ID: 951694031

View in Genome Browser
Species Human (GRCh38)
Location 3:25427419-25427441
Sequence CAGAACACACAGCTGGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1925
Summary {0: 1, 1: 4, 2: 64, 3: 336, 4: 1520}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951694027_951694031 1 Left 951694027 3:25427395-25427417 CCTGAAGAAGTTAAATACTTATC 0: 1
1: 0
2: 2
3: 20
4: 261
Right 951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG 0: 1
1: 4
2: 64
3: 336
4: 1520
951694026_951694031 27 Left 951694026 3:25427369-25427391 CCATTTTACAGATGAGGAAACTG 0: 714
1: 3520
2: 8648
3: 15140
4: 20726
Right 951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG 0: 1
1: 4
2: 64
3: 336
4: 1520
951694025_951694031 28 Left 951694025 3:25427368-25427390 CCCATTTTACAGATGAGGAAACT 0: 580
1: 3018
2: 7778
3: 13577
4: 18950
Right 951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG 0: 1
1: 4
2: 64
3: 336
4: 1520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951694031 Original CRISPR CAGAACACACAGCTGGTAAG TGG Intronic
900082070 1:865927-865949 AAGAACACACAACTGCTGAGTGG - Intergenic
900941671 1:5802449-5802471 AAGGTCACACAGCTGGTAAGTGG - Intergenic
901053690 1:6438629-6438651 TCGGTCACACAGCTGGTAAGTGG - Intronic
901185732 1:7371934-7371956 CAGATCACACAACTGGCCAGTGG + Intronic
901406881 1:9055153-9055175 AAGATCACACAGCTGGGAGGTGG - Intronic
901436205 1:9248783-9248805 CAGAACCCACAGCAGAAAAGAGG + Intronic
901741470 1:11344913-11344935 AAGTTCACACAGCTAGTAAGAGG + Intergenic
901761719 1:11476290-11476312 AAGGTCACGCAGCTGGTAAGGGG + Intergenic
901775457 1:11557460-11557482 AAGGACACACAGCTGGCAGGTGG - Intergenic
901787609 1:11635162-11635184 CAGGTCACACAGCTAGTTAGCGG - Intergenic
901792038 1:11658762-11658784 CTGAACGCACAGCTGGTACTTGG - Exonic
901904781 1:12398924-12398946 CAGGTCACACTGCTGGTCAGTGG - Intronic
902065384 1:13681455-13681477 AAGGTCACACAGCTAGTAAGTGG + Intergenic
902077802 1:13801535-13801557 AAGAACACACAGCTGGCAGGCGG - Intronic
902107258 1:14048056-14048078 CAGATCACACAGCTGGAGAGTGG - Intergenic
902207075 1:14876591-14876613 AAGGTCACAGAGCTGGTAAGGGG - Intronic
902231428 1:15030056-15030078 AAGACCACACAGCTGGTTAATGG - Intronic
902243687 1:15104891-15104913 CAAGATACACAGCTAGTAAGTGG + Intronic
902244829 1:15113968-15113990 AAGGTCACACAGCTGGGAAGTGG + Intronic
902293720 1:15451809-15451831 CAGATCACACAGCTAGCAATGGG + Intergenic
902343223 1:15798177-15798199 GAGCTCACACAGCTGGTTAGTGG - Intergenic
902343569 1:15800004-15800026 GAGCTCACACAGCTGGTTAGTGG + Intergenic
902603009 1:17552824-17552846 CAGGTCACACAGCTAGTAAATGG + Intronic
902604078 1:17559132-17559154 CAGGACACACAGCTGACAAATGG - Intronic
902651256 1:17839079-17839101 CTGGACAACCAGCTGGTAAGAGG - Intergenic
902671578 1:17978216-17978238 CAGAACACACAGCTTTCTAGTGG + Intergenic
902761625 1:18584598-18584620 AAGGTCACACAGCTGGTAAGTGG + Intergenic
902876609 1:19344275-19344297 AAGACCACACAGCTAGTAACTGG + Intronic
902936897 1:19770970-19770992 AAGGTCACACAGCTGATAAGTGG - Intronic
903037429 1:20502175-20502197 CAGACCGCACAGCTCCTAAGTGG + Exonic
903192138 1:21662799-21662821 CAGGTCACCCAGCTGGTGAGTGG - Intronic
903236186 1:21952273-21952295 AAGATCACACAGCTTGTAAGTGG + Intergenic
903272674 1:22201024-22201046 AAGGTCACACAGCTGATAAGTGG - Intergenic
903343116 1:22667197-22667219 GAGAACACGCAGCTTGTAAGTGG - Intergenic
903361890 1:22782142-22782164 CAAATCACACAGCTGGTGAGTGG - Intronic
903364821 1:22799679-22799701 CAGTCCACACAGCAAGTAAGTGG + Intronic
903385095 1:22920950-22920972 CAGGTCACACAGCCAGTAAGTGG + Intergenic
903414910 1:23175932-23175954 AAGGTCACACAGCTGGTAAGTGG + Intronic
903420654 1:23216426-23216448 GAGATCACACAGCTAGTAGGTGG + Intergenic
903450245 1:23448876-23448898 CAAGTCACACAGCTGTTAAGTGG + Intronic
903460272 1:23516089-23516111 AAGGTCACATAGCTGGTAAGTGG + Intronic
903480141 1:23647089-23647111 CAAGTCACACTGCTGGTAAGTGG - Intergenic
903592473 1:24467545-24467567 GGGATCACACAGCTAGTAAGAGG - Intronic
903798027 1:25945042-25945064 CAAATCACACAGCTAGTAAGTGG + Intergenic
903895304 1:26599230-26599252 AACAGCAGACAGCTGGTAAGTGG - Intergenic
904066754 1:27758224-27758246 CAAACCACACAGCTAGTAAATGG + Intronic
904090950 1:27944856-27944878 CAGGTCACACAGCTCCTAAGTGG + Intronic
904204106 1:28841467-28841489 CAAAACACACAGCTAAGAAGTGG - Intronic
904213308 1:28899887-28899909 GAGGTCTCACAGCTGGTAAGGGG - Intronic
904257171 1:29261218-29261240 AAGAGCACACAGCTAGTAAGTGG + Intronic
904259625 1:29280957-29280979 AAGGCCACACAGCTAGTAAGTGG + Intronic
904291640 1:29489856-29489878 AAGGACACACAGCCAGTAAGTGG - Intergenic
904320463 1:29694845-29694867 AAGGTCACACAGCTGGTGAGAGG - Intergenic
904332627 1:29772451-29772473 GAAAACACACATCTAGTAAGTGG - Intergenic
904368570 1:30034228-30034250 AAGGACACACAGCTAGGAAGGGG - Intergenic
904382152 1:30118926-30118948 AAGACCACACAGCTGGTAAATGG - Intergenic
904437267 1:30506927-30506949 AAGGTCACACAGCTGGTGAGAGG + Intergenic
904453139 1:30629495-30629517 AAGGCCACACAGCTGGTGAGGGG - Intergenic
904493600 1:30874789-30874811 AAGGACACACAGCTAGTAAGTGG + Intronic
904590422 1:31611893-31611915 AGGATCACACAGCTGGTAAGTGG + Intergenic
904680741 1:32227352-32227374 AAGATCACACAGCTAGAAAGTGG - Intronic
904772516 1:32888219-32888241 AAGGTCACATAGCTGGTAAGAGG + Intronic
904798404 1:33074932-33074954 AAGATCACACAGCTGGTAAGTGG - Intronic
904812319 1:33171432-33171454 AAGTTCACACAGCTAGTAAGAGG + Intronic
904844269 1:33397021-33397043 AATATTACACAGCTGGTAAGAGG - Intronic
904922373 1:34019026-34019048 GAGGTCACACAGCTAGTAAGAGG - Intronic
904974579 1:34445996-34446018 AAGGTCACACAGCTAGTAAGAGG - Intergenic
905109789 1:35586957-35586979 GAGATCACACAGCTGGTAGACGG - Intronic
905224533 1:36470602-36470624 AAGATCACACAGCTAGTAAGTGG + Intronic
905226329 1:36481470-36481492 AAGATCACAAAGCTGGTAAGTGG - Exonic
905241604 1:36585065-36585087 AAGACCACACAGCTGGCAGGTGG - Intergenic
905321967 1:37124218-37124240 AAGGACACACAGCTGGTAAGTGG + Intergenic
905332464 1:37215143-37215165 CAAACCACACATCTGATAAGCGG + Intergenic
905360861 1:37419411-37419433 GAGGTCACACAGCTAGTAAGTGG + Intergenic
905365839 1:37451057-37451079 AAGAACACACAGGTGGTGAGTGG - Intergenic
905451188 1:38057699-38057721 CTGGTCACACAGCTGGTAAGAGG - Intergenic
905453133 1:38069913-38069935 GAGGTCACACAGCTGGTAAATGG + Intergenic
905538692 1:38743366-38743388 AAGATCACACAGCTAATAAGTGG + Intergenic
905648980 1:39644034-39644056 AAGATCACACAGCTACTAAGTGG + Intergenic
905717937 1:40169208-40169230 AGGATCACACAGCTGGCAAGTGG + Intronic
905738553 1:40349430-40349452 CAAGTCACACAGCTAGTAAGTGG + Intronic
905871090 1:41405008-41405030 CAGAAATGACAGCTGGAAAGTGG + Intergenic
905891464 1:41521079-41521101 AAGAGCCCACAGCTGGCAAGTGG - Intronic
906059236 1:42937578-42937600 AAGGACACACAGCTAGTAAGTGG - Intronic
906141486 1:43536428-43536450 CAGAAGCCACACCTGGAAAGAGG - Intronic
906144741 1:43553218-43553240 CATATGACACAGCTGGTAAGTGG - Intronic
906200871 1:43959421-43959443 CAGATCAAGCAGCTTGTAAGTGG - Intronic
906582681 1:46949238-46949260 CAGAATCCCCAGTTGGTAAGAGG + Intergenic
906616472 1:47236058-47236080 GAGAACACCCAGCAGGTAAGTGG + Intergenic
906798998 1:48719835-48719857 GAGGTCACAGAGCTGGTAAGCGG + Intronic
906928251 1:50142163-50142185 CAGATCACACAGCTAATAAGTGG + Intronic
906928387 1:50143614-50143636 AAGGTCACACAGCTAGTAAGTGG + Intronic
906929804 1:50158279-50158301 AAGATCACACAGCTTCTAAGTGG + Intronic
906947168 1:50304813-50304835 AAGGCCATACAGCTGGTAAGTGG + Intergenic
907048550 1:51314761-51314783 CAGGTCACACAGCTGGTAGCTGG - Intronic
907073214 1:51556055-51556077 GAGATCACACAGCTAGTATGTGG - Intergenic
907107080 1:51893114-51893136 AAGGACACACAGCTAGCAAGTGG + Intergenic
907124335 1:52035911-52035933 AAGAGCACACAGCTAGCAAGTGG - Intronic
907217482 1:52877547-52877569 TAGATCACACAGCTACTAAGTGG + Intronic
907251642 1:53143418-53143440 GAGGTCACACAGCTAGTAAGTGG - Intergenic
907473941 1:54692919-54692941 CAGGTCACACAGGTGGCAAGTGG - Intronic
907474453 1:54696218-54696240 AAGACCGCACAGCTTGTAAGTGG + Intronic
907491076 1:54809210-54809232 CAGAGTGCACAGCTGCTAAGTGG + Intronic
907560725 1:55385181-55385203 AAGGTCACACAGCTGGTAAGTGG - Intergenic
907695723 1:56726425-56726447 GAGGCCACACAGCTAGTAAGAGG + Intronic
907733707 1:57091666-57091688 AAGGTCACATAGCTGGTAAGTGG - Intronic
907737264 1:57126554-57126576 GAGAACACTGAGCTGCTAAGAGG + Intronic
907745135 1:57205710-57205732 AAGATCACACAGCTAGTAAGTGG + Intronic
907919735 1:58901418-58901440 AAGATCACACAGCTCATAAGTGG + Intergenic
907936621 1:59047537-59047559 CAGATCACACAGCTAGTCAGTGG + Intergenic
908112997 1:60915681-60915703 CAGTTCACACAGGTGGTAGGAGG - Intronic
908122066 1:60995243-60995265 AAGGACACACAGCAAGTAAGTGG - Intronic
908122419 1:60998721-60998743 AAGACCACACAACTAGTAAGAGG + Intronic
908170951 1:61504194-61504216 GAGTTCACACAGCTGTTAAGTGG + Intergenic
908398215 1:63745772-63745794 GAGAGCACACAGCTAGTAGGAGG - Intergenic
908443224 1:64176518-64176540 GGGGTCACACAGCTGGTAAGTGG + Intronic
908597114 1:65700124-65700146 AAGATCACACAGCTAGTAAATGG + Intergenic
908767192 1:67564798-67564820 AAGGTCACACAGCTAGTAAGTGG + Intergenic
908879953 1:68720178-68720200 AAGATCATACAGCTGGTAAGTGG + Intergenic
909321431 1:74291560-74291582 TAGGTCACACAGCTAGTAAGTGG + Intronic
909701613 1:78530853-78530875 AAGTTCACACTGCTGGTAAGTGG - Intronic
909945271 1:81656447-81656469 CAGATCACAGAGCTAGTTAGTGG - Intronic
909971533 1:81996820-81996842 AAGGTCTCACAGCTGGTAAGTGG + Intergenic
910440403 1:87246085-87246107 AAGGTCACCCAGCTGGTAAGTGG - Intergenic
910489572 1:87754097-87754119 AAGGACACACATCTGGTAAGTGG + Intergenic
910578572 1:88795658-88795680 CAGGCCACACAGCTAGAAAGTGG + Intronic
910800583 1:91141436-91141458 AAGATCACACAGTTAGTAAGGGG + Intergenic
910865465 1:91784440-91784462 CTGCACACTCAGCTGGTGAGTGG - Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911328035 1:96492374-96492396 GAGATCACACAGCTAGTACGTGG + Intergenic
911377436 1:97068281-97068303 CACACCACACTGCTGGTAAATGG - Intergenic
911583400 1:99661574-99661596 CAAGACACAGAGCTAGTAAGTGG + Intronic
911991886 1:104708538-104708560 CAAACCACACATCTGATAAGAGG - Intergenic
912195022 1:107387693-107387715 AGAAACACACTGCTGGTAAGTGG - Intronic
912214757 1:107596234-107596256 CAGAACATTCAGCTGGACAGAGG - Exonic
912327216 1:108778505-108778527 CAAATCACACAGGTAGTAAGAGG - Intronic
912410402 1:109477202-109477224 GAGATCACACAGCAAGTAAGGGG - Intronic
912501554 1:110125913-110125935 CCTCACACACAGCTGCTAAGTGG - Intergenic
912705607 1:111909747-111909769 GAGACCACACAGCTGTTAACTGG - Intronic
912859133 1:113197513-113197535 CAAGTCACAGAGCTGGTAAGTGG - Intergenic
913047586 1:115087668-115087690 AAGATCACACAGCTAGTGAGTGG - Intronic
913187600 1:116383539-116383561 AAGGATACACTGCTGGTAAGTGG + Intronic
913229146 1:116727042-116727064 AAGGTCACACAGCTTGTAAGAGG + Intergenic
913348718 1:117833874-117833896 AAAAATACACAGCTGGAAAGTGG + Intergenic
913975861 1:143454523-143454545 CAAACCACACATCTGATAAGGGG + Intergenic
914070256 1:144280142-144280164 CAAACCACACATCTGATAAGGGG + Intergenic
914108899 1:144686212-144686234 CAAACCACACATCTGATAAGGGG - Intergenic
914389849 1:147210149-147210171 GAGATCACAGAGCTAGTAAGTGG + Intronic
914406551 1:147379946-147379968 AAGAGCACACAACTAGTAAGTGG - Intergenic
915071033 1:153267349-153267371 CAAACCATACATCTGGTAAGTGG - Intergenic
915161828 1:153925747-153925769 CAAATCACACAACTGGTAAGAGG - Intergenic
915276044 1:154788912-154788934 AAGGTCACACAGCTGGTAAGTGG + Intronic
915300886 1:154951032-154951054 AAGGTCACACTGCTGGTAAGGGG - Intronic
915320534 1:155053686-155053708 CAGGTCACACAGCTAGTATGTGG + Intronic
915523289 1:156461041-156461063 AAGACCACACAGCTGGTAAGGGG + Intergenic
915548887 1:156620307-156620329 GAGGTCACACAGCTAGTAAGAGG - Intronic
915593858 1:156885392-156885414 AATGTCACACAGCTGGTAAGTGG - Intergenic
915838150 1:159194491-159194513 AATATCACACAGCTAGTAAGTGG - Intronic
915956608 1:160225438-160225460 AAGATCACAAAGCTGGTAAGTGG + Intronic
916002576 1:160631258-160631280 CAGATCACACAGCTGGTTTGTGG - Intronic
916385391 1:164261736-164261758 CAGATCACACATCTAGGAAGTGG - Intergenic
916642100 1:166741262-166741284 CAGAAAACACAGCAGGTTGGTGG + Intergenic
916715559 1:167444053-167444075 AAAACCACACAGCTAGTAAGTGG - Intronic
916722302 1:167493612-167493634 AAGATCACACAGCTGGAATGTGG + Intronic
916748699 1:167704377-167704399 TAGGTCACACAGCTAGTAAGTGG - Intronic
916782187 1:168046132-168046154 GAAAAAACACTGCTGGTAAGTGG - Intronic
916938368 1:169655031-169655053 AAGATCATACAGCTGATAAGTGG - Intergenic
917084104 1:171288411-171288433 AAGGTCACACAGCTAGTAAGTGG - Intergenic
917261593 1:173175218-173175240 CAGAGGATACAGCTGATAAGTGG + Intergenic
917957450 1:180115096-180115118 CAGAACACAAAGTTGCTCAGTGG - Intergenic
917990116 1:180366964-180366986 GAGGACACAAAGCTAGTAAGTGG - Intronic
917994927 1:180426857-180426879 AAGATCACACAGCTAGTAAGTGG + Intronic
918470068 1:184862481-184862503 CAAAACAAAAACCTGGTAAGAGG - Intronic
919011084 1:191964102-191964124 CAGATTTCACAGCTGCTAAGTGG - Intergenic
919151764 1:193710144-193710166 AAGATCACACAGCTGGGCAGAGG + Intergenic
919982069 1:202648004-202648026 AAGGTCACACAGCTGCTAAGTGG - Intronic
920032823 1:203047800-203047822 AAGGTCACACAGGTGGTAAGAGG + Intronic
920246016 1:204588281-204588303 GAGATCACACAGCTAGTAAGTGG + Intergenic
920270522 1:204759866-204759888 AAGATCACACACCTGGTAAGGGG - Intergenic
920394366 1:205632913-205632935 CAGGTCACACAGCTAGTAAATGG - Intergenic
920404472 1:205698673-205698695 CAGAACACACAGCTAAAAAGTGG + Intergenic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
920655919 1:207874670-207874692 CAGATCACACAGCTAGCCAGTGG - Intergenic
920691194 1:208147681-208147703 AAGATCACACAGCTGGAGAGTGG + Intronic
920733725 1:208512499-208512521 CTGGTCTCACAGCTGGTAAGTGG + Intergenic
920773847 1:208916231-208916253 AAGATCACACAGCTAATAAGTGG - Intergenic
920821794 1:209388411-209388433 CAGAACACACACCTAATAAGTGG - Intergenic
920939896 1:210472354-210472376 CAGATCACACAGCAAGTGAGTGG + Intronic
921106976 1:211991313-211991335 CAGATCACAGAGTTGGTAGGTGG - Intronic
921138047 1:212280154-212280176 CAAACCACATATCTGGTAAGGGG - Intergenic
921257509 1:213355875-213355897 AAGATTACACAGCTAGTAAGTGG - Intergenic
921318245 1:213912607-213912629 CAGGTCACCCAGCTAGTAAGTGG + Intergenic
921338806 1:214113889-214113911 AAAGACAAACAGCTGGTAAGTGG + Intergenic
921382448 1:214538322-214538344 CAGCTCTCACAGCTAGTAAGTGG - Intronic
921400714 1:214720509-214720531 CACATCACACAGCTAATAAGAGG - Intergenic
921562146 1:216671624-216671646 AAGGTCTCACAGCTGGTAAGTGG + Intronic
921957709 1:221001238-221001260 CAGACCACACGGCTACTAAGTGG + Intergenic
922055103 1:222034817-222034839 AAGATCACACAGCTTGTGAGAGG - Intergenic
922237321 1:223731817-223731839 CAGAACACAGAGCTGCTACGGGG - Intronic
922240052 1:223749518-223749540 CAGGCCACACAGCTGGTAAGAGG - Intronic
922248582 1:223825327-223825349 CAGGTCACACAGCTATTAAGTGG + Intronic
922724467 1:227915943-227915965 CAGGACACACAGGTGGCCAGAGG - Intergenic
922815787 1:228447872-228447894 CAAACCAAACATCTGGTAAGGGG - Intergenic
923711473 1:236390912-236390934 AAGAGCACACAGGTGGTAAGTGG - Intronic
924176027 1:241391820-241391842 AAAGACATACAGCTGGTAAGTGG + Intergenic
924197665 1:241624858-241624880 AAGATCACACAGCTGGTAAGTGG - Intronic
924375532 1:243403991-243404013 TAGGGCACACAGCTGCTAAGTGG + Intronic
924464285 1:244286008-244286030 CAGATCACACAGCTAGTGAGTGG + Intergenic
924651220 1:245929100-245929122 AAGGACATACAGCTAGTAAGTGG + Intronic
924721713 1:246629181-246629203 AGGGCCACACAGCTGGTAAGTGG + Intronic
