990 5:105549058-105549080 GAAGTAGCTCTCTGCAGATGGGG + Intergenic
995131014 5:108630596-108630618 CGAGGGACCCTCTGCAGAGCTGG + Intergenic
995206637 5:109487982-109488004 CAGCTGCCTCCCTGCAGAGCAGG - Intergenic
998691805 5:144595577-144595599 CAATTGGCTCTCTGTAAAACAGG + Intergenic
999586031 5:153090611-153090633 CAAGTGGGCATCTGCAGACCTGG + Intergenic
1001050324 5:168408754-168408776 CCAGGGGTTCTCTGCAGGGCTGG + Intronic
1001576147 5:172765280-172765302 CAGGTTGCTTTCTGGAGAGCAGG - Intergenic
1002916264 6:1530251-1530273 TAAGTGGATGACTGCAGAGCTGG + Intergenic
1002961835 6:1922803-1922825 GAAATGGCTCTCAGCAGAGACGG - Intronic
1003294063 6:4808109-4808131 CAAGTGCCTGACTCCAGAGCTGG - Intronic
1003360852 6:5423733-5423755 CACTTGGCACTCTGCAGCGCTGG + Intronic
1006208935 6:32376063-32376085 GAAGTGGCTCTCAGCAGATGGGG - Intergenic
1009721446 6:67475921-67475943 CACGTGGCTATCTGCAAACCAGG + Intergenic
1009871650 6:69460196-69460218 CCATTGGGTATCTGCAGAGCAGG - Intergenic
1010732366 6:79404600-79404622 AAAGTGGCTCTCAGCAGAGAGGG - Intergenic
1011180868 6:84618934-84618956 CCAGTGACTCCCTGCAGAGAAGG + Intergenic
1014107409 6:117582680-117582702 AAAGTGGCTCTCAGCAGAGAGGG - Intronic
1014492754 6:122082450-122082472 GAAGTAGCTCTCTGCTGAGGGGG + Intergenic
1015194096 6:130506448-130506470 CAGGTGGCTGTCTGCAAACCAGG + Intergenic
1015387023 6:132635727-132635749 TAAGCTGCTCTCTTCAGAGCTGG - Intergenic
1018654770 6:166024750-166024772 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
1018805844 6:167258874-167258896 CCAGCTGCTCTCTTCAGAGCAGG - Intergenic
1018831082 6:167444098-167444120 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
1019958424 7:4435850-4435872 CAAGCTGTTGTCTGCAGAGCAGG + Intergenic
1023090840 7:36616005-36616027 CAAGAAGCTCTGGGCAGAGCAGG - Intronic
1023745439 7:43318778-43318800 AAAAGGGCTCTCTGCAGAGCTGG + Intronic
1024063225 7:45714087-45714109 CAAGTGGCTCCCTGCTCTGCTGG - Exonic
1026430769 7:70344971-70344993 CAGGTGGCTGTTTGCAAAGCAGG + Intronic
1027932287 7:84552797-84552819 GAAGTAGCTCTCAGCAGATCCGG - Intergenic
1028781269 7:94739313-94739335 CCAGAGGATCTCTGCACAGCAGG + Intergenic
1028920535 7:96305908-96305930 AAAGGGGCTCTCTGCACAGCTGG + Intronic
1029235357 7:99111830-99111852 CTAGTGGCTCCCTGAAGAACTGG + Intronic
1030101798 7:105953219-105953241 GAAGTAGCTCTCTGCAGATGGGG - Intronic
1030399261 7:109028103-109028125 AAAGTGGCTCTCTGCAGCTGAGG + Intergenic
1030616629 7:111744188-111744210 CAAGTGGCTCTCTGCAGTGGAGG + Intronic
1033223470 7:139543721-139543743 CAGGAGGAGCTCTGCAGAGCTGG - Intronic
1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG + Intronic
1034099268 7:148437290-148437312 CAAGTAGCTCTCAGCAGATGGGG + Intergenic
1034179831 7:149128313-149128335 CAATTGGCTATCTGAAGACCAGG + Intronic
1036097608 8:5741314-5741336 CAAGGGGCTCCATGCAGTGCTGG + Intergenic
1037331544 8:17748317-17748339 AAAGTGGCTCTCAGCAGAGAGGG - Intronic