924919913 1:248618081-248618103 CAGAACACTGAGCTGGTGAGTGG + Intergenic
1062929828 10:1345366-1345388 CCGGACACCCAGCTGGCAAGAGG + Intronic
1063057111 10:2517981-2518003 CAAACCATACAGCTGATAAGGGG + Intergenic
1063082568 10:2782495-2782517 GGACACACACAGCTGGTAAGAGG + Intergenic
1063187790 10:3666249-3666271 CAAAACACACAGTTGCTAAGTGG + Intergenic
1063621554 10:7653776-7653798 AAGACGACACAGCTGGGAAGAGG - Intronic
1063636382 10:7787235-7787257 AAGACCACACGGTTGGTAAGTGG + Intronic
1063729588 10:8680804-8680826 CAGAAAACAGAGCTAGTGAGTGG + Intergenic
1063922702 10:10948092-10948114 CAGATCATACAGCTGGAAAGTGG + Intergenic
1064157167 10:12912514-12912536 CACACCACACATCTGATAAGGGG - Intronic
1064252243 10:13715452-13715474 GAGAATACACAGCCGGTAAGTGG - Intronic
1064279746 10:13940894-13940916 ATGATCACACAGCTGGTCAGTGG + Intronic
1064456929 10:15496286-15496308 AAGATCACACAGCTAGTAAGTGG - Intergenic
1064560052 10:16586949-16586971 AAGAGCCCACAGCTGGCAAGTGG - Intergenic
1065051314 10:21794932-21794954 CAGAATGCTCAGCTGGTAAATGG - Intronic
1065282311 10:24151859-24151881 AAGATCACACAGCTGGTTAGTGG + Intronic
1065420105 10:25533858-25533880 CAGGTCACATAGCTGGTAAGTGG - Intronic
1065454614 10:25893940-25893962 AAGATTACATAGCTGGTAAGTGG + Intergenic
1065567583 10:27029903-27029925 AAGGTCACACAGCTGGTAACTGG - Intronic
1065853085 10:29806810-29806832 AAGATCACACAGCTGGTGTGAGG - Intergenic
1067281220 10:44874725-44874747 CAGATCACAGAGCTCTTAAGGGG - Intergenic
1067343398 10:45421568-45421590 CAGAACACTCAGCTGACGAGGGG + Intronic
1067464875 10:46490498-46490520 CAGGACAGAGAGCTGGGAAGCGG + Intergenic
1067622314 10:47894103-47894125 CAGGACAGAGAGCTGGGAAGCGG - Intergenic
1067816867 10:49485264-49485286 CAGGTCACGCAGCTGCTAAGTGG + Intronic
1067988359 10:51179805-51179827 GAGATCACACAGCTAGTAATGGG - Intronic
1068044988 10:51875258-51875280 TAGACCATACAGCTGGTAACTGG + Intronic
1068928772 10:62567260-62567282 AAGATCACACAGCTAGTAGGTGG + Intronic
1069065745 10:63940046-63940068 TAGGACACACAGCTGCTAAGTGG - Intergenic
1069246208 10:66210247-66210269 CTCAACACACAGCTGATATGGGG + Intronic
1069382449 10:67854827-67854849 GGGATCCCACAGCTGGTAAGTGG - Intergenic
1069517915 10:69094154-69094176 AAGATCACACAGCCAGTAAGGGG + Intronic
1069828336 10:71267926-71267948 CAGATCACACAGCAGTTAGGAGG - Intronic
1069864642 10:71494460-71494482 AAGATCACACAGCTAGGAAGAGG - Intronic
1069894422 10:71671760-71671782 AAGATCTCACAGCTGGTGAGTGG - Intronic
1069899453 10:71698895-71698917 AAGGTCACACAGCTGGTAAGTGG - Intronic
1070156420 10:73838357-73838379 AAGGTCACACAGCTGGCAAGTGG - Intronic
1070335118 10:75448371-75448393 CAGAACAGACAGCAGGGCAGAGG - Intronic
1070602932 10:77878246-77878268 GAGGTCACACAGCTGGTGAGTGG - Intronic
1070730106 10:78821235-78821257 GAGGTCACACAGCTGTTAAGTGG - Intergenic
1070733647 10:78848923-78848945 CAGACCACACAGCTCCTAAATGG + Intergenic
1070754897 10:78985815-78985837 CAGGTCACACAGCAGGTCAGTGG + Intergenic
1070805355 10:79267597-79267619 AAGATCACACAGCTGCTACGTGG + Intronic
1070807977 10:79281825-79281847 CAGAACACACAGCCAGTAAAGGG + Intronic
1070853008 10:79583069-79583091 CAGGTCACACAGCCGGGAAGTGG - Intergenic
1070888072 10:79922236-79922258 CAGGTCACACAGCCGGGAAGTGG + Intergenic
1071069645 10:81676626-81676648 GAGATCACACAGCTGAAAAGTGG + Intergenic
1071352015 10:84756008-84756030 AAGATCACAGAGCTGGTAAGTGG + Intergenic
1071568409 10:86683394-86683416 AAGGTCACACAGCTAGTAAGTGG + Intronic
1071692984 10:87842299-87842321 AAGATCTCACAACTGGTAAGTGG + Intergenic
1071730985 10:88248462-88248484 AAGATCACACAGCAGGTAAGAGG + Intergenic
1071794764 10:88992080-88992102 AAGATCACACAGCTAGTAAATGG + Intronic
1071943359 10:90612869-90612891 AAGACCACACAGCTTGTAAGTGG - Intergenic
1071992974 10:91118188-91118210 CAGAGCTCACAGCTAGGAAGTGG + Intergenic
1072030183 10:91511943-91511965 AAGACCCCACAGCTAGTAAGTGG + Intronic
1072138077 10:92565937-92565959 AAGGATACACAGCTAGTAAGTGG - Intronic
1072408332 10:95176083-95176105 CAGATCACACAGCTAATAAGTGG - Intergenic
1072417347 10:95260252-95260274 AAGGTCACACAGCTAGTAAGAGG + Intronic
1072555361 10:96510648-96510670 AAGGATACACAGCTTGTAAGTGG + Intronic
1072739726 10:97902141-97902163 AAGATCACACAGCTAGTCAGTGG - Intronic
1072789361 10:98306469-98306491 CAAGCCACACAGCTAGTAAGTGG + Intergenic
1072791660 10:98322300-98322322 AAGATCACACAGCTAGTCAGTGG + Intergenic
1072905324 10:99447724-99447746 CAAATCACAAAGCTAGTAAGTGG + Intergenic
1072913113 10:99521096-99521118 AAGATCTCACAGCTAGTAAGTGG - Intergenic
1073111327 10:101064634-101064656 CAGTGCTCACACCTGGTAAGGGG + Exonic
1073442513 10:103560792-103560814 AAGGTCACATAGCTGGTAAGTGG - Intronic
1073534023 10:104258480-104258502 CAAACCACATACCTGGTAAGGGG + Intronic
1073992418 10:109277342-109277364 CCAAGCTCACAGCTGGTAAGTGG + Intergenic
1074191112 10:111138537-111138559 AAGAACACACAGCTGGTAAATGG + Intergenic
1074216606 10:111390949-111390971 TAGATCACACAGCTGGTAACTGG - Intergenic
1074232289 10:111549499-111549521 CAGGACACAGAGGTGGTCAGAGG - Intergenic
1074419138 10:113293777-113293799 AAGATCACACAGCTGGTAAGCGG - Intergenic
1074448970 10:113543667-113543689 AAGATCACACAGCTAGTAAATGG + Intergenic
1075116264 10:119629652-119629674 AAGATCACACAGCTGGTGAATGG - Intergenic
1075384473 10:122045405-122045427 AAGATCACACAGCTTGGAAGTGG - Intronic
1075394431 10:122116472-122116494 AAGGTCACACAGCTGGTAAGGGG - Intronic
1075397083 10:122135125-122135147 CAGTACACATAGCTAGTAAGTGG + Intronic
1075576762 10:123583353-123583375 AAGTTCACACAGTTGGTAAGAGG + Intergenic
1075640708 10:124062427-124062449 GAGGGCACACAGCCGGTAAGGGG - Intronic
1075777320 10:124997253-124997275 AAGGCCACAGAGCTGGTAAGCGG + Intronic
1076059227 10:127400543-127400565 AAGGACACACAGCAGATAAGCGG - Intronic
1076635311 10:131878483-131878505 CAAAACACACATCTGATAAAGGG + Intergenic
1077201011 11:1307570-1307592 CAGACCACACAGCAAGGAAGGGG + Intronic
1077497490 11:2893189-2893211 AAGGACACACAGCTAGTAAGAGG - Intronic
1077634567 11:3833576-3833598 AGGGTCACACAGCTGGTAAGAGG - Intronic
1077871570 11:6266624-6266646 AAGACCACACACCTGATAAGGGG - Intronic
1077977106 11:7258896-7258918 AGGAACACACAGCTAATAAGAGG - Intronic
1078159662 11:8829747-8829769 CAGCACACACAGCTATTTAGTGG - Intronic
1078370700 11:10742333-10742355 AAGATCACAAAGCTAGTAAGTGG - Intergenic
1078402150 11:11037924-11037946 CAGGTCACATAGCTGGTGAGTGG + Intergenic
1078409095 11:11096848-11096870 AAGGTCAAACAGCTGGTAAGTGG - Intergenic
1078492192 11:11779838-11779860 CAGAACACACAGCTAGTAAATGG + Intergenic
1078654688 11:13227326-13227348 AAGATCACACAGCTAGTAAGTGG - Intergenic
1078705410 11:13739137-13739159 ATGACCACACAGCTGGTAACTGG - Intergenic
1078725672 11:13928779-13928801 AAAGTCACACAGCTGGTAAGTGG + Intergenic
1078735937 11:14020803-14020825 GAGGTCACACAGCTGGTAAATGG - Intronic
1078783347 11:14461584-14461606 CAGATCACACAACTGATAAGTGG + Intronic
1079043067 11:17076889-17076911 CAAATCACACAGCTGTCAAGTGG - Intronic
1079091337 11:17482361-17482383 AAGGTCACACAGCTGGTCAGGGG - Intergenic
1079148389 11:17875079-17875101 CAGGTTACACAGCTTGTAAGTGG + Intronic
1079153838 11:17925858-17925880 AAGATCACACAGCTGGTAAATGG - Intronic
1079158023 11:17966992-17967014 AAGATCACATAGCTAGTAAGTGG + Intronic
1079202019 11:18384506-18384528 CAGGCCACACAGCGGGAAAGTGG - Intergenic
1079292047 11:19197061-19197083 CAGATCACACAGCTTCGAAGAGG - Intronic
1079335546 11:19567508-19567530 CAGGTCACACAACTAGTAAGTGG + Intronic
1079370874 11:19851192-19851214 AAGGTCACACAGCTAGTAAGTGG + Intronic
1079479656 11:20865941-20865963 AAGAGCACACAGCTAGGAAGTGG - Intronic
1079520583 11:21321710-21321732 CAGGCCACACAGCTGATAAGTGG + Intronic
1079817808 11:25084293-25084315 CAAATCATACAGCTAGTAAGAGG + Intergenic
1080048783 11:27837114-27837136 ACTAACTCACAGCTGGTAAGTGG - Intergenic
1080104120 11:28494034-28494056 AAGGACACACAGCTAGTAAGTGG - Intergenic
1080443437 11:32315775-32315797 AAGGTCACACAGCTGGTAACTGG - Intergenic
1080545933 11:33318457-33318479 AAGGTCACACAGCTAGTAAGAGG - Intronic
1080615282 11:33940347-33940369 AAGAGCACACAACTAGTAAGTGG + Intergenic
1080684211 11:34502203-34502225 CAGGTCACATGGCTGGTAAGTGG + Intronic
1080716055 11:34801054-34801076 AAGATCACACAACAGGTAAGTGG - Intergenic
1080762812 11:35268940-35268962 CAGATCACACAGTTAGTAGGTGG - Intronic
1080819943 11:35796021-35796043 AAAATCACACAGCTAGTAAGTGG + Intronic
1080882934 11:36339647-36339669 AAACTCACACAGCTGGTAAGGGG + Intronic
1080963357 11:37186019-37186041 AAGAGCACACAGCTAGTCAGTGG + Intergenic
1081184745 11:40028597-40028619 AAGGACACAAAGCTGATAAGTGG + Intergenic
1081517618 11:43848697-43848719 AAGATCACACAACTAGTAAGTGG + Intronic
1081533107 11:43977816-43977838 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1081593708 11:44444723-44444745 CAGGTCACACAGCTGGTGAATGG - Intergenic
1081677065 11:44976312-44976334 AAGGTCACACAGCTAGTAAGAGG - Intergenic
1081699657 11:45145243-45145265 CAGATCACACAGCCAGTAACAGG + Intronic
1081702508 11:45161053-45161075 CAGAGTACCCAGTTGGTAAGGGG - Intronic
1081731366 11:45374006-45374028 CAGGGCACACAGTTGGCAAGAGG - Intergenic
1081754467 11:45534807-45534829 AAGATCACACAGCTGGGTAGTGG + Intergenic
1081862729 11:46342758-46342780 AAGGTCACCCAGCTGGTAAGTGG - Intronic
1082785164 11:57312789-57312811 GAGAACACAGGGCTGGTCAGGGG + Exonic
1082867959 11:57917057-57917079 AAAATCACACAGCTGATAAGAGG - Intergenic
1083177266 11:60958435-60958457 AAGATCACACAGCTCTTAAGAGG - Intergenic
1083252271 11:61476140-61476162 CAGGTCACACAGCTACTAAGGGG - Intronic
1083257149 11:61503546-61503568 AAGGTCACACAGCCGGTAAGGGG - Intergenic
1083483847 11:62970044-62970066 CAAAACACATATCTGGCAAGGGG + Intronic
1083489889 11:63008492-63008514 CAGAACACATAGCTCCTAAGTGG - Intronic
1083544565 11:63538745-63538767 GAGAACACTCAGCTGGAAGGAGG - Intronic
1083815796 11:65131737-65131759 CAAAAGTCACAGCTAGTAAGTGG - Intronic
1083891718 11:65598845-65598867 CAGCTCCCACAGCTAGTAAGTGG - Intronic
1083938812 11:65884227-65884249 CAAATCACACAGCTTCTAAGAGG + Intronic
1083949502 11:65946213-65946235 GAGGTCACACAGCTGGGAAGTGG - Intronic
1084028841 11:66468890-66468912 AAGGGCACACAGCTGGTAAGTGG + Exonic
1084173736 11:67412767-67412789 AAGGTCACACAGCTGGTGAGAGG - Intronic
1084198988 11:67542925-67542947 AAGTTCACATAGCTGGTAAGAGG + Intergenic
1084453029 11:69251256-69251278 GAAATCACACAGCTGGTAACAGG - Intergenic
1084473507 11:69376378-69376400 CACAACACACAGCTGCAGAGCGG + Intergenic
1084491876 11:69483337-69483359 AAAGACACACAGCTGATAAGTGG - Intergenic
1084590439 11:70086927-70086949 CTGGACACACAGCTAGTTAGTGG + Intronic
1084959539 11:72709324-72709346 CAGGTCACACAGCTAGTCAGTGG + Intronic
1085029765 11:73264009-73264031 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1085032566 11:73281623-73281645 GAGGACACTCAGCTGGTGAGGGG - Intronic
1085114053 11:73914490-73914512 CAGAGCAGGCAGCTGGCAAGTGG + Exonic
1085150151 11:74245799-74245821 AAGATCACAAAGCTAGTAAGTGG - Intronic
1085250551 11:75140791-75140813 AAGGACACACAGGTGGTACGTGG - Intronic
1085250795 11:75142378-75142400 AAGGTCACACAGTTGGTAAGAGG - Intronic
1085289834 11:75390034-75390056 GAGATCACAAAGCTTGTAAGTGG + Intergenic
1085408188 11:76276534-76276556 AAGATCACACAGCTGGCAAGTGG + Intergenic
1085426044 11:76405491-76405513 CCTAACACACAGCTGGCAAAAGG + Exonic
1085466146 11:76724562-76724584 AAGGGCACAGAGCTGGTAAGCGG + Intergenic
1085473075 11:76770451-76770473 CAGTTCACAGAGCTAGTAAGTGG - Intergenic
1085506657 11:77064723-77064745 CAGATCACACAGCCAGTAACTGG + Intergenic
1085552891 11:77391439-77391461 AAGATCAGAAAGCTGGTAAGTGG + Intronic
1085732400 11:79010921-79010943 CAGGACCCACAGCTAGTAAGGGG - Intronic
1085775597 11:79363472-79363494 GATACCACACAGCTGGGAAGTGG - Intronic
1085777473 11:79379696-79379718 CAGACCACACAGTGAGTAAGTGG + Intronic
1085777751 11:79381820-79381842 CAGACCACACAGTGAGTAAGTGG + Intronic
1085821802 11:79801787-79801809 CAGACCACACAGCTGGTAATAGG - Intergenic
1085876915 11:80418702-80418724 GAGATCACAAACCTGGTAAGTGG - Intergenic
1085883285 11:80493393-80493415 CAAATCATACATCTGGTAAGGGG - Intergenic
1086054834 11:82634480-82634502 GAGAACGCACAGCTGGCAAGCGG + Intergenic
1086258471 11:84908949-84908971 ATGATCACACAGCTGGTAAGAGG + Intronic
1086280401 11:85179956-85179978 AAGGACACACAGCTAGTAGGTGG + Intronic
1086332126 11:85764527-85764549 GAGATCACACAGCTGGTTAGGGG + Intronic
1086369143 11:86139436-86139458 AAAAACACACAGCTGATACGTGG - Intergenic
1086421152 11:86638795-86638817 AAGATCACACTGCTAGTAAGTGG + Intronic
1086503230 11:87474749-87474771 GAGATCACAGAGCTAGTAAGTGG - Intergenic
1086670908 11:89546499-89546521 CAGATCACATAGCTAATAAGTGG - Intergenic
1086908763 11:92448052-92448074 GAGGCCACACAGCTAGTAAGGGG - Intronic
1086945229 11:92838132-92838154 AAGATCATGCAGCTGGTAAGTGG + Intronic
1087156259 11:94907827-94907849 CAGAACACACACCTGTGAAGTGG + Intergenic
1087157408 11:94918947-94918969 TAGGACACACAGCTGGTATTGGG - Intergenic
1087278314 11:96182705-96182727 AAGTCCACACAGCTAGTAAGAGG + Intronic
1087828511 11:102793676-102793698 AAGGCCACCCAGCTGGTAAGAGG + Intronic
1087857282 11:103107594-103107616 AAAAACACAGAGATGGTAAGTGG - Intergenic
1088296983 11:108309496-108309518 AAGATCACACAGCTGGTAGTAGG + Intronic
1088337438 11:108722119-108722141 AAGATCTCACAGCTAGTAAGTGG + Intronic
1088566605 11:111179118-111179140 GAGACCACACAGCTCATAAGAGG + Intergenic
1088831813 11:113543305-113543327 GAGGTCACACAGCTGGTAAGTGG + Intergenic
1088846778 11:113674926-113674948 AAGGTCACACAGCTGGTGAGGGG - Intergenic
1088991460 11:114957224-114957246 AAGAGTACCCAGCTGGTAAGAGG - Intergenic
1089160164 11:116431265-116431287 CACAACACACAGCTGTTACATGG + Intergenic
1089177104 11:116556998-116557020 CAGCTCACAAAGCTGGCAAGCGG + Intergenic
1089259251 11:117211830-117211852 CAGTTCTCACAGCTAGTAAGTGG - Intronic
1089299613 11:117490694-117490716 AAGGTCACACAGCTGGTGAGTGG + Intronic
1089311983 11:117564387-117564409 GAGAACACACAGCTCTCAAGAGG + Intronic
1089319712 11:117617163-117617185 AAAGTCACACAGCTGGTAAGGGG + Intronic
1089325719 11:117655478-117655500 AAGATCACACAGCTAGTAAACGG + Intronic
1089531417 11:119132283-119132305 GAGATCACACAGCTAGTAAGTGG + Intronic
1089744921 11:120609915-120609937 AAGATCACACAGCAGGTTAGTGG - Intronic
1089764152 11:120750907-120750929 CAGATCACACAGTGGGTTAGTGG + Intronic
1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG + Intronic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1089983442 11:122791283-122791305 AAGGCCACACAGCTGGTAAGTGG - Intronic
1090084271 11:123637431-123637453 CAAGGCACACAGATGGTAAGAGG - Intronic
1090481945 11:127076830-127076852 CAAATCACACAGCTTGAAAGAGG + Intergenic
1090505025 11:127301849-127301871 AAGAACACATAACTAGTAAGTGG + Intergenic
1090748607 11:129727021-129727043 TAGATCACATGGCTGGTAAGTGG + Intergenic
1090915020 11:131155600-131155622 AAGAACACGCAGCTGGTAAGTGG + Intergenic
1091061864 11:132471198-132471220 CAAAAAACACAGCTGGGAGGAGG + Intronic
1091258008 11:134208080-134208102 AAGGACCCACAGCTAGTAAGTGG + Intronic
1091510053 12:1113380-1113402 AGGAAAACACAGCTAGTAAGAGG + Intronic
1091589049 12:1832232-1832254 AAGATCACACAGCTGGCAGGTGG - Intronic
1091815330 12:3433528-3433550 AAGATCACACAGCTGGTAAGTGG + Intronic
1092072946 12:5648063-5648085 AGGATCACACAGCTGATAAGTGG - Intronic
1092158669 12:6302671-6302693 AAGATCACAGAGCTGGTAAATGG + Intergenic
1092262208 12:6958793-6958815 AAGACCACACAGCTGGTAAGCGG - Intronic
1092335345 12:7628335-7628357 AAGATCACACAGCTAGTAAGAGG - Intergenic
1092874563 12:12836921-12836943 CAGATCATACAGCTGGTAAAGGG + Intergenic
1093083237 12:14837912-14837934 AAGAACACATAGCTATTAAGTGG + Intronic
1093506345 12:19871275-19871297 AAGGCCACACAGCTGGTAAATGG - Intergenic
1093748912 12:22776423-22776445 TAGAAAACACATGTGGTAAGAGG + Intergenic
1093766614 12:22970594-22970616 AAGAACACAAAGCTAGTAAGAGG - Intergenic
1093768712 12:22995796-22995818 AAGATCACAAAGCTGGAAAGTGG - Intergenic
1093941988 12:25065326-25065348 AAGATCACACAACTGGTATGTGG + Intronic
1094066332 12:26364470-26364492 AAGGTCACAGAGCTGGTAAGTGG + Intronic
1094215574 12:27938244-27938266 AAGATCACACAGCTTATAAGTGG - Intergenic
1094352370 12:29541362-29541384 AAGGAAACACAGCTAGTAAGTGG - Intronic
1094355702 12:29575096-29575118 AAGATCACACAGCTAGCAAGTGG + Intronic
1094440604 12:30471670-30471692 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1094623627 12:32103218-32103240 AGAAACACACAGCTAGTAAGTGG + Intergenic
1095874587 12:47066884-47066906 AAGATCACACAGCTGGTAAATGG - Intergenic
1095950583 12:47779739-47779761 CAGGCCACACAGCAGGTGAGGGG + Intronic
1096080254 12:48828118-48828140 CAGAACACACAGCTAGTACCTGG - Exonic
1096122708 12:49098497-49098519 CAGATCACGCAGCTAGTTAGGGG - Intronic
1096165735 12:49422229-49422251 AAGAACAAAGAGCTGGTAAGTGG - Intronic
1096303664 12:50455014-50455036 GAGAACACACAGCTAGTAATTGG + Intronic
1096523532 12:52197519-52197541 CAAACCACACAGCTGGTGAGTGG - Intergenic
1096588987 12:52644709-52644731 CAGAATACACATCTGGAAAATGG + Exonic
1096869122 12:54582562-54582584 CAGATCACCCAGCTAGTCAGTGG + Intronic
1097087723 12:56480900-56480922 AAGATCACACAGCTATTAAGGGG - Intronic
1097318540 12:58200157-58200179 CAGATCACTCACCTTGTAAGGGG + Intergenic
1097390489 12:59006351-59006373 AAGATCACACAGCAGGGAAGTGG - Intergenic
1097731579 12:63134156-63134178 CCGTACACATAGCTGGCAAGAGG + Intergenic
1097796660 12:63869961-63869983 AAGATCACATAGCTGGTAAATGG + Intronic
1098029874 12:66242656-66242678 AAGAGCACACAGCTGATAAGAGG + Intronic
1098065327 12:66608707-66608729 GAGGTCACACAGCTAGTAAGTGG - Intronic
1098206235 12:68113385-68113407 CAGAACACACAGCTGGTTGGTGG + Intergenic
1098662203 12:73109592-73109614 CAGATGACAGTGCTGGTAAGGGG + Intergenic
1099164427 12:79285429-79285451 AAGATCACACAGCTAGTAAATGG + Intronic
1099168042 12:79330837-79330859 CAGATCACATAGCTAGTAAGTGG + Intronic
1099509781 12:83519402-83519424 AAGAACACAAAGCTAGTAAGTGG - Intergenic
1100300313 12:93300999-93301021 AAGGTCACACAGCTGGTCAGTGG + Intergenic
1100373759 12:93993442-93993464 GAGATCACACAGCTGGTAAGTGG - Intergenic
1100500431 12:95168854-95168876 AAGATCACAGAGCTAGTAAGTGG + Intronic
1100696364 12:97098357-97098379 CACAAGACACAGCTGGTAAATGG - Intergenic
1100708054 12:97223092-97223114 AAGGACACACAGCTTGTAAGTGG + Intergenic
1101013142 12:100471967-100471989 AAGGTCACACAGCTTGTAAGTGG + Intergenic
1101060512 12:100966379-100966401 AAGATCACAGGGCTGGTAAGAGG + Intronic
1101166756 12:102044505-102044527 AAGATCACACAGCTTGTGAGTGG - Intronic
1101170072 12:102082610-102082632 GAGATCACACAGCTAGTAAGTGG + Intronic
1101242312 12:102850644-102850666 CAGGTCACACAGCTGGTTAGTGG + Intronic
1101286019 12:103313497-103313519 CAGGTAACACAGCTGGGAAGGGG - Intronic
1101322713 12:103687257-103687279 AAGATCACACAGCTGGTAAATGG + Intronic
1101381434 12:104216683-104216705 CAAAGCACACAACTAGTAAGTGG + Intronic
1101398494 12:104368415-104368437 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1101473381 12:105020422-105020444 CAAATCACACAGCTATTAAGTGG - Exonic
1101528714 12:105555628-105555650 AAGGACACACAGCTAGGAAGTGG + Intergenic
1101631184 12:106496484-106496506 AAGGCCACACAGCTGGTAAGAGG - Intronic
1101650149 12:106669941-106669963 GAGCTCACACAGCTGCTAAGTGG - Intronic
1101671814 12:106882594-106882616 AAGATCACACAGCTGGTAAGTGG + Intronic
1101717577 12:107323987-107324009 AAGAACACACAGCTAGAAAATGG - Intronic
1101753906 12:107606157-107606179 CAAGTCACAGAGCTGGTAAGTGG - Intronic
1101776676 12:107801127-107801149 AAAAACATACAGCTGATAAGGGG + Intergenic
1101819347 12:108171759-108171781 AAGGTCACACAGCTGGTTAGAGG - Intronic
1101837968 12:108308396-108308418 CAGAAGAGAGAGCTGGGAAGGGG - Intronic
1101840486 12:108324340-108324362 AAGGTCACACAGCTGGTAAGCGG - Intronic
1101881196 12:108627231-108627253 AAAGACACACAGCTGGTGAGAGG + Intronic
1101991373 12:109488168-109488190 AAGCTCACACAGCTAGTAAGTGG + Intronic
1102019662 12:109673366-109673388 AAGATCACACAGCTGGTAAGTGG - Intergenic
1102150006 12:110682515-110682537 AAGATCACACAGCTAGAAAGTGG - Intronic
1102152422 12:110698006-110698028 AAGGCCACACAGCTGGTAAGAGG + Intronic
1102198688 12:111042515-111042537 AAGGTCACACAGCTGGTAAGTGG - Intronic
1102202412 12:111066797-111066819 AAGATCACACAGCTTGTAAAAGG - Intronic
1102224699 12:111219768-111219790 CAGATCACACAGCTAGTAAGTGG - Intronic
1102244535 12:111347271-111347293 CAGGTCACACAGCTAGTAAGTGG - Intronic
1102338907 12:112106585-112106607 GAGGTCACACAGATGGTAAGTGG - Intronic
1102454516 12:113063396-113063418 CAGTTCACACAGCTGGACAGAGG + Intronic
1102461299 12:113101446-113101468 GAGATCACACAGCTAGTAAGTGG + Intronic
1102548934 12:113676885-113676907 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1102566337 12:113799752-113799774 AAGACCACACAGCTTCTAAGTGG - Intergenic
1102639237 12:114351974-114351996 CAGATTACACAGCTGGTGTGTGG - Intergenic
1102729497 12:115095859-115095881 GAGTCCACACAGCTAGTAAGGGG + Intergenic
1102747568 12:115262978-115263000 AAGAACACAGTGCTGATAAGTGG + Intergenic
1102774073 12:115503727-115503749 AAGACCATACAGCTGCTAAGTGG + Intergenic
1102783026 12:115581926-115581948 AAGGTCACACTGCTGGTAAGTGG + Intergenic
1102829906 12:115988427-115988449 CAGGACAGACAGCAGGGAAGGGG - Intronic
1102891471 12:116561698-116561720 CAGGCCACACAGCTAGTAAGGGG - Intergenic
1102894632 12:116588789-116588811 AAGGTCACACAGCTGGTTAGAGG - Intergenic
1103038944 12:117678820-117678842 AAGACCACACAGCTGGTACAAGG - Intronic
1103208947 12:119153301-119153323 AAGGTCACACAGCTAGTAAGTGG + Intronic
1103210955 12:119166044-119166066 CAGGTCACACAGATAGTAAGTGG + Intergenic
1103214773 12:119193538-119193560 AAGACCACACAGCTAGAAAGGGG + Intronic
1103262009 12:119595542-119595564 GAGATCACACAGCTAGAAAGTGG - Intronic
1103335561 12:120186862-120186884 CAGGTCACACAGCCTGTAAGTGG + Intronic
1103356406 12:120324700-120324722 AAGATCACACAGCTTGTAAGTGG - Intronic
1103368414 12:120400091-120400113 AAGATCACACAACTAGTAAGAGG + Intergenic
1103403748 12:120660432-120660454 CAGATCACAGAGCTGGTAAGAGG - Intronic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103618543 12:122171259-122171281 AAGGCCACACAGCTGTTAAGGGG - Intronic
1103652028 12:122440421-122440443 CAGAAAACATAGCTGAGAAGGGG - Intergenic
1103928330 12:124435848-124435870 TAGGTCACACAGCTGGGAAGTGG - Intronic
1103946014 12:124526834-124526856 GAGACCACACAGCTGGGAGGTGG - Intronic
1104031431 12:125067861-125067883 CTGATCACACAGCTGGTAAGTGG - Intronic
1104070520 12:125341212-125341234 AAGATCACACAGCTAGTAAGTGG - Intronic
1104119023 12:125780204-125780226 CAAAACACTTAGCTGATAAGTGG - Intergenic
1104155166 12:126124221-126124243 AAGAACTCACTGCTAGTAAGTGG - Intergenic
1104266125 12:127234431-127234453 AAGATCACAGAGCAGGTAAGAGG - Intergenic
1104369267 12:128208599-128208621 GAGGCCACACAGCTGGGAAGTGG + Intergenic
1104412228 12:128568615-128568637 AAGGTCACACAGCTGGCAAGTGG + Intronic
1104586102 12:130049232-130049254 GAGACCACACAGCTCATAAGTGG + Intergenic
1104701179 12:130905294-130905316 CTGGGCACACAGCTGGTAAGAGG - Intergenic
1104862678 12:131932365-131932387 CAGAACACTGAGCTGGAAAGTGG - Intronic
1105638433 13:22238626-22238648 AAGATCACACAGCAAGTAAGTGG - Intergenic
1105652175 13:22391125-22391147 CAAAGCACACAGCTAGTAAATGG - Intergenic
1105687911 13:22804426-22804448 AAGATCACTCAGCTGGTAAGTGG - Intergenic
1106659252 13:31781237-31781259 CTGACCACACAGCTAGTAAGTGG - Intronic
1107351778 13:39522312-39522334 AAGATTACACAGCTAGTAAGTGG + Intronic
1107443542 13:40449519-40449541 GAGTTCACACAGCTGGTGAGTGG - Intergenic
1107446763 13:40476411-40476433 AAGATCATACAGCTGGTAAGTGG + Intergenic
1107571331 13:41661466-41661488 AAGATCACACATCTGGTAAGTGG - Intronic
1107645890 13:42493946-42493968 AAGGACACACAGCTAGTAAGTGG - Intergenic
1107646351 13:42497876-42497898 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1107875172 13:44783969-44783991 AAGAGCACATAGCTGGTAAATGG + Intergenic
1107900024 13:45002668-45002690 CAAATCACACAGCTAGTAAGTGG + Intronic
1107979831 13:45724170-45724192 CAGAAGATAGAGCTGGTGAGAGG - Intergenic
1108286854 13:48917251-48917273 AAGAACACAGAGCTGGTGAATGG + Intergenic
1108343277 13:49518690-49518712 CAGGTTACACAGCTGGTCAGTGG + Intronic
1109106581 13:58259565-58259587 CAGAACACTCAGCAGGTACTAGG + Intergenic
1110325476 13:74209615-74209637 AAGATCACACAGCTAGTAAGAGG - Intergenic
1110386470 13:74917498-74917520 CAGTTCACAGAGCTGGTAAAAGG + Intergenic
1110551505 13:76815708-76815730 CAGATCTCACAGCTGGTAATGGG + Intergenic
1110775404 13:79403676-79403698 AATATCATACAGCTGGTAAGTGG + Intronic
1111607426 13:90559444-90559466 AAGATTACACAGCTGGAAAGAGG + Intergenic
1111650946 13:91090710-91090732 CAGGTCACACAGCTGGTGAGAGG - Intergenic
1111999109 13:95193562-95193584 CAGAACACACAGCATGGGAGAGG - Intronic
1112169337 13:96953744-96953766 AAGACCACAGAGCTGGTAAATGG + Intergenic
1112228260 13:97562321-97562343 AAGATCACACAGCTAGTAGGTGG - Intergenic
1112305058 13:98266339-98266361 AAGACCACACAGCTAGTATGTGG - Intronic
1112375700 13:98838197-98838219 AAGGCCACACAGCTGGTGAGTGG - Intronic
1112527323 13:100163343-100163365 AAGATCACACAGCTACTAAGTGG - Intronic
1113626123 13:111848255-111848277 CAAACCACACATCTGATAAGTGG - Intergenic
1113831967 13:113302844-113302866 CAGGTCACACAGCTAGTGAGTGG - Intronic
1113897876 13:113777349-113777371 CAGGTCACATAGCTGGCAAGAGG - Intronic
1114169687 14:20259860-20259882 AAGGTCATACAGCTGGTAAGTGG - Intronic
1114494527 14:23123517-23123539 AAGGACACACAGCTGTTGAGTGG + Intergenic
1114513459 14:23281412-23281434 GAGATCACATAGCTGATAAGTGG - Intronic
1115223686 14:31082535-31082557 CAATACACACAGCTAGTCAGTGG - Intronic
1115773518 14:36690425-36690447 AAGATCACACTGCTTGTAAGAGG + Intronic
1116000806 14:39240935-39240957 CAGGCCACATAGCTTGTAAGTGG - Intronic
1116055565 14:39860281-39860303 CAGGACACACATCTGAGAAGTGG + Intergenic
1116473270 14:45310032-45310054 CAGATCACACAACTAGTAAGTGG + Intergenic
1116600657 14:46918070-46918092 TAAAACACACAGCTAGTAATGGG + Intronic
1116875168 14:50104063-50104085 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1116951792 14:50885095-50885117 AAGGTCACACAGCAGGTAAGTGG + Intronic
1117111506 14:52461639-52461661 CAGAAGACAGAGCTGTGAAGAGG + Intronic
1117141351 14:52793486-52793508 CAGAACACAAGGCTTGTAAGAGG + Intergenic
1117208367 14:53469517-53469539 CAGTGCACACAGGTGGTAACCGG - Intergenic
1117590409 14:57262340-57262362 AAGATCACACAACTAGTAAGAGG + Intronic
1117972250 14:61263504-61263526 AAGGACACACAGCTAGGAAGGGG + Intronic
1118039475 14:61901437-61901459 AAGCTCAAACAGCTGGTAAGTGG + Intergenic
1118138761 14:63056764-63056786 AAGGTCACACAGCTGATAAGTGG + Intronic
1118272542 14:64356937-64356959 GAGCACACACAGCTGGCAAATGG + Intergenic
1118460605 14:65983763-65983785 AAGATCACACAGCTAGTTAGTGG - Intronic
1118506400 14:66417391-66417413 CAAACCACACATCTGATAAGGGG + Intergenic
1118595010 14:67428543-67428565 CAAGTCACACAGCTGGTACGTGG + Intergenic
1118639828 14:67782049-67782071 AAGAACACACAGCCAGTCAGTGG + Intronic
1118706995 14:68489345-68489367 GAGATCACAAAGCTAGTAAGTGG - Intronic
1118821391 14:69348454-69348476 CAGATCACACAGCTGAGAAGGGG + Intronic
1118838341 14:69492603-69492625 CAGATCACATAGCTGGGAATGGG - Intronic
1118889519 14:69896357-69896379 GAGAACACACAGCTAGAAAGTGG - Intronic
1119109892 14:71961528-71961550 AAGATCACACAGCTAGGAAGTGG + Intronic
1119114089 14:72002301-72002323 CAGATCACACAGCTTATTAGAGG + Intronic
1119167341 14:72505695-72505717 AAGGTCACACAGCTGGTAGGTGG - Intronic
1119198482 14:72735028-72735050 GATATCACACAGCTGGTAAGGGG + Intronic
1119296273 14:73535902-73535924 AAGATCATACAGCTGGGAAGTGG - Intronic
1119300460 14:73567238-73567260 AAGATCACACAGCTAGAAAGTGG - Intergenic
1119384299 14:74247600-74247622 CAGGCCCCACAGCTAGTAAGTGG + Intronic
1119391759 14:74295737-74295759 AAGATCACACAGCTAGTAACTGG + Intronic
1119408968 14:74416931-74416953 CACAGCACACAGCTGGTGAGTGG + Intronic
1119582154 14:75795144-75795166 AAGATCACACAGCTAGTCAGTGG - Intronic
1119677712 14:76568329-76568351 AAGACCACACAGCTGATAGGTGG - Intergenic
1119874881 14:78050277-78050299 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1120245819 14:82004960-82004982 AAGATCACACAGCTGGATAGTGG - Intergenic
1120609414 14:86622054-86622076 CAGAACAGAAAGGTGGTTAGAGG - Intergenic
1120643889 14:87048809-87048831 AAGTTCACACTGCTGGTAAGTGG + Intergenic
1120862282 14:89265701-89265723 AAGTATACACAGCTAGTAAGTGG + Intronic
1120954537 14:90069876-90069898 CAGACCACACAGCTATAAAGTGG + Intronic
1121041812 14:90755747-90755769 CAAATCACAGAGCTGGTAAATGG - Intronic
1121288095 14:92752190-92752212 CAGCTCACACAGCTTGTAAGTGG - Intergenic
1121421678 14:93820226-93820248 AAGGTCACACAGCTAGTAAGAGG - Intergenic
1121425446 14:93847427-93847449 AAGGACACACAGCTGCTACGTGG + Intergenic
1121658096 14:95613197-95613219 CAGGTCACAGAGCTGGTAAGAGG + Intergenic
1121945744 14:98120005-98120027 CCGAACACACAGCTAGGAAGTGG - Intergenic
1122067604 14:99184533-99184555 CAGGTCACAGGGCTGGTAAGTGG + Intronic
1122250870 14:100438860-100438882 AGGGTCACACAGCTGGTAAGAGG + Intronic
1122454292 14:101837901-101837923 CAGAATTGACAGCTGGCAAGTGG + Intronic
1122498703 14:102178962-102178984 AAGGCTACACAGCTGGTAAGTGG + Intronic
1124873363 15:33566062-33566084 AAGGTCACACGGCTGGTAAGTGG + Intronic
1124904496 15:33856121-33856143 AAGACCACACAGCTGCTAAGTGG + Intronic
1124954868 15:34353770-34353792 CAGAACACACAGCTGATGAATGG + Exonic
1124964928 15:34426281-34426303 TAAGACACACAGCTGGTGAGCGG + Intronic
1124981539 15:34572489-34572511 TAAGACACACAGCTGGTGAGCGG + Intronic
1125607777 15:40951827-40951849 TACAACCCACAGCTGGTGAGTGG + Intergenic
1125758070 15:42079124-42079146 AAGGACACACAGCTAGTAAGAGG + Intronic
1125795987 15:42404177-42404199 CAGGTCACCCCGCTGGTAAGTGG - Intronic
1125887869 15:43242181-43242203 AAGGTCACACAGCTAGTAAGAGG + Intronic
1126136099 15:45393348-45393370 AAGTTCACACAGCTAGTAAGTGG - Intronic
1126362251 15:47858647-47858669 CAGAATTCACAGCTGGTTTGGGG - Intergenic
1126581798 15:50248817-50248839 AAGGTCACACAGCTAGTAAGTGG - Intronic
1126670472 15:51111073-51111095 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1126955067 15:53924301-53924323 AAGGTCACACAGCTGGTAAATGG - Intergenic
1127045422 15:55020348-55020370 AATATCACACAGCTAGTAAGTGG - Intergenic
1127138852 15:55953357-55953379 CAGATCACACAGCTAGAAAGCGG + Intronic
1127270385 15:57395812-57395834 AAGACCATGCAGCTGGTAAGTGG + Intronic
1127622126 15:60744510-60744532 TGGGCCACACAGCTGGTAAGAGG - Intronic
1127684272 15:61326689-61326711 AAGACCACACAGCTAGGAAGTGG + Intergenic
1127960815 15:63888979-63889001 CAGGTCACACAGCTGGGGAGAGG - Intergenic
1127973128 15:63977798-63977820 AAGATCACACAGCTAGTAAGTGG + Intronic
1128112359 15:65084746-65084768 AACATCACACAGCTGGCAAGTGG - Intergenic
1128236056 15:66067965-66067987 CAGGCCACACAGCTAGTAAGTGG - Intronic
1128243426 15:66116978-66117000 AAGATCACACATCTGGAAAGTGG - Intronic
1128271510 15:66314349-66314371 AAGGTCACACACCTGGTAAGTGG + Intronic
1128314419 15:66651411-66651433 AAGATCACACAGCTGCTAAGTGG + Intronic
1128336056 15:66786422-66786444 AAGGTCACACAGCTGCTAAGTGG - Intergenic
1128391564 15:67186145-67186167 AAGCGCACACAGCTAGTAAGTGG + Intronic
1128620354 15:69143942-69143964 AAGGTCATACAGCTGGTAAGTGG + Intergenic