1037533431 8:19802299-19802321 AAAGTGGCTCTCAGTAGAGAAGG - Intergenic
1038720133 8:30027784-30027806 CAAGTTGGTTTCCGCAGAGCTGG - Intergenic
1041099052 8:54378417-54378439 CACGTGGCTGTCCACAGAGCTGG - Intergenic
1043356962 8:79425036-79425058 TAAGTGGCTCTCTGCAAGCCAGG + Intergenic
1044730832 8:95227312-95227334 CAAGTGGCTGCCTGCACTGCTGG + Intergenic
1045488004 8:102648006-102648028 CAAGTGTTTCTCTTCAGAGGTGG + Intergenic
1045568320 8:103343733-103343755 CAAGGGGCACTCTGGAGAGGTGG - Intergenic
1046990808 8:120451034-120451056 GAAGTGGTTCTTTGCAGTGCAGG + Exonic
1047707706 8:127517329-127517351 AAGGTGGCTCTCTGCAAACCAGG - Intergenic
1048384136 8:133895440-133895462 CATGTGGCTCCCAGCAGGGCTGG + Intergenic
1048641690 8:136370227-136370249 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
1048965641 8:139612564-139612586 CAAGTGGACCTCTGCTGTGCTGG - Intronic
1049509604 8:143020866-143020888 CCAGTGTGTCTCTCCAGAGCAGG + Exonic
1049811982 8:144579760-144579782 CCAGGGGCTTTCTGCAGAGGTGG - Intronic
1050058069 9:1676599-1676621 CATGTGGCTCTCTGCAGCTTAGG + Intergenic
1050479304 9:6073411-6073433 AAAGTAGCTCTCAGCAGATCGGG - Intergenic
1050745347 9:8869832-8869854 CTAGAGGCTTTCTTCAGAGCAGG - Intronic
1050900835 9:10947115-10947137 CAAATAGCTCTCAGCAGAGCGGG + Intergenic
1051745342 9:20290113-20290135 CTAGTGCCACTCTGCCGAGCTGG - Intergenic
1052660174 9:31419344-31419366 AAAGTGGCTCTCAGCAGATAGGG - Intergenic
1055135496 9:72824485-72824507 AAATTGGCTCTCAGCAGAGAGGG + Intronic
1056429832 9:86516378-86516400 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
1056758581 9:89398410-89398432 GAAGTGGCTCTCAGCGGAGATGG - Intronic
1057404910 9:94760655-94760677 CAGGAGCATCTCTGCAGAGCCGG - Intronic
1058249967 9:102681091-102681113 CAAGTGGCTCTCTTGAGCCCAGG - Intergenic
1058610317 9:106769214-106769236 CAACTAGCTCACTGCAGACCTGG - Intergenic
1058669106 9:107345697-107345719 CAAGAGGCTATCTTCAGAGCTGG - Intergenic
1060055192 9:120407121-120407143 CCAGCAGCACTCTGCAGAGCAGG - Exonic
1061014108 9:127972105-127972127 GAAGAGGCCCTCTGCACAGCCGG - Intronic
1062004162 9:134230963-134230985 TTGGTAGCTCTCTGCAGAGCTGG + Intergenic
1062061271 9:134496575-134496597 CGAGTGGCTCTCTGCTCTGCTGG + Intergenic
1062441652 9:136572403-136572425 CCAGTGCCTTTCTGCAGGGCGGG + Intergenic
1185488100 X:498416-498438 CTAATGGCTCTCTACACAGCAGG - Intergenic
1185950102 X:4423026-4423048 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
1185975401 X:4714235-4714257 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
1187535937 X:20141789-20141811 CAGGCGGATCTCTGAAGAGCTGG - Exonic
1188180600 X:27050665-27050687 AAAGTGGCTCTCAGCAGACAGGG - Intergenic
1189325649 X:40109317-40109339 CAAGTGGATCTCGGCTGCGCGGG - Intronic
1189676727 X:43468186-43468208 AAAATGGCTCTCAGCAGAGAGGG + Intergenic
1195447600 X:104971929-104971951 CAAGTGGCTCTCTGGGAAGTTGG + Intronic