1128690709 15:69722845-69722867 GAGGACACACAGCTGGAAAGGGG - Intergenic
1128730726 15:70019116-70019138 AAGATCACAGAGCTGGTAAGAGG - Intergenic
1128771484 15:70285948-70285970 AAGGCCACCCAGCTGGTAAGTGG - Intergenic
1128794044 15:70451917-70451939 AGGCACACACAGCTGGTCAGCGG - Intergenic
1128943714 15:71807986-71808008 CAGGCCACACAGCTAGTGAGTGG - Intronic
1129316922 15:74750690-74750712 CAGGTCACACAGCTGGTCTGAGG - Intronic
1129607468 15:77031823-77031845 CAGGAAACACAGCAGGCAAGGGG - Intronic
1129741264 15:77990780-77990802 AAGGCCACACAGCTGGTGAGGGG - Intronic
1129844399 15:78761618-78761640 AAGGCCACACAGCTGGTGAGGGG + Intronic
1129856463 15:78828789-78828811 CAAGACACATACCTGGTAAGTGG + Intronic
1129888661 15:79056537-79056559 AAGCTCACACAGCTGGGAAGTGG - Intronic
1129909190 15:79212215-79212237 AAGGACACATGGCTGGTAAGTGG + Intergenic
1130011401 15:80155459-80155481 CAGATCTCACAGCCAGTAAGAGG + Intronic
1130181161 15:81629899-81629921 CTGAAGAAACAGCTGGGAAGAGG - Intergenic
1130202147 15:81842037-81842059 CAGCTTACACAGGTGGTAAGTGG - Intergenic
1130257399 15:82332161-82332183 AAGGCCACACAGCTGGTGAGGGG - Intergenic
1130355402 15:83125406-83125428 AAGGCCACACAGCTAGTAAGTGG - Intronic
1130393436 15:83479808-83479830 AAGATCACAGAGCTGGTAGGTGG - Intronic
1130518322 15:84643357-84643379 AAGGCCACACAGCTGGTAACAGG + Exonic
1130597546 15:85257804-85257826 AAGGCCACACAGCTGGTGAGGGG + Intergenic
1130886047 15:88093519-88093541 CAGACCACACAGCTCATAAATGG + Intronic
1130992776 15:88886497-88886519 AAGGCCACACAGCTAGTAAGAGG + Intronic
1131065796 15:89434252-89434274 CAGACCACACAGATGGGAAACGG - Intergenic
1131099331 15:89675818-89675840 AAGATCCCACAGCTGATAAGTGG + Intronic
1131196344 15:90358243-90358265 AAGGCCACACAGCTTGTAAGAGG + Intronic
1131382211 15:91973376-91973398 GAGGACACACAGCTAGTAAGGGG + Intronic
1131810228 15:96165731-96165753 AAGATCACATAGCTGCTAAGTGG - Intergenic
1132177307 15:99725882-99725904 ACGACCACACAGCTGGTAAATGG - Intronic
1132205250 15:99982013-99982035 GAGGTCACACAGCTAGTAAGTGG - Intronic
1132307689 15:100828671-100828693 CTGAACACAGAGTTGGCAAGAGG - Intergenic
1132327304 15:100982429-100982451 AAGACCACATAGCTAGTAAGTGG - Intronic
1132338881 15:101065737-101065759 CCGGGCACACAGCTGGTAGGTGG - Exonic
1132424467 15:101702990-101703012 CAGAACAGACAGTAGGTATGGGG + Intronic
1133114624 16:3570066-3570088 AAGGATACACAGCTGGGAAGTGG + Intronic
1133218346 16:4307083-4307105 AAGGTCACACAGCTTGTAAGTGG - Intergenic
1133242243 16:4421830-4421852 AAGGACACACAGCTGGTAAGTGG + Intronic
1133332435 16:4982800-4982822 AAGGTCACACAGCTTGTAAGTGG + Intronic
1133428148 16:5711330-5711352 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1133442497 16:5832395-5832417 AAGATCACACAGCTAGGAAGTGG - Intergenic
1133478795 16:6149304-6149326 AAGGACACACATCTGGTAAAGGG - Intronic
1133513985 16:6489489-6489511 GAGATCACACAGCTTCTAAGTGG + Intronic
1133599486 16:7325325-7325347 GGGAACACACAGCTGATAACTGG + Intronic
1133753260 16:8741409-8741431 AAGATCACACAGCTAGCAAGTGG - Intronic
1133769987 16:8862196-8862218 AAGACCACACAGCAGGCAAGGGG - Intronic
1133829316 16:9306994-9307016 AAGAACACACAGCAAGTAAGAGG - Intergenic
1134026558 16:10958382-10958404 AAGGTCACATAGCTGGTAAGCGG + Intronic
1134039688 16:11059084-11059106 CAGCTCACACACCTGCTAAGTGG - Intronic
1134060458 16:11196659-11196681 AAGGCCAAACAGCTGGTAAGTGG + Intergenic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134104051 16:11472582-11472604 AAGGTCACACAGCTGGGAAGTGG - Intronic
1134394297 16:13848917-13848939 AAGAACCCATAGCTAGTAAGAGG - Intergenic
1134418044 16:14061671-14061693 TAGCTCACACATCTGGTAAGTGG - Intergenic
1134418882 16:14068534-14068556 AACAACACACAGTTGGCAAGTGG - Intergenic
1134420109 16:14078962-14078984 CAGATCACACAGGTAGAAAGTGG + Intronic
1134492820 16:14708365-14708387 CAGATCACACAGCTGATAAGTGG + Intergenic
1134498201 16:14747487-14747509 CAGATCACACAGCTGATAAGTGG + Intronic
1134582373 16:15381606-15381628 CAGATCACACAGCTGATAAGTGG - Intergenic
1134615650 16:15649679-15649701 AAGACCACACAGTTAGTAAGGGG + Intronic
1134769642 16:16796286-16796308 AAGGTCACACAGCTAGTAAGAGG + Intergenic
1134784350 16:16927562-16927584 CAAATCCCACAGCTGGTAAGTGG - Intergenic
1134819536 16:17235465-17235487 AAGGTCACACAGCTGGAAAGAGG + Intronic
1134824928 16:17276791-17276813 TAGGTCACACAGCTGGGAAGTGG - Intronic
1134881854 16:17751640-17751662 GAGACCACACAGCTAGTAGGTGG - Intergenic
1134884743 16:17780605-17780627 AAGAGCACACAGCTAGTAAATGG + Intergenic
1135046538 16:19160579-19160601 AAGGTCACACAGCTAGTAAGTGG + Intronic
1135114328 16:19712553-19712575 AAGGCCACACAGCTGGCAAGAGG - Intronic
1135132356 16:19863430-19863452 AAGGTCACACAGCTGGTAAGGGG + Intronic
1135173362 16:20206455-20206477 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1135195499 16:20390802-20390824 AAGGTCACACAACTGGTAAGTGG - Intronic
1135313691 16:21425656-21425678 CAGATCACACAGCTGATAAGTGG - Intronic
1135366615 16:21857936-21857958 CAGATCACACAGCTGATAAGTGG - Intronic
1135445200 16:22513222-22513244 CAGATCACACAGCTGATAAGTGG + Intronic
1135707444 16:24686960-24686982 AAGGACACAGAGCTAGTAAGTGG - Intergenic
1135736115 16:24933079-24933101 TAGGTCACACAGCTAGTAAGGGG + Intronic
1135840799 16:25874371-25874393 CAAATCACACAGATGGTAAAGGG + Intronic
1135859626 16:26044049-26044071 CAAATCACACAGCTGGTAAGTGG + Intronic
1135868566 16:26127649-26127671 AAGATCACACAGCTCGTATGTGG - Intronic
1135877049 16:26212380-26212402 CATATCACACAGATAGTAAGTGG - Intergenic
1135928493 16:26716175-26716197 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1136006448 16:27333483-27333505 CAGGTCCCACAGCTGGTAAAAGG - Intronic
1136062267 16:27734866-27734888 AAGGTCACACAGCTGGTATGTGG - Intronic
1136109910 16:28058212-28058234 AAGGTCACACAGCTAGTAAGTGG - Intronic
1136152830 16:28363379-28363401 CAGATCACACAGCTGATAAGTGG - Exonic
1136193921 16:28637761-28637783 CAGATCACACAGCTGATAAGTGG + Exonic
1136210253 16:28751894-28751916 CAGATCACACAGCTGATAAGTGG + Exonic
1136310354 16:29404359-29404381 CAGATCACACAGCTGATAAGTGG - Intergenic
1136323803 16:29506150-29506172 CAGATCACACAGCTGATAAGTGG - Intergenic
1136340891 16:29642523-29642545 ACGGTCACACAGCTGGTAAGGGG - Intergenic
1136438488 16:30246131-30246153 CAGATCACACAGCTGATAAGTGG - Intronic
1137340834 16:47602660-47602682 CAGATCACACAGGTAGTAAGTGG - Intronic
1137345061 16:47649700-47649722 AAGAACACACAGCTGGCAAGTGG - Intronic
1137372553 16:47921815-47921837 AAGATCACACAGCTTGTTAGTGG - Intergenic
1137423881 16:48360144-48360166 AAGGTCACACAGCTGGTTAGTGG + Intronic
1137465037 16:48700086-48700108 AAGACCACACAGCTAGTAAGGGG - Intergenic
1137469017 16:48737959-48737981 AAGTCCACACAGCTGGTGAGTGG - Intergenic
1137552798 16:49452200-49452222 CAGAAATCACAGCTGGTAGGTGG + Intergenic
1137621944 16:49882020-49882042 CAGGCCACACAGCTGGCAGGTGG + Intergenic
1137711554 16:50570514-50570536 AAGGTCACACAGCTAGTAAGTGG - Intronic
1137750969 16:50860839-50860861 AAGGACACACAGCTAGGAAGTGG + Intergenic
1137767004 16:50985399-50985421 AAGGCCACACAGCTAGTAAGTGG - Intergenic
1137788995 16:51158655-51158677 CAGGTCACACTGCTGGTAGGAGG - Intergenic
1137891828 16:52171021-52171043 CCGAACACATGGTTGGTAAGAGG - Intergenic
1137935776 16:52634075-52634097 CACAAGACACTGCTGGCAAGTGG + Intergenic
1138104372 16:54279873-54279895 GAGAACACCCACCTGGTAGGTGG + Intergenic
1138121606 16:54404809-54404831 CAGTTCAGAAAGCTGGTAAGTGG + Intergenic
1138235914 16:55382434-55382456 AAGGCCACACAGCTAGTAAGTGG - Intergenic
1138390279 16:56665495-56665517 CAAACCACACAGCCAGTAAGTGG + Intronic
1138391374 16:56672355-56672377 CAAACCACACAGCCAGTAAGTGG - Intronic
1138401582 16:56749367-56749389 CAGATCACACAGCTGGCGAGTGG + Intronic
1138416693 16:56875731-56875753 CAGTGCACACAGCAGGGAAGAGG + Intronic
1138418702 16:56885913-56885935 CAGGTCACACAGCTGGCAAGTGG + Intronic
1138431946 16:56974724-56974746 AAGATCACACAGCCTGTAAGAGG + Intronic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1138497093 16:57415427-57415449 CAGGTCACACAGCTGGTCAGGGG + Intronic
1138547146 16:57726728-57726750 GAGGTCACACAGCTGGAAAGTGG + Intronic
1138652626 16:58469898-58469920 AAGAGCACACAGATGGTGAGTGG + Intronic
1138719565 16:59063532-59063554 AAGAAAACACAGCAGGTAAATGG - Intergenic
1138752595 16:59441922-59441944 AAGGACACACAGCTGGTATGTGG + Intergenic
1138876955 16:60963764-60963786 AACATCACACAGCTGGTTAGAGG + Intergenic
1139010756 16:62630804-62630826 CAGAACACACAGCAGGTAGTTGG + Intergenic
1139206828 16:65037200-65037222 GATGCCACACAGCTGGTAAGTGG - Intronic
1139317148 16:66082608-66082630 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1139323820 16:66136008-66136030 AAGATCACACAGCAAGTAAGGGG - Intergenic
1139339525 16:66259014-66259036 CAGGTCACACAGCTGGGAAGTGG + Intergenic
1139341114 16:66268554-66268576 AAAGACACACAGCTGGCAAGTGG + Intergenic
1139363698 16:66419590-66419612 CAGAACACACAGCAAGTAAGTGG + Intergenic
1139858037 16:69996746-69996768 CAGATCACACAGCTGATAAGTGG - Intergenic
1140131872 16:72169730-72169752 TTGAATACACAGCTGATAAGGGG - Intronic
1141094136 16:81150721-81150743 GAGGTCACACAGCTGGGAAGAGG - Intergenic
1141213505 16:82002703-82002725 AAAATCACACAACTGGTAAGTGG - Intronic
1141437055 16:84005887-84005909 GAGGCCACACAGCTGGTAAGTGG + Intergenic
1141530080 16:84640255-84640277 AAGCTCACACAGCTGGCAAGCGG + Intergenic
1141600557 16:85123739-85123761 CACAATTCACAGCTGGTAGGTGG - Intergenic
1141612735 16:85192279-85192301 AAGAACGCACAGCTAGCAAGGGG - Intergenic
1141715014 16:85721854-85721876 CAGACCACACAGCAGGTCAAGGG - Intronic
1141764529 16:86049743-86049765 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1141896988 16:86964580-86964602 CAGGCCACACAGCTGGTAAGTGG - Intergenic
1142612381 17:1116357-1116379 CAGGTCACACAGTTGGCAAGAGG - Intronic
1142618541 17:1151058-1151080 AAGGTCACACAGCTGGTAAGGGG - Intronic
1142783677 17:2202817-2202839 AAGGTCACACAGCTGGCAAGTGG + Intronic
1143238441 17:5423119-5423141 CAGGTCATACAGCTAGTAAGTGG + Intronic
1143720408 17:8805200-8805222 AAGGTCACACAGCTAGTAAGTGG - Intronic
1143792787 17:9311650-9311672 AAGGCCACACAGCTAGTAAGTGG - Intronic
1144028337 17:11298162-11298184 AAGATCCCACAGCTAGTAAGTGG + Intronic
1144077271 17:11730556-11730578 AAGGTCACACAGCTAGTAAGTGG - Intronic
1144311024 17:14014550-14014572 CAGTTCACACAGCTAGTCAGAGG + Intergenic
1144703688 17:17353995-17354017 CAGAAACCCCAGCTGGTGAGGGG + Intergenic
1144872115 17:18377969-18377991 CAGCAAGCACAGCTGGTGAGTGG + Exonic
1144949457 17:18986075-18986097 CAGGACCCACAGCAGGTCAGCGG + Intronic
1144969180 17:19096467-19096489 CAGGTCACACAGCTGGAAAGTGG + Intronic
1144978736 17:19155599-19155621 CAGGTCACACAGCTGGAAAGTGG - Intronic
1144989486 17:19222633-19222655 CAGGTCACACAGCTGGAAAGTGG + Intronic
1145258025 17:21338156-21338178 AAGGTTACACAGCTGGTAAGAGG - Intergenic
1145318614 17:21749850-21749872 AAGGTTACACAGCTGGTAAGAGG + Intergenic
1145860307 17:28204195-28204217 AAGATCACACAGCTAGTCAGTGG + Intergenic
1145866581 17:28245848-28245870 CAGACCACACAGCTAGTCAGTGG - Intergenic
1146061476 17:29609819-29609841 AAGGTCACACAGCTGTTAAGTGG + Intronic
1146218451 17:30997746-30997768 AAGATCACACAGCTAGTTAGTGG - Intronic
1146255789 17:31391155-31391177 TAGGCCACACAGCTGGCAAGAGG - Intergenic
1146268861 17:31471565-31471587 CAGGTCACCCAGCTGGGAAGTGG + Intronic
1146299453 17:31676830-31676852 AGGCACACACAGCTGGTGAGTGG - Intergenic
1146376808 17:32300124-32300146 AAGAAGACACAGCTAGAAAGTGG + Intronic
1146427011 17:32749979-32750001 AAGATCACATAGCTAGTAAGTGG + Intronic
1146478347 17:33181185-33181207 AAGAGCTCACAGCTGCTAAGTGG - Intronic
1146533733 17:33632083-33632105 CAGGTCACACAGCTAATAAGTGG - Intronic
1146550071 17:33772824-33772846 AAGACCACACAGCCAGTAAGTGG - Intronic
1146555508 17:33819737-33819759 AAGATCACACAGCAGGTAAGTGG - Intronic
1146559529 17:33856169-33856191 CAAGCCACCCAGCTGGTAAGAGG - Intronic
1146572533 17:33965243-33965265 CAGATCAAACAGCTGGTAAATGG + Intronic
1146633061 17:34484499-34484521 AAGGGCACACAGCTGGTGAGTGG - Intergenic
1146650774 17:34604937-34604959 AAGGTCACACAGCTGGAAAGAGG + Intronic
1146803521 17:35846210-35846232 AAGATCACACAGCTAATAAGTGG - Intronic
1146808242 17:35882550-35882572 AAGATCACGCAGCTGATAAGTGG + Intergenic
1146943144 17:36857736-36857758 CAAGGCACACAGCTGCTAAGTGG - Intergenic
1147035644 17:37678068-37678090 AAGATCTCACAGCTAGTAAGTGG + Intergenic
1147214949 17:38893622-38893644 CAGACCACACAGCTGGTGGGCGG - Intronic
1147237780 17:39070388-39070410 AAGGTCACACAGCTAGTAAGTGG - Intronic
1147321094 17:39646614-39646636 CAGAGCACACAGCTAGGAAGGGG + Intronic
1147478392 17:40735952-40735974 AAGAAAACACAGCTAGAAAGGGG + Intergenic
1147509014 17:41049393-41049415 AAGGACACACAGCCAGTAAGTGG - Intergenic
1147687015 17:42292256-42292278 CAAGTCACACAGCTAGTAAGTGG - Intronic
1147700851 17:42393854-42393876 AAGAACATACAGCTGGTAAATGG + Intergenic
1147753313 17:42750804-42750826 CAGGTCATCCAGCTGGTAAGTGG + Intergenic
1147883055 17:43666034-43666056 GAGACCACACAGCCGGTAACAGG - Intergenic
1147929291 17:43967514-43967536 AAGATCACACAGCTAGTCAGTGG - Intronic
1148082445 17:44975097-44975119 AGGATCATACAGCTGGTAAGAGG + Intergenic
1148161458 17:45452466-45452488 GAGCTCACACAGCTAGTAAGTGG - Intronic
1148231756 17:45940336-45940358 AAGGACACACAGCTTGTCAGTGG - Intronic
1148233667 17:45952941-45952963 CAGGTCACACAGCCAGTAAGAGG - Intronic
1148248895 17:46056430-46056452 AAGGCCACACAGCTAGTAAGTGG - Intronic
1148290276 17:46440913-46440935 GGGAAGACACATCTGGTAAGTGG - Intergenic
1148312444 17:46658486-46658508 GGGAAGACACATCTGGTAAGTGG - Intronic
1148427909 17:47616179-47616201 AAGATCACACAGCTAGTTAGAGG + Intronic
1148431721 17:47649076-47649098 AAGGTCACACAGCTGGTTAGTGG - Intergenic
1148475283 17:47924655-47924677 AAGATCACACAGCTAGTAAGTGG - Intronic
1148572204 17:48678932-48678954 AAGATCACACAGCTGGTAATTGG - Intergenic
1149375821 17:56042838-56042860 AAGCACACAGAACTGGTAAGAGG + Intergenic
1149403355 17:56321832-56321854 AAGATCACACAGCTGGTGAGGGG + Intronic
1149415147 17:56451579-56451601 AATAATACACAGCTTGTAAGTGG - Intronic
1149435018 17:56626395-56626417 AAGATCACACAGCTGTTAAGTGG + Intergenic
1149667283 17:58374159-58374181 AAGATTACACAGCTAGTAAGTGG + Intronic
1150323934 17:64240556-64240578 GAGGTCACACAGCTGGTGAGGGG - Intronic
1150392694 17:64799112-64799134 GAGCTCACACAGCTAGTAAGTGG - Intergenic
1150439875 17:65182461-65182483 AAGGACACACAGCTGAGAAGTGG + Intronic
1150471529 17:65441578-65441600 AAAGACACACAGCTGGTAAGGGG + Intergenic
1150624716 17:66834576-66834598 GAGGACACACAGCTGGAAAATGG - Intergenic
1150647323 17:66987188-66987210 GAGGTCACACAGCTGCTAAGTGG + Intronic
1150917227 17:69449140-69449162 AAGACTACACAGCTAGTAAGTGG - Intronic
1150958282 17:69886508-69886530 CAAATCACAGAGCTAGTAAGTGG + Intergenic
1151214776 17:72569910-72569932 CAGAGCACACAGCTATTAAATGG - Intergenic
1151300689 17:73222942-73222964 CAAAGAACACAGCTAGTAAGAGG - Intronic
1151381331 17:73727665-73727687 CAGCACTCGCAGCAGGTAAGTGG + Intergenic
1151411288 17:73931811-73931833 TAGGCCACACAGCTGGAAAGGGG - Intergenic
1151424587 17:74022648-74022670 AAGGTCACACAGCTGGGAAGAGG - Intergenic
1151499762 17:74481312-74481334 CAGAACCCCAAGCAGGTAAGGGG + Exonic
1151567114 17:74904873-74904895 AAGGCCACACAGCTGGAAAGGGG + Intergenic
1151749171 17:76027093-76027115 CAGCAGGCACAGCCGGTAAGTGG - Exonic
1151807733 17:76417024-76417046 CAGCACACACAGCTGGGGAGTGG - Intronic
1151894504 17:76970883-76970905 CAAACCACCCAGCTGGTCAGCGG - Intergenic
1151897904 17:76992766-76992788 AAGATCACACAGCTGGTCAGTGG - Intergenic
1151994645 17:77600988-77601010 GAGGCCACACAGCTGGTAAATGG + Intergenic
1152192037 17:78894251-78894273 CAGATCACACAGCTGGTAAGTGG + Intronic
1152282337 17:79392322-79392344 AGGATCACACAGCTAGTAAGTGG - Intronic
1152374989 17:79914360-79914382 GAGGTCACACAGCTGGAAAGGGG + Intergenic
1152383308 17:79953540-79953562 AAGGTCACACAGCTGGCAAGTGG + Intronic
1153189955 18:2527004-2527026 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1153244138 18:3057129-3057151 AAGACCACACAGCTAGTAAGTGG - Intergenic
1153289996 18:3491812-3491834 AAAAATACACAGCTGGTAAAGGG + Intergenic
1153331064 18:3875572-3875594 AAGGACACACAGCTAGTATGTGG - Intronic
1153660723 18:7323551-7323573 CAGAACACAGAGCTGGGGAGGGG - Intergenic
1153848312 18:9069672-9069694 GAGGCCACACAGCTGGTAAGGGG + Intergenic
1154090614 18:11357493-11357515 CAAACCACACATCTGATAAGAGG + Intergenic
1154119484 18:11640018-11640040 CAGATCACACAGCTGATAAGTGG - Intergenic
1154200179 18:12294124-12294146 GAGATCACACAGCTAGTTAGAGG + Intergenic
1154301918 18:13201659-13201681 CAGGTCACACAGCTGGTAAATGG - Intergenic
1154396224 18:13992335-13992357 AAGATCACATGGCTGGTAAGTGG - Intergenic
1155068670 18:22292827-22292849 AAGATCACACAGCTATTAAGTGG + Intergenic
1155247740 18:23925955-23925977 AAGGTCACACAGCTGGTAAGTGG - Intronic
1155315196 18:24564301-24564323 CATATTACACAGCTAGTAAGTGG + Intergenic
1155380872 18:25220510-25220532 AAGATCACACAGCCAGTAAGTGG - Intronic
1155408737 18:25518553-25518575 GAGGTCACACAGCTGGCAAGTGG - Intergenic
1155536689 18:26825893-26825915 AAGTTCCCACAGCTGGTAAGTGG + Intergenic
1155735508 18:29217777-29217799 AAGACCAAACAGCTGGTAAGAGG - Intergenic
1156039748 18:32807211-32807233 AAGATCACACAGCCAGTAAGTGG - Intergenic
1156215799 18:34996934-34996956 GAGATCACACAGCTAGTAAAGGG - Intronic
1156414311 18:36871823-36871845 CAGCAGACACAGCTGGAAATGGG + Intronic
1156521505 18:37725746-37725768 CAGGTAACACAGCTGGTAAATGG + Intergenic
1156565039 18:38177792-38177814 AAGAACACACAGCTAGTATGTGG - Intergenic
1156994122 18:43446452-43446474 AAGGTCACACAGCTGATAAGTGG - Intergenic
1157131492 18:45011780-45011802 AAGATCACACAGCTGGACAGAGG - Intronic
1157176581 18:45457771-45457793 AAGGACACACAGGTAGTAAGTGG - Intronic
1157181393 18:45501374-45501396 CAGTCCACAAAGCTGGTAAGTGG - Intronic
1157251587 18:46100415-46100437 AAGAACAAACAGATGGTTAGAGG + Intronic
1157386961 18:47265543-47265565 AAGACCACACAGCTGGTAAGTGG + Intergenic
1157428450 18:47603626-47603648 AAGAACACACAGATGATAAATGG + Intergenic
1157438823 18:47694293-47694315 CAAGATACACAGCTAGTAAGTGG - Intergenic
1157495295 18:48152950-48152972 CAAAGCACACAGCTGTTGAGTGG + Intronic
1157548153 18:48562327-48562349 CAGGTCACACAGCTACTAAGTGG + Intronic
1158224527 18:55186901-55186923 CAGAAGACACACCTGGGAATGGG + Intergenic
1158290019 18:55930431-55930453 AAGATTACTCAGCTGGTAAGTGG + Intergenic
1158356996 18:56632236-56632258 CAATATACACAACTGGTAAGTGG + Intronic
1158432814 18:57405320-57405342 TGAAACTCACAGCTGGTAAGTGG - Intergenic
1158666377 18:59436513-59436535 AAGATGACACAGCTAGTAAGCGG - Intronic
1158805573 18:60967887-60967909 CAGGACACAAAGCAGCTAAGAGG + Intergenic
1159876127 18:73813150-73813172 AAGTTCACACAGCTAGTAAGTGG - Intergenic
1160064370 18:75561475-75561497 CAGAAAAGGCAGCTTGTAAGAGG - Intergenic
1160710604 19:549380-549402 AAGACCACACAGCCGGGAAGCGG + Intronic
1160750403 19:731388-731410 CGGCTCACACAGCTGGGAAGTGG - Intronic
1161039333 19:2101668-2101690 CAGAACCCACAGTGGGAAAGCGG - Exonic
1161877524 19:6923235-6923257 AAGAAAACACAGCTAGAAAGTGG - Intronic
1162003408 19:7762633-7762655 AAGGTCACACAGCTGGTAAATGG - Intergenic
1162323462 19:9984732-9984754 AAGATCACATAGCGGGTAAGAGG + Intronic
1162847416 19:13404019-13404041 AAGATCACACAGCTGGAGAGTGG - Intronic
1162938678 19:13995165-13995187 CAGGCCACACAGCGGGGAAGTGG + Intronic
1162997036 19:14342741-14342763 CAGATCACACCGCTGGTAAGAGG + Intergenic
1163022867 19:14492849-14492871 CCAGCCACACAGCTGGTAAGTGG - Exonic
1163170309 19:15526609-15526631 TAGGTCACACAGCTTGTAAGTGG + Intronic
1163173847 19:15551064-15551086 CAGGACACACAGCTAGTAAGAGG + Intronic
1163253304 19:16139727-16139749 CAGAGGCCGCAGCTGGTAAGTGG - Intronic
1163470846 19:17496227-17496249 GAGATCACAGAGCTGGGAAGTGG - Intronic
1163708319 19:18830717-18830739 AATTTCACACAGCTGGTAAGTGG + Intergenic
1163774717 19:19211496-19211518 TTGTTCACACAGCTGGTAAGAGG - Intergenic
1164752612 19:30667951-30667973 AAGGTCACACAGCTGGTAATTGG + Intronic
1165312706 19:35038538-35038560 GAGGTCACACAGCTAGTAAGAGG + Intronic
1166019023 19:40008140-40008162 AAGGTCACACAGCTGGTAGGTGG + Intronic
1166063641 19:40343382-40343404 GAGATCACACAGCTAATAAGTGG - Intronic
1166545724 19:43634076-43634098 CAGGTCACACAGATGGCAAGTGG - Intronic
1166891813 19:45998692-45998714 CAGATCACACAGATGGTAACAGG + Intronic
1167200411 19:48061464-48061486 CAGGCCACACAGCTGGTAAGTGG + Intronic
1167634495 19:50646627-50646649 CAGAAAACACAACTGGTAGGAGG + Intronic
1168060335 19:53888534-53888556 CAAATCACACAGCTGAGAAGCGG + Intronic
1168070288 19:53946343-53946365 CTGGTCACACAGCTAGTAAGCGG + Intergenic
1168348791 19:55663959-55663981 GAGGACACACAGCTTGTACGTGG + Intronic
1168411392 19:56142327-56142349 AAGGACACAGAGCTGGTAGGAGG + Intronic
925314059 2:2907942-2907964 CAGAGGCCACAGCTGGTCAGGGG - Intergenic
925381831 2:3433533-3433555 CAGCACAAACAGCTAGTGAGTGG + Intronic
925422241 2:3722173-3722195 AAGGCCACACAGCTAGTAAGTGG + Intronic
925530775 2:4859837-4859859 CAGTTCACACAGATGATAAGTGG + Intergenic
925754004 2:7116485-7116507 CATAACACAAAGCTGGAATGGGG + Intergenic
925768151 2:7257789-7257811 CAGGACACTCTGCTGGGAAGAGG - Intergenic
925870717 2:8267557-8267579 AAGTTCACATAGCTGGTAAGTGG - Intergenic
926116932 2:10219303-10219325 CAACTCACACAGCTGGGAAGTGG + Intergenic
926142418 2:10375626-10375648 CAGGTCACACAGCTGCTAACAGG - Intronic
926249518 2:11146283-11146305 AAGGTCACACAGCTGGCAAGTGG + Intronic
926315853 2:11709004-11709026 AAGACCACACAGATGGTAAGTGG + Intronic
926473142 2:13286433-13286455 CAGAATACACAGTTGCTATGTGG - Intergenic
926561082 2:14418264-14418286 CAAATCACACAGCTAGAAAGTGG + Intergenic
926847339 2:17156379-17156401 GAGATCACACAGCTTGTAAATGG + Intergenic
926923126 2:17959133-17959155 CCAAACACACAGCTGGTAAAAGG + Intronic
927136522 2:20100578-20100600 AAGGTCACACAGCTGGTTAGTGG - Intergenic
927228175 2:20791267-20791289 AAGCTCACACAGTTGGTAAGTGG - Intronic
927248402 2:20976702-20976724 CAAGACACACAGCTGAGAAGGGG - Intergenic
927293451 2:21426804-21426826 CATATCACATAGTTGGTAAGTGG + Intergenic
927649853 2:24905849-24905871 CAGATCTCACAGTTGGTAAGTGG + Intronic
927723594 2:25403960-25403982 AAGATCACACAGCTAGTAAATGG - Intronic
928033435 2:27800386-27800408 GAGGTCACACAGCTAGTAAGTGG - Intronic
928041902 2:27886818-27886840 CAAATCACACAGCCAGTAAGTGG - Intronic
928091332 2:28376920-28376942 GAGGACACACAGGTAGTAAGGGG + Intergenic
928118231 2:28563397-28563419 CAAGTCACACAGCTGGTCAGCGG + Intronic
928239514 2:29574390-29574412 CAGCACAGACAGGTGGGAAGAGG - Intronic
928313373 2:30228793-30228815 AAGATCACACAGCCGGAAAGTGG - Intergenic
928339483 2:30429518-30429540 CAGAACACATAGCTAGTAAATGG - Intergenic
928445510 2:31330373-31330395 GAGATCACACAGCAGCTAAGTGG + Intergenic
928450233 2:31371980-31372002 CAGGCCACACAGTTGGTAAGTGG - Intronic
928906559 2:36374295-36374317 CAGCACACACAGCTAGTGATGGG - Intronic
928945543 2:36768620-36768642 CAGCCTACACAGCTGGGAAGTGG + Intronic
929316240 2:40482616-40482638 GTGGTCACACAGCTGGTAAGTGG + Intronic
929654596 2:43717720-43717742 AAGGTCACACAGGTGGTAAGTGG - Intronic
929667608 2:43845363-43845385 AAGGTCACACAGCTGGTAAGTGG - Intronic
929762746 2:44819744-44819766 AAGATCACCCAGCTGGGAAGAGG + Intergenic
929861525 2:45682360-45682382 AATAACACACTGGTGGTAAGGGG + Intronic
929966128 2:46538367-46538389 CAGATCACACAGCTGGTAAGTGG - Intronic
930044037 2:47153364-47153386 CAGTGCACCTAGCTGGTAAGTGG - Intronic
930736756 2:54787440-54787462 CAGGCCACACAGCTGGTAAGTGG - Intronic
930813305 2:55565468-55565490 CAGAGCACACGGCTGGTTAGAGG + Intronic
930854345 2:55996786-55996808 CAGGACATATAGCTGGTTAGTGG - Intergenic
931121375 2:59223966-59223988 CAGAATTCACAGATGGTAAGTGG - Intergenic
931668761 2:64628200-64628222 AAGGTCACACAGCTGGCAAGTGG - Intergenic
931707026 2:64955097-64955119 CAGATCACACAGCTGGAAAGTGG - Intergenic
931830780 2:66049071-66049093 TTGTAAACACAGCTGGTAAGAGG + Intergenic
931836168 2:66100174-66100196 AAGACCACACAGCTAGGAAGTGG + Intergenic
931909592 2:66883985-66884007 TAGAACAAACATCTGATAAGAGG - Intergenic
931983987 2:67723837-67723859 CAGATCACACAGGTAGGAAGTGG + Intergenic
932018508 2:68058552-68058574 CAGGTCACAGGGCTGGTAAGTGG + Intronic
932196136 2:69785702-69785724 CAGGTCACACAGCTAGAAAGAGG + Intronic
932479930 2:72032971-72032993 CAGGCCACACAGCTGGCAAATGG - Intergenic
932608240 2:73178223-73178245 CAGGTCACGCAGCTAGTAAGTGG - Intergenic
933014064 2:77102044-77102066 CAGCACACACAGATAGTAACTGG - Intronic
933247365 2:79990505-79990527 AACATCACACAGCTAGTAAGTGG - Intronic
933279285 2:80314958-80314980 CAGATCACACAGCTTCTAAATGG - Intronic
933299477 2:80525891-80525913 CAGATCATACAGCTAATAAGTGG - Intronic
933656292 2:84889546-84889568 AAGATCACACAGCTAGTAAGTGG - Intronic
933676488 2:85062184-85062206 AAGATCACACAGCTAGTAAGCGG - Intergenic
933750693 2:85600740-85600762 CAGGTCACACAGCTAATAAGCGG - Intronic
933981737 2:87556148-87556170 CAGACCACATAGCTGGTAGCTGG - Intergenic
934011714 2:87826190-87826212 AGGAACACACAGCTAGTAAATGG + Intergenic
934084066 2:88494731-88494753 AAGGTCACACAGCTGGGAAGTGG - Intergenic
934122767 2:88855961-88855983 AAGACCACGCAGCTGGTAAGTGG - Intergenic
934180559 2:89615501-89615523 CAAACCACACATCTGATAAGGGG + Intergenic
934290859 2:91689763-91689785 CAAACCACACATCTGATAAGGGG + Intergenic
934684780 2:96313006-96313028 AAGATCACACAGGTAGTAAGGGG - Intergenic
934721167 2:96577904-96577926 CAAATCACACAGCTGGTAAGTGG - Intergenic
935202008 2:100865409-100865431 AAGAACACATAGCAGGTAAGTGG - Intronic
935246588 2:101224198-101224220 CAGTTCACGCAGCTGGTAACTGG + Intronic
935327443 2:101949455-101949477 CAGGTCACACAGCTAGCAAGTGG + Intergenic
935902957 2:107812110-107812132 AAGAACACAGAGCTAGTAAGTGG + Intergenic
936077273 2:109409593-109409615 CAGCACTCTCAGCTGGTGAGGGG - Intronic
936089620 2:109492671-109492693 AAGATCACACAGCTAGTTAGTGG + Intronic
936100146 2:109570369-109570391 CAGAACCCACAGATGATGAGGGG - Intronic
936312099 2:111394669-111394691 CAGACCACATAGCTGGTAGCTGG + Intergenic
936945916 2:117930579-117930601 CAAAAAACACAGCTGGTAAGTGG + Intronic
937273566 2:120670543-120670565 AAGGTCACACAGCTGGTCAGCGG + Intergenic
937303178 2:120855788-120855810 GAGGTCCCACAGCTGGTAAGGGG + Intronic
937355526 2:121195981-121196003 AAGGTCACACAGCTTGTAAGTGG + Intergenic
937635522 2:124151475-124151497 AAAATCACACAACTGGTAAGTGG - Intronic
937971289 2:127551355-127551377 AAGATCACACAGCTGTTAACTGG + Intronic
938219674 2:129554604-129554626 CAGAGCACACAGCTGGAGAGAGG - Intergenic
938626100 2:133111153-133111175 CATAACACACACCACGTAAGAGG + Intronic
938678993 2:133670113-133670135 CAAGTCACAGAGCTGGTAAGGGG - Intergenic
938800991 2:134763186-134763208 AAGGACACACAGCTAGGAAGTGG + Intergenic
939597168 2:144139507-144139529 CAGATCACAGAACTAGTAAGTGG + Intronic
939642624 2:144659560-144659582 CAGATCATACAGATGCTAAGGGG + Intergenic
939820939 2:146956047-146956069 CAGAATACAAAGCTGGAAAAGGG + Intergenic
939829780 2:147057826-147057848 AACAACACACAGCTAGTAAATGG + Intergenic
939952469 2:148491050-148491072 TGGCACACACAGCTGGGAAGGGG + Intronic
940105155 2:150091274-150091296 AAGATCACACAGCTGTTAAGGGG - Intergenic
940141520 2:150496504-150496526 AGGAACACACAGCTTGTTAGTGG - Intronic
940323162 2:152398751-152398773 GAGACCACACAGCTAGTAAGTGG + Intronic
940394211 2:153168966-153168988 GAGAAAAAACAGCTGGTAGGAGG - Intergenic
940604020 2:155897216-155897238 TAGAAAACACAGATGGTGAGAGG + Intergenic
940958180 2:159752877-159752899 AAGGACACACAGCTGGTAAATGG - Intronic
941471151 2:165888937-165888959 AAGGTCACACAGCTAGTAAGTGG + Intronic
941617081 2:167733009-167733031 AAGGTTACACAGCTGGTAAGTGG + Intergenic
941746139 2:169088668-169088690 AAGGTCACCCAGCTGGTAAGTGG + Intronic
942033831 2:171991212-171991234 AAGGTCACACAGCTAGTAAGTGG + Intronic
942128840 2:172857226-172857248 AAGGTCATACAGCTGGTAAGTGG + Intronic
942205473 2:173616000-173616022 CAAGTCACACAGCAGGTAAGTGG + Intergenic
942295423 2:174512056-174512078 AAGATCACACAGCTGTAAAGTGG - Intergenic
942386136 2:175445110-175445132 AAGGTCACACAGCTGGTAAGTGG - Intergenic
942881388 2:180865383-180865405 AAGGTCACACAGCTAGTAAGTGG - Intergenic
943028303 2:182655414-182655436 CAGAATATAAGGCTGGTAAGTGG - Intergenic
943362720 2:186941855-186941877 AAGATCTCACAGCTGGTAAATGG + Intergenic
944438351 2:199715756-199715778 AAGAAAACATAGCTTGTAAGAGG + Intergenic
944540951 2:200753015-200753037 AAGGTCACACAGCTAGTAAGTGG - Intergenic
944622381 2:201529844-201529866 CAAACCATACAGCTGATAAGGGG + Intronic
944654977 2:201868362-201868384 CCGGTCACACAGCTGGTAAGAGG + Intronic
944658505 2:201900575-201900597 CAAATCACACAGTTAGTAAGTGG - Intergenic
944692127 2:202167979-202168001 AAGGTCACACAGCTAGTAAGTGG - Intronic
944836454 2:203584919-203584941 AAGGTCACACAGCTAGTAAGTGG - Intergenic
944895679 2:204161475-204161497 AAGGTCACAGAGCTGGTAAGTGG + Intergenic
944981747 2:205128513-205128535 TACATCACACAGCTAGTAAGTGG - Intronic
944987169 2:205190607-205190629 CAGGTCACACAGCTGGCCAGGGG - Intronic
945265937 2:207891449-207891471 AAGGTCACACAGCAGGTAAGGGG + Intronic
945800110 2:214418371-214418393 AAGACCATACAGCTGGAAAGAGG + Intronic
945989976 2:216387841-216387863 AAGATCAAACAGCTGGTAAGTGG - Intergenic
946019344 2:216630195-216630217 CAGAACCCAGAGCTGGTTACTGG - Intergenic
946175901 2:217921913-217921935 AAGGTCACACAGCTGATAAGTGG + Intronic
946302241 2:218831120-218831142 CAAATCACACAGCAAGTAAGTGG + Intronic
946441005 2:219695936-219695958 AAGGTCACACAGCTAGTAAGTGG + Intergenic
946522099 2:220477233-220477255 ATGATCACACAGCTAGTAAGGGG - Intergenic
946766667 2:223046920-223046942 CAGATCACACAGCTAGTACATGG - Intergenic
946960418 2:224979338-224979360 AAGATCACACAGCTAGTGAGTGG + Intronic
946994764 2:225378931-225378953 CAGCTCACACAGTTAGTAAGTGG + Intergenic
947063023 2:226188171-226188193 AAGGGCACACAGCTGTTAAGAGG - Intergenic
947285617 2:228511217-228511239 CATCACACATAGCTGGTAACTGG + Intergenic
947713342 2:232328159-232328181 CAGGACACCCAGCAGGTAAAAGG - Intronic
947802966 2:232943262-232943284 CAGAAAACTCAGCTGGTGACAGG - Intronic
947810015 2:232998287-232998309 AGGATCACACAGCTGGTAAGTGG + Intronic
947817098 2:233044927-233044949 CAAACCACACAGCTGATTAGAGG + Intergenic
947831980 2:233147922-233147944 CAGGTCACACAGCTGCTAAGTGG - Intronic
947862697 2:233373112-233373134 CAGGTCACAAAGCTGGAAAGTGG + Intronic
948185820 2:236020533-236020555 CAAGCCACACAGCTGGGAAGTGG - Intronic
948305431 2:236943884-236943906 CAGGACACACAGCTGGTTTGAGG + Intergenic
948328151 2:237142874-237142896 GAAGTCACACAGCTGGTAAGTGG - Intergenic
948337420 2:237221448-237221470 CAGGTCACACAGCTGGTAGCGGG + Intergenic
948752084 2:240138701-240138723 AAGGTCACACAGCTGGTTAGGGG - Intergenic
1168796848 20:616116-616138 AAGATCACACATCTGGTAAGTGG - Intergenic
1168852067 20:983894-983916 CAGATCCCATAGCTGGTGAGTGG + Intronic
1168967035 20:1904936-1904958 CAGAGCACACAGCCAGTAAGCGG - Intronic
1169248438 20:4042178-4042200 AAGGTCACACAGCTGGCAAGCGG - Intergenic
1169410114 20:5361644-5361666 CAAAACACACAGCTGGTGTGTGG - Intergenic
1169443765 20:5654475-5654497 GAGAAGACACAACTGGAAAGGGG - Intergenic
1169484354 20:6014256-6014278 AAGATCACACAGCTACTAAGTGG + Intronic
1169529551 20:6469768-6469790 CAAGACACACAGCTATTAAGTGG + Intergenic
1169612556 20:7398647-7398669 AAAGCCACACAGCTGGTAAGTGG - Intergenic
1170201815 20:13752298-13752320 GAAGTCACACAGCTGGTAAGTGG - Intronic
1170463734 20:16603655-16603677 AAGATCACACAGCTAGTCAGAGG + Intergenic
1170603077 20:17856389-17856411 AAGGTCACACAGCTGGTTAGAGG + Intergenic
1170714434 20:18819763-18819785 CAGAACACAGAGCTGGAAAAAGG - Intronic
1171031916 20:21684371-21684393 TGGGACACACAGCTGGTGAGTGG + Intergenic
1171070189 20:22061144-22061166 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1171213925 20:23338029-23338051 AAGATCATGCAGCTGGTAAGTGG + Intergenic
1171976252 20:31596461-31596483 CAGATCACAAAGCTGGGAGGTGG - Intergenic
1172021893 20:31920467-31920489 AAGACCACACAGCTGCTGAGTGG - Intronic
1172038045 20:32024090-32024112 AAGGTCACACAGCTGGTAAGTGG + Intronic
1172115679 20:32572178-32572200 AAGAGCACAAAGCTGGGAAGAGG - Intronic
1172121219 20:32599924-32599946 AAGGTCACACAGCTGGTGAGTGG - Intronic
1172124763 20:32618950-32618972 CAGACCACACAGCTAGGAAATGG + Intergenic
1172161535 20:32872233-32872255 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172179169 20:32990229-32990251 AAGATCACCCAGCTGGTATGAGG + Intronic
1172328632 20:34057907-34057929 AAGGTCACACAGCTAGTAAGTGG + Intronic
1172357951 20:34292698-34292720 AAGGTCACACAGCTGGCAAGTGG - Intronic
1172610028 20:36243829-36243851 AAGGTCACACAGCTGCTAAGTGG + Intronic
1172665631 20:36597591-36597613 CATACCACACAGCTTTTAAGTGG + Intronic
1172740171 20:37160376-37160398 CAGCTCAAACACCTGGTAAGAGG - Intronic
1172810178 20:37641750-37641772 TAGATAACACAGCTAGTAAGTGG - Intergenic
1172863203 20:38073423-38073445 CAGACAACACAGCTGGGAAGGGG + Intronic
1172899418 20:38323585-38323607 AAGGTCACACAGCTGGTAAGTGG - Intronic
1173260176 20:41427508-41427530 AAGGTCACACAGCTGGCAAGTGG + Intronic
1173327910 20:42050406-42050428 AAGGTCACACAGCTTGTAAGGGG + Intergenic
1173329290 20:42060946-42060968 CAGATCACATAGTTGTTAAGTGG - Intergenic
1173350330 20:42239346-42239368 CAGATCACACAGCTAGTAACTGG + Intronic
1173464649 20:43271370-43271392 GAAATCACACAGCTGGTATGTGG + Intergenic
1173476570 20:43364041-43364063 AAGATCACCCAGCTGGTCAGTGG + Intergenic
1173490822 20:43479795-43479817 AGGAACACTCGGCTGGTAAGGGG - Intergenic
1173532403 20:43780465-43780487 AAGGACACACAGCTGGAAAGTGG + Intergenic
1173736339 20:45364095-45364117 CAGGTCACACAGCTAGTAAGTGG - Intronic
1173738187 20:45376517-45376539 CAAATCACACAGGTGGTAAGAGG - Intronic
1173761360 20:45563439-45563461 CAGGCCACACAGCCGATAAGTGG - Intronic
1173810364 20:45951693-45951715 CAGGCCACACAGCAGGTGAGCGG - Intronic
1173816714 20:45993997-45994019 AAGATTACACAGCTAGTAAGTGG - Intergenic
1174058456 20:47815833-47815855 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1174170864 20:48617541-48617563 AAGAACACACAGCCAGCAAGTGG + Intergenic
1174344012 20:49916108-49916130 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1174359524 20:50019139-50019161 GAGACCACACAGCTGGTGGGTGG + Intergenic
1174375107 20:50121382-50121404 AAGGTCACACAGCTGGTAGGTGG - Intronic
1174519801 20:51120687-51120709 GAGGTCACACAGCTGGTGAGTGG + Intergenic
1174563775 20:51449720-51449742 AAGATCACACAGCTGATAAAGGG - Intronic
1174741731 20:53020894-53020916 GAGGTCACATAGCTGGTAAGTGG - Intronic
1174763125 20:53226367-53226389 CTGAGCACAGAGCAGGTAAGAGG - Intronic
1175194350 20:57232151-57232173 AAGGTCACACAGCTGGTAAGTGG - Intronic
1175460505 20:59148840-59148862 CAGAACTCACACCAGGTATGTGG - Intergenic
1175538434 20:59732282-59732304 AAGGTCACACAGCTGGTAAATGG - Intronic
1175581670 20:60104605-60104627 CACAGCAAACAGCTGGGAAGTGG + Intergenic
1175612504 20:60363554-60363576 CAGGTCACACAGCTTGTCAGTGG + Intergenic
1175681710 20:60994152-60994174 AAGGGCACACAGGTGGTAAGTGG - Intergenic
1176973901 21:15296702-15296724 GAGGTCACACAGCAGGTAAGTGG + Intergenic
1177120523 21:17132421-17132443 CAAAACACTCAGATGGGAAGTGG - Intergenic
1177244570 21:18506383-18506405 CAAAACATACATCTAGTAAGGGG - Intergenic
1177638763 21:23819411-23819433 CAGAGCACATATCTGATAAGGGG + Intergenic
1178250475 21:30999010-30999032 GAGGTCACACAGCAGGTAAGTGG - Intergenic
1178324533 21:31633036-31633058 CAGACCATACATCTGATAAGGGG - Intergenic
1178347117 21:31839647-31839669 AAGATCACTCAGCTGGTAGGTGG - Intergenic
1178353117 21:31887143-31887165 CAGAAAGCACAGCTGTTCAGGGG - Intronic
1178381357 21:32112299-32112321 AAGGACACACAGCTGGGCAGTGG - Intergenic
1178459912 21:32793593-32793615 CAGAACAGAGAGCTGGTTATTGG + Exonic
1178468528 21:32870946-32870968 CAGAGGACACAGCTGGTAAGTGG - Intergenic
1178811100 21:35882209-35882231 CAGGTCACCCAGCTGGTAAGGGG - Intronic
1178929638 21:36806245-36806267 CAACACACACAGCTGGTAAGGGG + Intronic
1179424905 21:41268253-41268275 CAGATCACACAGCTTGTATGTGG + Intronic
1180203891 21:46244952-46244974 CAGGTCACACAGCTGTTCAGAGG + Exonic
1180288538 22:10775573-10775595 CAGACCTCACAGCAGGTGAGCGG + Intergenic
1180604498 22:17046755-17046777 CACATCACACAGCTACTAAGGGG + Intergenic
1180620344 22:17157847-17157869 AAGGGCACACAGCTGGTAAGTGG - Intronic
1180627749 22:17205544-17205566 AAGGACACACAGCTGGTAAATGG - Intronic
1180654520 22:17408357-17408379 CAAATCACACAGCTAGCAAGAGG - Intronic
1181035542 22:20168240-20168262 CAGAACACAGAGCTGGGACTCGG - Intergenic
1181674543 22:24443059-24443081 CAGGTCACACAGCTAGTAAGTGG + Intergenic
1181747017 22:24962509-24962531 AAGGCCACACAGCTGGTAAGCGG - Intronic
1181769425 22:25114537-25114559 AAGATCACACAGCTGGGAAGCGG - Intronic
1181873203 22:25919354-25919376 CAGATCACACAGCTAGTAAGTGG - Intronic
1181946621 22:26522731-26522753 TAGAACAGGCAGCTGGTAAAAGG + Intergenic
1181951039 22:26554113-26554135 GAGATCACACAGATGATAAGTGG + Intronic
1181988687 22:26820349-26820371 AGGGCCACACAGCTGGTAAGAGG + Intergenic
1182030987 22:27159280-27159302 CAGAACACTCAGCGCATAAGTGG - Intergenic
1182086166 22:27562735-27562757 CAGGTCACACAGCTGATACGTGG + Intergenic
1182176638 22:28296872-28296894 CAAGTCACACAGCTAGTAAGTGG + Intronic
1182190059 22:28450400-28450422 AAGAGCACACAGCTAGTAAGTGG - Intronic
1182315613 22:29444933-29444955 AAGATCACACAGCTGGCTAGAGG + Intergenic
1182399079 22:30060585-30060607 AAGGACACGCAACTGGTAAGTGG - Intergenic
1182451597 22:30425128-30425150 CAGAACACACAGCTGCTAAGTGG - Exonic
1182568637 22:31219073-31219095 AAGAACACACAGCTATTCAGTGG - Intronic
1182671326 22:31998285-31998307 CAGTTAACACAGCTAGTAAGAGG - Intergenic
1183061571 22:35339387-35339409 AAGGACACATAGCTGGTAACTGG - Intronic
1183069675 22:35387301-35387323 AAGATCACCCAGCTAGTAAGTGG - Intronic
1183077827 22:35437950-35437972 CAGGACACACAGCAAGTTAGTGG + Intergenic
1183159488 22:36102437-36102459 AAGATCATACAGCTAGTAAGTGG + Intergenic
1183198414 22:36369123-36369145 CAGGACACACAGCTAGTCAATGG + Intronic
1183204054 22:36406297-36406319 AAGATCACAGAGCTTGTAAGTGG + Intergenic
1183310003 22:37104341-37104363 AAGATCACACAGCAGGGAAGTGG + Intronic
1183321624 22:37168483-37168505 AAGATCACACAGCTAGGAAGTGG - Intronic
1183405469 22:37628476-37628498 GAGAACACACAGCTAGAAAGTGG - Intronic
1183620389 22:38968602-38968624 GTGAACACACAGAGGGTAAGTGG + Intronic
1183716559 22:39536619-39536641 CAGGTCACACATCTGCTAAGCGG - Intergenic
1183727986 22:39600048-39600070 CAGGTCACACAGCAGATAAGTGG - Intronic
1184047636 22:41981430-41981452 AAGAACACAGAGCAGGTCAGAGG - Intronic
1184087810 22:42275720-42275742 CAGGTCACACAGCTAGGAAGAGG + Intronic
1184106979 22:42373466-42373488 AAGATCACTCAGCTGGCAAGAGG - Intergenic
1184392794 22:44214588-44214610 AAGACTACACAGCTGCTAAGGGG - Intronic
1184403896 22:44289230-44289252 AAGGCCACACAGCTGGTGAGTGG + Intronic
1184507747 22:44914358-44914380 GAGGCCACACAGCTGGGAAGCGG - Intronic
1184518754 22:44979666-44979688 GAGCACACACAGCCGGTAAATGG - Intronic
1184611142 22:45604238-45604260 AAGGACACACAGCTAGTAAGTGG - Intergenic
1184628968 22:45760755-45760777 AAGGCCACACAGCTGTTAAGTGG + Intronic
1184658274 22:45952923-45952945 CAGCAGACACAGCTGGGAGGCGG - Intronic
1184738548 22:46413268-46413290 CAGGACACACAACTGGAAACAGG + Intronic
949861034 3:8504934-8504956 AAGAGCACACAGCTAGTAAGTGG - Intronic
950127988 3:10522343-10522365 AAGATCAGACAGCTAGTAAGTGG + Intronic
950180624 3:10910709-10910731 CAAACCACACAGCTGGAAAGTGG - Intronic
950310555 3:11954209-11954231 AAGATCACACAGCTAGGAAGTGG - Intergenic
950312480 3:11970562-11970584 CACATCACACAGCTAGTGAGTGG - Intergenic
950458596 3:13107519-13107541 AAGGCCACAGAGCTGGTAAGTGG + Intergenic
950507899 3:13407021-13407043 AAGATCACGCAGCTGGTGAGTGG - Intronic
950611165 3:14127539-14127561 CAGATCACACAGCTTCTAAGAGG - Intronic
950713927 3:14834282-14834304 AAGGACACACAGCTAGTAAGTGG - Intronic
951085274 3:18505468-18505490 GATATCACACAGCTGGTAGGTGG - Intergenic
951373048 3:21876218-21876240 CAAAACACATATCTTGTAAGTGG + Intronic
951427164 3:22560980-22561002 CATAATACACAGCTGTCAAGTGG - Intergenic
951483670 3:23188451-23188473 AATAACACACATCTGGGAAGTGG - Intergenic
951527164 3:23664574-23664596 CAAACCATACAGCTAGTAAGAGG - Intergenic
951542305 3:23793565-23793587 AAGGTCAAACAGCTGGTAAGAGG - Intergenic
951645888 3:24890876-24890898 AAGATCACACAGCTGGTAAATGG - Intergenic
951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG + Intronic
951805937 3:26643506-26643528 AAGATCACACAGCTGGTGGGTGG - Intronic
951871252 3:27364984-27365006 AAGGTCCCACAGCTGGTAAGTGG + Intronic
951890022 3:27559826-27559848 CAGGTCACGCAGCTGGTGAGTGG + Intergenic
952028716 3:29115008-29115030 CAAGTCACATAGCTGGTAAGTGG + Intergenic
952083688 3:29792557-29792579 CAGGTCATACAGCTAGTAAGTGG - Intronic
952234535 3:31465051-31465073 AAGGTCACACAGCTGATAAGTGG - Intergenic
952386275 3:32843685-32843707 CAGAAAACCCAGCGGGTAACGGG - Intronic
952506954 3:34016090-34016112 CTGAACTCACAGCTGGTGAGTGG - Intergenic
952594243 3:34996571-34996593 CAAATCACACATCTGGTAAATGG - Intergenic
952650889 3:35725515-35725537 AAGAAAACACAGCTAGTAAGTGG + Intronic
952916597 3:38250379-38250401 AAGGTCACACAGCTGGAAAGAGG + Intronic
952995327 3:38875112-38875134 CAGGTCATACAGCTGATAAGTGG + Intronic
953271873 3:41453652-41453674 AAAGTCACACAGCTGGTAAGTGG + Intronic
953414305 3:42706902-42706924 AAGGCCACACAGCTGGTAAGTGG + Intronic
953419770 3:42745401-42745423 AAGGTCACACAGCTGGTGAGTGG + Intronic
953861741 3:46550168-46550190 AAGTTCACACAGATGGTAAGTGG - Intronic
953908572 3:46881104-46881126 CAGGACACACAACTGGTAAGCGG + Intronic
954066095 3:48107468-48107490 AAGATCACACAGCAGGTAACAGG - Intergenic
954259191 3:49426339-49426361 CAGCACACACACCTGCCAAGTGG - Exonic
954795439 3:53159297-53159319 CAGAGTACACAGCTAGTCAGTGG - Intronic
954840555 3:53507959-53507981 CATCAGACACAGCTGGAAAGGGG + Intronic
954937690 3:54342065-54342087 AAGAATACACAGTTGGCAAGTGG + Intronic
954985748 3:54790152-54790174 CAGATGGCACAGCTGCTAAGTGG - Intronic
955088312 3:55724488-55724510 GAGATGCCACAGCTGGTAAGGGG - Intronic
955106954 3:55907697-55907719 AAGGTCACACAGCTGGTAAGTGG - Intronic
955411601 3:58659038-58659060 AAAAACACACAACTAGTAAGTGG - Intronic
955537525 3:59940060-59940082 CAGGTCCCACAGCTGGAAAGTGG - Intronic
955640399 3:61076745-61076767 AAGACCACACAGGTGTTAAGAGG + Intronic
955746190 3:62142645-62142667 GAGAACACACAGCCTGTCAGGGG - Intronic
955777193 3:62446494-62446516 AAGGTCACACAGCTTGTAAGTGG - Intronic
955816130 3:62845359-62845381 CAAATCACACATCTGGTAAGTGG - Intronic
955919229 3:63937792-63937814 AAGATCACACAGCTGACAAGAGG - Intronic
955952315 3:64254851-64254873 AAGACCATACAACTGGTAAGTGG - Intronic
955959950 3:64330277-64330299 AAACACACACAGCTGGTAAGTGG - Intronic
955996213 3:64683467-64683489 AAGATCTCACAGCTCGTAAGTGG - Intronic
956016743 3:64891819-64891841 AAGATCCCACAGCTAGTAAGTGG - Intergenic
956100476 3:65762809-65762831 AAGGTCACACAGCTAGTAAGTGG + Intronic
956112074 3:65879816-65879838 CAAGTCACACAGCTGATAAGTGG + Intronic
956125988 3:66011362-66011384 AAGAACACACATCTGGGAAGTGG - Intronic
956332732 3:68129200-68129222 AACATCAGACAGCTGGTAAGTGG + Intronic
956730782 3:72194719-72194741 TAGATCACACAGCTGGTAGCAGG - Intergenic
957760858 3:84554295-84554317 CAGAATACATAGATCGTAAGAGG - Intergenic
957875607 3:86142010-86142032 AAGATCATACAGCTAGTAAGAGG + Intergenic
958745005 3:98123298-98123320 CAGAGCATACATCTGATAAGGGG + Intergenic
959095599 3:101952180-101952202 AAGATCTCACAGCTGGTAGGTGG + Intergenic
959606981 3:108251554-108251576 AAGGTCACACAGCTGGTATGTGG + Intergenic
959699851 3:109288527-109288549 TAGAACACAAAGGTGGAAAGAGG + Intergenic
960166995 3:114413824-114413846 AAGGTCACACAGCTGGTAAATGG + Intronic
960209388 3:114941493-114941515 CATAACAGACACCTGGTAAGCGG + Intronic
960588169 3:119340548-119340570 CACATCACACAGCTGGCAAGTGG - Intronic
960618875 3:119620504-119620526 CTGATCACACAGCTGGTAAGTGG - Intronic
960633831 3:119763057-119763079 CAAACCATACATCTGGTAAGAGG + Intronic
960677221 3:120207466-120207488 CAAACCATACATCTGGTAAGGGG - Intronic
960737906 3:120800752-120800774 AAGATCACATGGCTGGTAAGAGG + Intergenic
960959448 3:123059311-123059333 AAGGCCACACAGCTAGTAAGTGG + Intergenic
960960361 3:123066703-123066725 CAGATCACACAGCCGGTAAATGG - Intergenic
961026863 3:123565971-123565993 CAGCTCATACAGCTGGTAAATGG - Intronic
961098771 3:124180546-124180568 AAGGTCACACAGCTGATAAGTGG - Intronic
961180729 3:124875095-124875117 CAAACCACACATCTGATAAGTGG + Intronic
961217720 3:125173744-125173766 CAAAACACACATCTGATAAAGGG + Intronic
961376137 3:126467292-126467314 AAGGCCACACTGCTGGTAAGAGG - Intronic
961518564 3:127454035-127454057 AAGATCACCCAGCTGGAAAGTGG + Intergenic
961817640 3:129559486-129559508 GAGAACACACAGCTGGGAAATGG + Intronic
961818516 3:129563540-129563562 AAGATCACCCAGCTGGGAAGCGG + Intronic
962220741 3:133562772-133562794 ATGATCACACAGCTTGTAAGTGG + Intergenic
962368355 3:134800904-134800926 AAGGTCACACAGCTAGTAAGTGG + Intronic
962398859 3:135040154-135040176 GAGAACACACAGCAAGTAAGTGG - Intronic
962631968 3:137286191-137286213 AAGATCACGCAGCTGGTAAATGG - Intergenic
962829183 3:139124546-139124568 AAGGTCCCACAGCTGGTAAGTGG - Intronic
962927284 3:140006653-140006675 AATATCACACAGCTGGTAACAGG - Intronic
962947022 3:140181121-140181143 GAGATCATACAGCTAGTAAGTGG - Intronic
963004083 3:140709948-140709970 AAGGTCACACAGCTTGTAAGTGG + Intergenic
963054918 3:141178487-141178509 AAGGTCACACAGCTAGTAAGTGG + Intergenic
963065949 3:141264734-141264756 GAGGTCACATAGCTGGTAAGTGG - Intronic
963322099 3:143820171-143820193 AAGATCACACAGCTTGTAAGTGG + Intronic
963904090 3:150759621-150759643 CAAATCACACAGCTAGTAAGAGG - Intronic
964073357 3:152663239-152663261 CAGAACAAAGAGAAGGTAAGAGG + Intergenic
964159607 3:153630999-153631021 AAGGTCACACAGCTGGTAAGTGG - Intergenic
964384159 3:156129549-156129571 CAGGTCACACAGATTGTAAGGGG - Intronic
964447061 3:156770616-156770638 CAGGACACACAGCCAGAAAGTGG + Intergenic
964655364 3:159061052-159061074 GAGAACACAGAGATGGTAAAGGG - Intronic
964689442 3:159433615-159433637 CAAATCACACAGCTATTAAGTGG - Intronic
964846960 3:161054659-161054681 AAGGTCACACAGCTAGTAAGGGG - Intronic
965686277 3:171306163-171306185 GAGAACACATAGATGGAAAGAGG + Intronic
965727988 3:171739779-171739801 AAGGTCACACAGCTGGTAAGTGG + Intronic
966019710 3:175193200-175193222 AAAAACACACAACTAGTAAGTGG - Intronic
966138670 3:176730212-176730234 AAGGTCACACAGCTTGTAAGTGG + Intergenic
966310552 3:178588950-178588972 CAGGTCACACAGCTATTAAGTGG + Intronic
966508342 3:180732287-180732309 AAGATCACACAGTTAGTAAGTGG + Intronic
966650878 3:182299644-182299666 AAGCTCATACAGCTGGTAAGTGG - Intergenic
966771623 3:183509570-183509592 AAGAACACATAGTGGGTAAGAGG - Intronic
966886967 3:184382194-184382216 AAGGTCACACAGCTAGTAAGTGG + Intronic
967120135 3:186375336-186375358 CAAATCACAGAGCTGCTAAGTGG + Intergenic
967337492 3:188360815-188360837 AAGAACACACGGCTAGTAAGAGG - Intronic
967453019 3:189648655-189648677 CAAATCACAAAGCTGGTTAGTGG + Intronic
967493885 3:190121700-190121722 AAGGTCACACAGCTGGTAAACGG - Intronic
967707715 3:192671545-192671567 CAAAACACACAGCTGGTAAATGG - Intronic
967736441 3:192957551-192957573 CAGATCACACAGCTACTAAATGG - Intergenic
967833181 3:193939770-193939792 AAGATCACACAGCTAGTAAGTGG - Intergenic
967995355 3:195162156-195162178 AAGATCACGCAGCTGGTCAGTGG + Intronic
968279612 3:197466393-197466415 AAGCTCACACAGCTGGTAAGAGG - Intergenic
968487983 4:873211-873233 CACCCCACACATCTGGTAAGTGG + Intronic
969235180 4:5860502-5860524 AAGGAGACACAGCTGGGAAGTGG - Intronic
969243930 4:5920271-5920293 CAGATCTCACAGCTAGTGAGTGG - Intronic
969274001 4:6122816-6122838 GAGGTCACACAGCTAGTAAGTGG - Intronic
969426133 4:7125123-7125145 AAGAACGCACAGCTAGTGAGTGG - Intergenic
969429233 4:7144668-7144690 GAGGTCACACAGCTAGTAAGTGG + Intergenic
969565564 4:7975310-7975332 CAGCACACAGAGCTCATAAGAGG - Intronic
969578179 4:8048521-8048543 CAGGTCACACAGCTGGGAGGAGG + Intronic
969587079 4:8100340-8100362 AAGGTCACACAGCTGGGAAGTGG - Intronic
969624854 4:8297229-8297251 CAGAACACACACCAAGTATGGGG - Intronic
969855487 4:9995831-9995853 AAGGGCACACAGCTAGTAAGTGG + Intronic
969871781 4:10109204-10109226 CAGGCCACCCAGCTGTTAAGTGG + Intronic
970131338 4:12875191-12875213 GAGGTCACACAGCTAGTAAGTGG - Intergenic
970148260 4:13060024-13060046 CAAACCACACATCTGGTAGGGGG - Intergenic
970302927 4:14700735-14700757 GATCACACACAGCTGGTGAGTGG - Intergenic
970383875 4:15536686-15536708 AAGAACACACAGCTGGTGAGTGG - Intronic
970676124 4:18452317-18452339 GAGATCACACAGCTGGTGAGGGG + Intergenic
970788594 4:19829414-19829436 CAGAACCCAAGGCTGGTAAGTGG + Intergenic
970889704 4:21029248-21029270 AAGGACACACAGCTGATCAGGGG + Intronic
971007720 4:22393556-22393578 CAGATCACCCAGCAGGTAAGAGG - Intronic
971181303 4:24330742-24330764 AAAACCACACAGCTGGGAAGGGG + Intergenic
971194821 4:24462528-24462550 AAGGTCACACAGCTAGTAAGTGG - Intergenic
972180920 4:36464375-36464397 AAGGCCACATAGCTGGTAAGTGG + Intergenic
972368250 4:38395899-38395921 CAAATCACACAGCTGGAAAGTGG - Intergenic
972584249 4:40421919-40421941 AAGATCACACAGCTGGTAATAGG - Intergenic
972587167 4:40448632-40448654 GAGGAGACACAGCTAGTAAGTGG - Intronic
972629031 4:40827643-40827665 AAGGTCACACAGCTAGTAAGTGG - Intronic
972636737 4:40890945-40890967 CAGACCACACAGCTAGGAAGTGG - Intronic
972678166 4:41280160-41280182 CAAGGCACCCAGCTGGTAAGGGG - Intergenic
972820199 4:42692962-42692984 AAGATCACACAGCTAGTAACTGG + Intergenic
972886111 4:43490987-43491009 AAGGACACACAGCTGCTAAGTGG - Intergenic
973288059 4:48441536-48441558 AGGATCACACAGCTAGTAAGTGG - Intergenic
973661707 4:53114047-53114069 AAGGTCACACAGCTAGTAAGTGG - Intronic
973699017 4:53518674-53518696 AAAGTCACACAGCTGGTAAGTGG + Intronic
973821218 4:54663266-54663288 CAGAGCACACAGCAGGGAAGAGG - Intronic
974053008 4:56958852-56958874 CAGATCACAGAGGTGGTTAGGGG - Intergenic
974129534 4:57736428-57736450 AAGATTACACAGCTAGTAAGTGG - Intergenic
974400845 4:61403817-61403839 TAGGACACACAGCTGGTACCTGG + Intronic
974403102 4:61428610-61428632 CAAATCACATAGCCGGTAAGTGG - Intronic
974886410 4:67823443-67823465 AAGGTCACATAGCTGGTAAGTGG - Intronic
975227235 4:71888181-71888203 CAAACCATACATCTGGTAAGGGG - Intergenic
975645531 4:76542302-76542324 AAGGTCACACAGCTAGTAAGTGG + Intronic
976086552 4:81412752-81412774 AAGTTCACAAAGCTGGTAAGCGG - Intergenic
976113097 4:81698201-81698223 AAGATCACACAGCTAGCAAGTGG + Intronic
976113408 4:81701066-81701088 AAGGACACACAGTTAGTAAGTGG - Intronic
976140016 4:81981449-81981471 CAAGTGACACAGCTGGTAAGTGG - Intronic
976391133 4:84504987-84505009 AAGATCACACAGCTACTAAGTGG + Intergenic
976810065 4:89090909-89090931 CAAATCACACAGCTGGAAAGAGG + Intronic
976828292 4:89284402-89284424 GAGGCCACACAGCTTGTAAGTGG - Intronic
976885213 4:89974527-89974549 TAGGGCACACAGCAGGTAAGTGG - Intergenic
977295020 4:95200464-95200486 TAGGTCACACAGCTGTTAAGTGG - Intronic
977439236 4:97041124-97041146 CAAAACACACATCTGATAAAGGG + Intergenic
977939036 4:102838332-102838354 CTGAACACAGAGCTGGGAAGAGG - Intronic
978022031 4:103826224-103826246 AAGGTCACACATCTGGTAAGTGG - Intergenic
978166084 4:105608909-105608931 CAAACCACACATCTGATAAGGGG - Intronic
978340662 4:107718966-107718988 AAGATCACACAGCTAGTAAATGG + Intronic
978580008 4:110222070-110222092 CAGATCACCCAGCTAGTAAGTGG - Intergenic
978646199 4:110934712-110934734 CAAGTCACACAGCTGGTATGTGG + Intergenic
978653213 4:111033323-111033345 AAGATCACATAGCTAGTAAGTGG + Intergenic
978822445 4:112980967-112980989 AAGAACTTACAGCTGATAAGAGG + Intronic
979318872 4:119300210-119300232 AAGATCACACAGCTGGTGAGTGG - Intronic
979337428 4:119479629-119479651 CAAATCACACAGTTTGTAAGAGG - Intergenic
979530905 4:121768195-121768217 AAGACCACACCGCTGGCAAGTGG + Intergenic
979628742 4:122876889-122876911 AAGAACACAGAGCTCATAAGTGG - Intronic
980005606 4:127538796-127538818 CAAAACACACAGATGGCCAGTGG + Intergenic
980432529 4:132722722-132722744 CAAACCATACATCTGGTAAGTGG - Intergenic
980789623 4:137603256-137603278 AAGATTACACAGCTGGAAAGTGG - Intergenic
980866980 4:138563406-138563428 AAGATCACACAGCCAGTAAGTGG - Intergenic
981071813 4:140548629-140548651 CAAATCACACAGTTTGTAAGTGG - Intronic
981103135 4:140852737-140852759 CAAATCACACAGCCAGTAAGTGG - Intergenic
981270201 4:142837435-142837457 AAGATCACACAGCAGGTAAGTGG - Intronic
982242151 4:153310974-153310996 AAGACCACACTGCTGGAAAGAGG - Intronic
982263924 4:153521101-153521123 CAGATCACAGAGCCGGAAAGTGG - Intronic
982493238 4:156056372-156056394 AAGATCACACAGCTAGTAAATGG + Intergenic
982521735 4:156425791-156425813 CAAACCACACACCTGTTAAGGGG - Intergenic
982966922 4:161920960-161920982 CAAAACATAAAGCTAGTAAGTGG - Intronic
983142402 4:164168009-164168031 TAAAACAAACATCTGGTAAGGGG + Intronic
983375687 4:166924673-166924695 CTGAACACATGGCTGGTAAGTGG + Intronic
983538632 4:168885005-168885027 CAAACCACACAGCTTTTAAGTGG + Intronic
983551022 4:169017584-169017606 AAGATCACACAACTAGTAAGTGG + Intergenic
983703374 4:170626307-170626329 CAAACCATACATCTGGTAAGGGG - Intergenic
984018816 4:174459562-174459584 CAAATCACAGATCTGGTAAGAGG - Intergenic
984214486 4:176892436-176892458 TAGTTCACATAGCTGGTAAGAGG + Intergenic
984272045 4:177558945-177558967 CAGAAAATACAACTGGTAACAGG + Intergenic
984490054 4:180422572-180422594 AAGATAACACAGCTGATAAGTGG + Intergenic
984943475 4:184953558-184953580 CAGGTCACACAGCAAGTAAGTGG + Intergenic
985085717 4:186310396-186310418 CAGAACACATATCTGATAAAGGG - Intergenic
985570927 5:644524-644546 CAGCAGACGCAGTTGGTAAGTGG + Intronic
986433822 5:7708559-7708581 CAAATTACACAGCTGGTAAATGG + Intronic
986527442 5:8695413-8695435 CAGGACACACCGCTGGTGACTGG - Intergenic
986593634 5:9397359-9397381 CAGAACACACAACCAGGAAGTGG - Intronic
986746931 5:10753262-10753284 CAAATCGCACAGCTGGCAAGCGG + Intronic
986907632 5:12514692-12514714 CAAAACTAAAAGCTGGTAAGGGG + Intergenic
987123623 5:14791182-14791204 AAGATAACACAGCTGGTAGGGGG - Intronic
987135522 5:14896371-14896393 AAGGTCACACAGCTGGTAAGAGG - Intergenic
987245136 5:16041243-16041265 AACATCACACAGCTGGTAAGGGG + Intergenic
987557605 5:19474619-19474641 AAGATCACACAGATGGCAAGTGG + Intronic
987761677 5:22171667-22171689 GAGGCCACACAGCTAGTAAGTGG + Intronic
987785792 5:22496979-22497001 AAGATCACACAGCTGGTAAGTGG - Intronic
988674181 5:33414426-33414448 CAAAGCACAGAGCTGGGAAGTGG + Intergenic
988703928 5:33704736-33704758 CAGACCACATATCTGATAAGTGG - Intronic
988730786 5:33970612-33970634 AAGGTCACACAGCTGGTTAGTGG - Intronic
988959893 5:36359265-36359287 AAGCCCACACAGCTGGAAAGTGG + Intergenic
989085259 5:37669554-37669576 CTGACAACACAGGTGGTAAGAGG - Intronic
989164357 5:38420099-38420121 AAGGTCACACAGCTAGTAAGTGG + Intronic
989279586 5:39625795-39625817 CAGAAAACAAAGCTTGTAACAGG + Intergenic
989654400 5:43730586-43730608 AAGATTACACAGCTAGTAAGTGG - Intergenic
989667946 5:43878508-43878530 AAGATCATACAACTGGTAAGAGG + Intergenic
990294608 5:54387933-54387955 AAGGTCACACAGCTAGTAAGTGG - Intergenic
990707726 5:58548752-58548774 GATATCACACAGCTAGTAAGTGG + Intronic
990778233 5:59328215-59328237 CAAATCACACAGCTAGTAAATGG - Intronic
991127719 5:63086413-63086435 CAGGTCACACAGCTAGTAGGTGG - Intergenic
991206539 5:64056220-64056242 AAGATCACACGGCTTGTAAGTGG - Intergenic
991447298 5:66714050-66714072 AAGATCACCCAGATGGTAAGTGG + Intronic
991556958 5:67906141-67906163 CAAACCATACATCTGGTAAGGGG + Intergenic
991617664 5:68513837-68513859 AAGGTCACACAGCTGGTAAGTGG - Intergenic
991896463 5:71405107-71405129 GAGGCCACACAGCTAGTAAGTGG + Intergenic
992175400 5:74144669-74144691 AAGGACACACAGCTGGGAATTGG - Intergenic
992186776 5:74251922-74251944 CAGGTCTCACTGCTGGTAAGAGG - Intergenic
992361436 5:76042285-76042307 CAGTTCACAAAGCTAGTAAGTGG - Intergenic
992415465 5:76548594-76548616 AAGATTACACAGCTAGTAAGCGG - Intronic
992462690 5:76976537-76976559 AAGGACATACAGCTGGTTAGTGG - Intronic
992578440 5:78145421-78145443 CACATCTCACAGCTGGTTAGTGG + Intronic
992673020 5:79078520-79078542 AAGGTCACACAGCTGGTCAGTGG - Intronic
992768420 5:80024535-80024557 AAGGCCACACAGCTAGTAAGTGG + Intronic
992941044 5:81761887-81761909 AAGATCACACAGCTGATAATTGG - Intergenic
993216908 5:85036694-85036716 CATAACAGACAACTGGTAAGCGG - Intergenic
993279138 5:85903115-85903137 CAAAACACACAGGTAGTAAGTGG - Intergenic
993387053 5:87272455-87272477 AAGAATACCCAGCTAGTAAGTGG - Intronic
993598512 5:89889967-89889989 AGGAACACACAGCTTGTAAGTGG - Intergenic
993949756 5:94159272-94159294 AATATCACACAGCTAGTAAGTGG - Intronic
994054788 5:95402916-95402938 TAGAACACTCGGTTGGTAAGTGG + Intronic
994339392 5:98608420-98608442 AAGATTACACAGCTAGTAAGTGG + Intergenic
995004995 5:107181719-107181741 AAGATCACACAGCTTGTAAATGG - Intergenic
995095261 5:108228435-108228457 AAAATCACACAGCTAGTAAGTGG - Intronic
995175379 5:109170474-109170496 AAGATCACATAGCTGGTAAGTGG - Intronic
995336309 5:111003786-111003808 AAGTTCACACAGCTGGTATGAGG + Intergenic
995575082 5:113521266-113521288 GAGATCACACAGCTAGCAAGTGG + Intronic
995652918 5:114391436-114391458 CAAACCACTCAGCTAGTAAGTGG + Intronic
996366100 5:122703019-122703041 AAGGACACACAGCTGGCAAAGGG - Intergenic
996420821 5:123259955-123259977 CAGACCACACAGCTGTTTACTGG + Intergenic
996606466 5:125328985-125329007 CAGCACACAAAGGTGGTGAGGGG + Intergenic
996780491 5:127181503-127181525 CAGAGCAGACAGTTGGGAAGGGG + Intergenic
996985061 5:129551147-129551169 AAGATCACATAGCTAGTAAGAGG + Intronic
997473976 5:134132151-134132173 AAGGTCACACAGCTAGTAAGTGG - Intronic
997622759 5:135309581-135309603 TAAGACACACAGCTGGCAAGTGG - Intronic
997736810 5:136218935-136218957 AAGGTCACACAGCTGGAAAGTGG + Intronic
997860559 5:137411622-137411644 AAAAACACACAGCTGGGAAGTGG - Intronic
998388187 5:141770409-141770431 CAAGTCACACAGCTGGTAAGTGG - Intergenic
998414471 5:141936260-141936282 GAGTTAACACAGCTGGTAAGTGG + Intronic
998460465 5:142306181-142306203 AAGGCCACACAGCTGATAAGTGG - Intergenic
998475929 5:142421825-142421847 AAGGCCACACAGCTGGTGAGTGG - Intergenic
998505857 5:142671896-142671918 GTGGTCACACAGCTGGTAAGGGG + Intronic
998532306 5:142896762-142896784 AAGAACACACAGCTAGTAAATGG - Intronic
998543976 5:143010298-143010320 AAGGACACAGAGCTGGTCAGTGG - Intronic
998643854 5:144041407-144041429 CAGATCACAGAGCTGGTTAATGG - Intergenic
998783233 5:145681487-145681509 AAGATCACACAGGTAGTAAGTGG - Intronic
998827699 5:146120906-146120928 AAGGTCACACAGCTAGTAAGTGG + Intronic
999102755 5:149040361-149040383 CAGGACACACAGATGCTAGGGGG - Intronic
999147330 5:149405201-149405223 CAGACCTCACAGCTAGGAAGTGG + Intergenic
999292406 5:150434841-150434863 AAGATCACACAGCAAGTAAGTGG - Intergenic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
999368288 5:151037203-151037225 AAGGTCACACAGCTAGTAAGTGG + Intronic
999373743 5:151072103-151072125 GAGAATACACAGCTGGTTAGTGG + Intronic
999494562 5:152084353-152084375 GAGGTCACACAGCAGGTAAGTGG - Intergenic
999686727 5:154109839-154109861 AAGGCCACACAGCTAGTAAGTGG + Intronic
999702739 5:154243043-154243065 AAGGTCACACAGCTAGTAAGTGG - Intronic
999809328 5:155113004-155113026 CAGGTCACACAGCTAGTAAGTGG - Intergenic
999886659 5:155931759-155931781 AAGAACAGACAGATAGTAAGTGG - Intronic
1000072431 5:157753122-157753144 CAGATCACACTGTTAGTAAGTGG + Intronic
1000161657 5:158603412-158603434 GAGTTCACATAGCTGGTAAGTGG - Intergenic
1000221659 5:159220209-159220231 AAGGTCACACAGCTGGTAAGAGG - Intergenic
1000230365 5:159310277-159310299 AAGAGCAAAAAGCTGGTAAGTGG + Intergenic
1000258470 5:159563202-159563224 GAGGTCACATAGCTGGTAAGTGG - Intergenic
1000298983 5:159938009-159938031 AAAATCACACAGCTAGTAAGAGG - Intronic
1000339792 5:160268330-160268352 CAGACCACATGGCTAGTAAGCGG - Intronic
1000473198 5:161671940-161671962 AAGGACTCACAGCTAGTAAGTGG + Intronic
1000537500 5:162497058-162497080 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1000793076 5:165630740-165630762 CAGAGTCCACAGCTGGTGAGTGG - Intergenic
1000916244 5:167085707-167085729 TAGATCACACAGCTCCTAAGTGG + Intergenic
1001042670 5:168348191-168348213 CCGGCCACACAGCTGGCAAGTGG + Intronic
1001078714 5:168650707-168650729 AAGATCACACAGCTGATAAGTGG - Intergenic
1001141396 5:169146864-169146886 AAGTTCACACAGCTAGTAAGTGG - Intronic
1001221896 5:169907672-169907694 AAGATCACACAGCTGGAAAATGG + Intronic
1001277022 5:170358515-170358537 AACTTCACACAGCTGGTAAGAGG - Intronic
1001309528 5:170600989-170601011 AAGGTCACACAGCTGGTAAGTGG - Intronic
1001490952 5:172154770-172154792 CAGGCCACACAGCTAGCAAGTGG - Intronic
1001495474 5:172185191-172185213 CAGGACACACTGCGGGGAAGGGG + Intronic
1001536420 5:172501371-172501393 AAGAACACACAGCTAGGAATTGG + Intergenic
1001561459 5:172671935-172671957 AAGGCCACACAGCTGGCAAGTGG - Intronic
1001684218 5:173581149-173581171 AAGATCACACAGCAAGTAAGTGG - Intergenic
1001685881 5:173594772-173594794 AAGAACACACAGCTGGTAGGGGG + Intergenic
1001705105 5:173735857-173735879 AAGGTCACACAGCTAGTAAGAGG - Intergenic
1001717618 5:173829421-173829443 AAAATCACACAGCTAGTAAGTGG - Intergenic
1001772931 5:174309347-174309369 CACATCACACAGCTAGTAAGAGG + Intergenic
1001936274 5:175708092-175708114 CAGAACACACAGCTGGGTGTGGG + Intergenic
1001946108 5:175779375-175779397 CAACCCACACAGCTGGTAAAGGG - Intergenic
1002177401 5:177409038-177409060 AAGAGCACACAGTCGGTAAGTGG - Exonic
1002204502 5:177553764-177553786 CAGGAGACACAGCTGCTGAGGGG + Intronic
1002378899 5:178810621-178810643 GGAAACACACAGCTGATAAGGGG + Intergenic
1002871328 6:1169712-1169734 CGGGTCACACAGCTGGGAAGGGG + Intergenic
1002979321 6:2120242-2120264 GAGATAACACAGCTAGTAAGTGG + Intronic
1003428473 6:6016222-6016244 CAAACCATACATCTGGTAAGGGG - Intergenic
1003728423 6:8792468-8792490 AAGGTCACACAGCTGGTAAACGG + Intergenic
1004180556 6:13377484-13377506 CAGGGCACACAGCAGGAAAGTGG - Intronic
1004189754 6:13453791-13453813 AAAGACACACAGCTAGTAAGTGG + Intronic
1004618426 6:17312490-17312512 GAGATCACACAGCTGGCAAGTGG - Intergenic
1004871739 6:19912076-19912098 AAGATCACACAGCTGGTGAAAGG + Intergenic
1005397672 6:25400009-25400031 CAAATCACACAGCTAGTAAATGG + Intronic
1005431079 6:25757646-25757668 CAGAAGCCACAGCTAGCAAGAGG - Intronic
1005456579 6:26025542-26025564 CAGAGCACAGAGCATGTAAGTGG + Intergenic
1005474391 6:26193186-26193208 AAGATCACATAGCTGCTAAGGGG + Intergenic
1005674690 6:28141753-28141775 CACAGCACACAGCAGGTGAGGGG + Intergenic
1005939147 6:30547694-30547716 GACATCACAAAGCTGGTAAGTGG - Intronic
1006447853 6:34090018-34090040 CAGGCCACACAGCAAGTAAGAGG - Intronic
1006454926 6:34126207-34126229 AAGGTCACACAGCTAGTAAGTGG - Intronic
1006535860 6:34698127-34698149 AAGATTACACAGCTGGAAAGTGG + Intergenic
1006593515 6:35175895-35175917 TAGGTCACACAGCTGGTAAGGGG - Intergenic
1006609492 6:35285571-35285593 AAGGTCACACAGCTGTTAAGAGG + Intronic
1006629325 6:35420017-35420039 GAGGCCACACAGCTGTTAAGTGG + Intronic
1006807437 6:36797817-36797839 AAGGACACACAGCTAGGAAGAGG - Intronic
1006906724 6:37537922-37537944 CAGCTCACACGGCTGGTAAGAGG - Intergenic
1007178480 6:39912216-39912238 GAGAACACAGAGGTGGCAAGGGG + Intronic
1007237640 6:40402300-40402322 AAGCTCACACAGCTGGAAAGTGG + Intronic
1007369481 6:41416981-41417003 CAGATCCCACAGCTTGAAAGAGG + Intergenic
1007746051 6:44043593-44043615 CACATCACACAGCTGGAAAGTGG + Intergenic
1007833287 6:44655314-44655336 ATGATCCCACAGCTGGTAAGTGG + Intergenic
1007930302 6:45684985-45685007 AAGACCACACAGTTGGTAGGTGG + Intergenic
1007947452 6:45839054-45839076 AAGTTCTCACAGCTGGTAAGGGG + Intergenic
1008096857 6:47347765-47347787 AAGAGCACACAGCTAGCAAGAGG - Intergenic
1008481616 6:51992042-51992064 CAGGACCCACAGCTGGAAAGTGG - Intronic
1008576778 6:52868555-52868577 CAGATCACACAGCTATTATGAGG - Intronic
1008578173 6:52881482-52881504 CAGATCACACAGCTATTATGAGG - Intronic
1008669467 6:53752665-53752687 CATGGCACACAGCTAGTAAGTGG + Intergenic
1008671197 6:53770857-53770879 CAGGCCACAGAGCTGGTAACTGG + Intergenic
1008680527 6:53867091-53867113 AAGTTTACACAGCTGGTAAGTGG - Intronic
1008717248 6:54303866-54303888 CAAACCACACATCTGATAAGGGG + Intergenic
1008904035 6:56656619-56656641 AAGAACACAAATCTGGTAAGTGG + Intronic
1009947626 6:70358012-70358034 GAAAACACACAGCTGGGAAGTGG - Intergenic
1010155685 6:72789733-72789755 TAGGTCACACAGCTGGTGAGTGG + Intronic
1010226651 6:73495958-73495980 AAGATCACACAGTTGGTGAGTGG + Intronic
1010446116 6:75950554-75950576 CAATTCACACAGCTGGTGAGTGG - Exonic
1010587132 6:77666625-77666647 GAGGTCACATAGCTGGTAAGGGG + Intergenic
1011111727 6:83844959-83844981 TAGAGCAGACAGCTGGTATGTGG - Intergenic
1011226105 6:85108998-85109020 AAGGTCACACAGCTGGTTAGTGG - Intergenic
1011472219 6:87719098-87719120 AAGAACACTCAGCTAGAAAGTGG - Intergenic
1011514388 6:88136490-88136512 AAGATCACACAACTAGTAAGTGG - Intergenic
1012313993 6:97762395-97762417 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1012524917 6:100165798-100165820 CAGAACATATGGCTAGTAAGGGG - Intergenic
1012735595 6:102937334-102937356 CAAAACACACATCTGGTAAAGGG - Intergenic
1013443680 6:110198599-110198621 CAAACCATACATCTGGTAAGGGG - Intronic
1013601864 6:111712557-111712579 CAGAGCACAGAGCTGGCAGGTGG - Intronic
1013747057 6:113358333-113358355 GAGAACACACACATAGTAAGTGG - Intergenic
1015102194 6:129494645-129494667 AAGATCACACAGCTAGCAAGTGG + Intronic
1015361263 6:132341918-132341940 CAGGTCACACAACTAGTAAGGGG - Intronic
1015550360 6:134405736-134405758 CAGTACACACATCTAGAAAGTGG + Intergenic
1015571244 6:134623506-134623528 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1015670502 6:135684335-135684357 AGGATCACACAGCTAGTAAGTGG + Intergenic
1015831549 6:137375444-137375466 CAGAAGACAGAGCTGTGAAGAGG + Intergenic
1016287189 6:142486389-142486411 CAGATTGCACAACTGGTAAGTGG - Intergenic
1016840874 6:148523985-148524007 GAGATCACACAGCAAGTAAGTGG + Intronic
1016897118 6:149064302-149064324 AGGCTCACACAGCTGGTAAGTGG - Intronic
1017311972 6:152985168-152985190 AAAACCACACAGCTAGTAAGCGG + Intergenic
1017440636 6:154461531-154461553 AAGGTCACACAGCTGGGAAGTGG - Intronic
1017464014 6:154677956-154677978 GAGACCACACAGCTAGTATGTGG - Intergenic
1017516193 6:155157681-155157703 AATGTCACACAGCTGGTAAGTGG + Intronic
1017529835 6:155278664-155278686 AAGTTCACACAGCTAGTAAGTGG + Intronic
1017677842 6:156832591-156832613 CTTACCACTCAGCTGGTAAGTGG - Intronic
1017732066 6:157325482-157325504 AAGCTCACACAGCTGTTAAGTGG + Intergenic
1017749597 6:157479152-157479174 AAGGTCACACAGCTGGTTAGTGG - Intronic
1017946451 6:159100115-159100137 CAGACCTCTCAGCTGGCAAGTGG + Intergenic
1018002615 6:159593091-159593113 AAGGACACATGGCTGGTAAGAGG - Intergenic
1018449478 6:163893759-163893781 CCAAAATCACAGCTGGTAAGTGG - Intergenic
1018771664 6:166976283-166976305 CAGAACCCAAGGCTAGTAAGGGG - Intergenic
1019478330 7:1254800-1254822 GAGGACACACAGCTGGGCAGGGG + Intergenic
1019616276 7:1964077-1964099 CTGATCACAGAGCTGGTAAGGGG + Intronic
1019722972 7:2584295-2584317 CACAAAACACAGCTTGCAAGCGG - Intronic
1020409142 7:7871418-7871440 CAGATTACACAGCTTGTCAGTGG - Intronic
1022062219 7:26809036-26809058 CAAACCACACATCTGGTAAGGGG + Intronic
1022120310 7:27301970-27301992 AAGGCCACACAGCTAGTAAGTGG + Intergenic
1022133079 7:27422064-27422086 CACACAACACAGCTGCTAAGTGG + Intergenic
1022277728 7:28872489-28872511 AAGCTCACACAGCTAGTAAGAGG + Intergenic
1022282844 7:28928109-28928131 AAGATCACACAACTAGTAAGTGG - Intergenic
1022325967 7:29332201-29332223 CAGAAAGCCCAGCTGGTAAGGGG - Intronic
1022370460 7:29766151-29766173 AAGATCACCCAGCTGATAAGTGG + Intergenic
1022394200 7:29971176-29971198 CAGGTCACACAGCTAGTAGGTGG - Intronic
1022921858 7:35023662-35023684 CAAGGCACATAGCTGGTAAGTGG + Intronic
1022947908 7:35306013-35306035 CAAATCATGCAGCTGGTAAGTGG + Intergenic
1023124484 7:36941896-36941918 CAGATCACACACCTGGGAAGTGG + Intronic
1023552646 7:41386492-41386514 AAGGTCACACAGCTGGTTAGAGG - Intergenic
1023892290 7:44401820-44401842 CAGAACACACAGGTGGAGACAGG + Intronic
1024583508 7:50820896-50820918 AAAGTCACACAGCTGGTAAGTGG + Intergenic
1024944572 7:54795754-54795776 CAGTGCCCCCAGCTGGTAAGTGG + Intergenic
1024971197 7:55072379-55072401 CAAGTCCCACAGCTGGTAAGTGG - Intronic
1024994868 7:55266067-55266089 CAAACCATACAGCTGATAAGGGG + Intergenic
1025635099 7:63314799-63314821 CAGAAAACACACCGGGTAAAAGG + Intergenic
1025647596 7:63433371-63433393 CAGAAAACACACCGGGTAAAAGG - Intergenic
1026024604 7:66734346-66734368 CAGAATACACAGCTAGGAGGTGG - Intronic
1026283294 7:68941018-68941040 AAGGCCACATAGCTGGTAAGTGG + Intergenic
1026357652 7:69573227-69573249 AAGATCACACAGCTTGTAAGTGG + Intergenic
1027154298 7:75755627-75755649 CAGATCACACAGCTAATAAATGG + Intergenic
1027784610 7:82565355-82565377 CAAATCACACAGCTAGTATGAGG - Intergenic
1028005057 7:85554950-85554972 AAGGACACAAAGCTGATAAGTGG + Intergenic
1028185274 7:87777325-87777347 AAGGACACATAGCTGATAAGTGG + Intronic
1028447915 7:90945845-90945867 CAAATCACACATCTTGTAAGTGG + Intronic
1028514538 7:91662014-91662036 CAAACCATACAGCTGATAAGGGG - Intergenic
1028827213 7:95287626-95287648 AAGATCACACAGTTAGTAAGTGG - Intronic
1028925506 7:96353427-96353449 CAGATCACACAGCCAATAAGCGG + Intergenic
1029016855 7:97324333-97324355 TAGAGGACACAGCTGGGAAGAGG + Intergenic
1029128009 7:98308516-98308538 CAGACCCCACAGCTGGCAAGTGG + Intronic
1029186414 7:98741999-98742021 CAGAACACATAGATTTTAAGAGG - Intergenic
1029844178 7:103396097-103396119 AAGATCACACAGCTAGTACGTGG + Intronic
1030089717 7:105847666-105847688 AAGATCACACAGCTAATAAGTGG - Intronic
1030112951 7:106042028-106042050 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1030273631 7:107696289-107696311 AAGATCACACAGCTAGTACGTGG + Intronic
1030595876 7:111538133-111538155 CAGAACTCACAACTGATTAGGGG - Intronic
1030676399 7:112390324-112390346 AAGGCCACACAGCTAGTAAGCGG - Intergenic
1030947453 7:115741274-115741296 CAAACCACACATCTGGTAAGAGG + Intergenic
1031391077 7:121216012-121216034 AAGACCACACAGCTACTAAGTGG + Intronic
1031895573 7:127345064-127345086 CAGAACAAACAAATGGTTAGTGG + Intergenic
1032190072 7:129759935-129759957 AAGTTCACACTGCTGGTAAGAGG + Intergenic
1032451935 7:132039122-132039144 CAGGTCACACAGCTAGTAGGTGG + Intergenic
1032571833 7:133009001-133009023 CAGAACACAAAGGTAGTCAGTGG + Intronic
1032615117 7:133460297-133460319 CAGGCCACACAGCAGGTGAGCGG - Intronic
1032976769 7:137233279-137233301 AAGATCACAGAGCTGGTAAGTGG - Intronic
1033640166 7:143255781-143255803 CAAACCACACATCTGATAAGGGG + Intronic
1034367474 7:150563730-150563752 CAGAACAAAGACCTGGGAAGAGG - Intergenic
1034597665 7:152213811-152213833 CAAACCACACATCTGATAAGGGG + Intronic
1034614997 7:152408496-152408518 CAGGCCACACAGCAGGTGAGCGG + Intronic
1034826448 7:154269232-154269254 AAAACCACACAACTGGTAAGTGG + Intronic
1035523193 8:291627-291649 AAGAACACACAACTGCTGAGAGG + Intergenic
1036207030 8:6813189-6813211 CAGATCAAGCAGCTGGTTAGTGG + Intronic
1036410001 8:8491069-8491091 CAGGTCACAGAGCTAGTAAGTGG + Intergenic
1036662003 8:10714818-10714840 CAGCACACACGGCTGGGGAGTGG - Intergenic
1036731804 8:11272109-11272131 AAGAGCACACAGCTAGTTAGTGG - Intergenic
1037071222 8:14651979-14652001 CAGGAAACACAGCTGGTAGTAGG - Intronic
1037396494 8:18449316-18449338 CAGATTACACAGCCAGTAAGTGG + Intergenic
1037436017 8:18864262-18864284 AAGGTCACACAGATGGTAAGTGG - Intronic
1037448620 8:18994062-18994084 TAGATCACACAGTGGGTAAGTGG - Intronic
1037492274 8:19407604-19407626 CAGGCCTCACAGCAGGTAAGAGG - Intronic
1037517283 8:19645474-19645496 AGGAGCACACAGCTTGTAAGTGG - Intronic
1037561440 8:20078386-20078408 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1037725313 8:21478508-21478530 CAGATCTCACAGCTGGTAAGTGG + Intergenic
1037860411 8:22401198-22401220 AAGATCACATTGCTGGTAAGTGG + Intronic
1038012743 8:23487707-23487729 AAGGCCACCCAGCTGGTAAGTGG + Intergenic
1038061225 8:23915416-23915438 AAGGTCACACAGCTGGCAAGTGG - Intergenic
1038283832 8:26189671-26189693 CAACTCACTCAGCTGGTAAGTGG - Intergenic
1038865958 8:31439138-31439160 CCCCACACATAGCTGGTAAGTGG + Intergenic
1038904263 8:31880409-31880431 AAAATCACACGGCTGGTAAGCGG - Intronic
1039021436 8:33211419-33211441 AAGATCTCACAGCTAGTAAGTGG + Intergenic
1039135315 8:34316222-34316244 CTAACCACACAGCTAGTAAGTGG + Intergenic
1039342308 8:36664385-36664407 CAGGTCAAAGAGCTGGTAAGAGG - Intergenic
1039912824 8:41838249-41838271 AAGATCACACAGCTGGTGTGAGG + Intronic
1041772551 8:61487405-61487427 CAGATCACAGAGCTAGTAGGTGG + Intronic
1042080185 8:65043182-65043204 AAGATCACACAGCTTGTGAGTGG + Intergenic
1042239977 8:66654093-66654115 AAGATCACACAGCTAGTAAGTGG + Intronic
1042397117 8:68305772-68305794 AGGAACACTCAGCTGATAAGGGG + Intronic
1043344319 8:79282071-79282093 CAGCATCCACAGCTAGTAAGTGG - Intergenic
1043380015 8:79692508-79692530 CAAGACACACAGCTGCTGAGAGG + Intergenic
1043526500 8:81103410-81103432 GAGATAACACAGCTAGTAAGTGG - Intronic
1043969729 8:86515485-86515507 CAAATTACACAACTGGTAAGTGG + Exonic
1044326251 8:90861789-90861811 AAGATCACACATCTGGTAAATGG + Intronic
1044804235 8:95988496-95988518 AAAGACACACAGCTGGTAGGTGG + Intergenic
1044860152 8:96515075-96515097 CAGAGGTCACAGCTGGTAACTGG - Intronic
1044865416 8:96565985-96566007 AAGATCACACAGCTGGTACGTGG - Intronic
1044865826 8:96570164-96570186 GAGATCCCGCAGCTGGTAAGTGG + Intronic
1044878987 8:96702685-96702707 AAGATCACACAGCTAGTAAGTGG + Intronic
1045183453 8:99811726-99811748 AAGATCACACAGCTAGCAAGCGG - Intronic
1045413137 8:101939883-101939905 AAGATCAGACAGCTAGTAAGTGG + Intronic
1045472934 8:102528475-102528497 CAAACCGCACAGCTGGTAAGTGG + Intergenic
1045582579 8:103498168-103498190 AAGAACAGCCAGCTGGTAAGTGG - Intergenic
1045586509 8:103544053-103544075 CAGACCATACATCTGATAAGGGG + Intronic
1046046245 8:108968357-108968379 AAGAACACACAGCCAGTTAGTGG - Intergenic
1046110495 8:109717526-109717548 AAGGACTCACAGCTAGTAAGTGG - Intergenic
1046171759 8:110517348-110517370 AAGAACACACAGATGGTAAGTGG - Intergenic
1046496428 8:115020151-115020173 CAGCAATCAGAGCTGGTAAGTGG - Intergenic
1046725666 8:117670924-117670946 AAGATCACACAGCCAGTAAGTGG - Intergenic
1046727067 8:117687306-117687328 AAGATCACACAGCTAGTAAGTGG - Intergenic
1046830527 8:118740980-118741002 CTGAACACACAGGAGGTGAGAGG - Intergenic
1046852887 8:118995559-118995581 AAGACCACATTGCTGGTAAGTGG + Intronic
1047026618 8:120831463-120831485 TAAGACACACAGCTGGGAAGTGG + Intergenic
1047111516 8:121794459-121794481 CAAGTCACACAGCTGATAAGTGG + Intergenic
1047227951 8:122972458-122972480 AAGATCACACAGCTAGTAAGTGG - Intronic
1047307499 8:123664789-123664811 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1047314193 8:123717174-123717196 AAGTTCACACAGCTGCTAAGAGG - Intronic
1047757728 8:127931596-127931618 CAGATCACACAGCTGGAAAGTGG + Intergenic
1047788657 8:128179546-128179568 AAGACCACACACCTGGTCAGTGG + Intergenic
1047824429 8:128558169-128558191 GAGATGACACAGCTGGTGAGGGG + Intergenic
1047961527 8:130015458-130015480 AAGGTCACACAGCTAGTAAGCGG + Intronic
1047963233 8:130026061-130026083 AAGGTCACACAGCTAGTAAGGGG + Intergenic
1048066762 8:130977746-130977768 TAGGACACACAGCAAGTAAGTGG + Intronic
1048141459 8:131798757-131798779 AAGAGCACACAGATAGTAAGTGG + Intergenic
1048166683 8:132067870-132067892 AAGACCACATAGCTTGTAAGTGG + Intronic
1048278166 8:133083472-133083494 AAGAACACACAGCTGGTTAGAGG + Intronic
1048295296 8:133209553-133209575 CAGGGCACACAGCTGGTGAGGGG - Intronic
1048297469 8:133225083-133225105 AAGATCACACAGCTTGTAGGTGG + Intronic
1048335482 8:133499127-133499149 GAGGTCACACAGCCGGTAAGTGG - Exonic
1048352747 8:133629297-133629319 CAGGTTACACAGCTGGGAAGGGG - Intergenic
1048377472 8:133835226-133835248 AAGATCACACAGCTGGCGAGTGG + Intergenic
1048554814 8:135464814-135464836 AAGAACACATAGCTAGTAACTGG + Intronic
1048682809 8:136864899-136864921 AAGCCCTCACAGCTGGTAAGTGG - Intergenic
1048733468 8:137470860-137470882 CAGGGCACAGAGCTGGAAAGGGG + Intergenic
1048753888 8:137713153-137713175 CAGACCACAGAACAGGTAAGGGG - Intergenic
1048809180 8:138269686-138269708 AAGGCCACACAGCTGGAAAGTGG - Intronic
1048819567 8:138368351-138368373 AAGGTCACACAGCTGGAAAGCGG - Intronic
1049264661 8:141661018-141661040 AAGGACACAGAGCTGGGAAGTGG - Intergenic
1049940498 9:541709-541731 CAGACCATACATCTGATAAGGGG + Intronic
1050008999 9:1165882-1165904 CATGACAAACTGCTGGTAAGTGG + Intergenic
1050341069 9:4638988-4639010 CAGATCACATAGTTGGTAAGTGG - Intronic
1050433001 9:5580949-5580971 CACATCACACAGCTAGTAAGTGG + Intergenic
1050576593 9:7002792-7002814 TAGATCACAAAGCTAGTAAGTGG + Intronic
1050857945 9:10385615-10385637 AAGCCCACACAGCTGTTAAGTGG - Intronic
1051104733 9:13566488-13566510 CAGAGTACACAGCTGGCAGGTGG + Intergenic
1051215722 9:14795326-14795348 AAGATCACACTGTTGGTAAGTGG + Intronic
1051360823 9:16280223-16280245 CAGATTGCACAGCTGGAAAGAGG + Intergenic
1051529586 9:18085273-18085295 AAGATCGCACAGCTGGTAAGTGG - Intergenic
1051540940 9:18216893-18216915 TAGGCCACACAGCTGGTAAGGGG - Intergenic
1051614278 9:18992568-18992590 CATAACACACAGCTAGGAAGTGG + Intronic
1051707149 9:19892795-19892817 AAGGTCACACAGATGGTAAGTGG + Intergenic
1051954346 9:22672510-22672532 GGGACCACACAGCTAGTAAGTGG + Intergenic
1052170973 9:25396121-25396143 CAGGACACAGAGGTGGTAAGTGG - Intergenic
1052179703 9:25509277-25509299 CAGAACACACAGCTGGTGAATGG + Intergenic
1052280213 9:26724207-26724229 AAGATCACACAGCTAGTAAGTGG - Intergenic
1052335224 9:27312354-27312376 CAGACCATGCAGCTGGTTAGTGG - Intergenic
1052344273 9:27392753-27392775 CAAATCACACAGCTAGCAAGAGG - Intronic
1052496722 9:29235465-29235487 CCCATCACACAGCTAGTAAGTGG + Intergenic
1052825094 9:33168192-33168214 AAGAGCCCACAGCTGGCAAGAGG + Intergenic
1053135568 9:35648506-35648528 AAGAACACACAGCTGGTAAGTGG + Intergenic
1053164289 9:35833704-35833726 CAGAATGCACAGCTAGTAGGTGG - Intronic
1053256576 9:36621527-36621549 AAGGTCACACAGCTAGTAAGAGG + Intronic
1053293078 9:36894915-36894937 AAGGTCACACGGCTGGTAAGTGG - Intronic
1053294657 9:36904001-36904023 AAGGTCACACAGCTTGTAAGTGG - Intronic
1053299864 9:36941402-36941424 CAAATCACACAGCTGGTAAGAGG - Intronic
1053305512 9:36981767-36981789 AAGATCACACAGCTGGCAAGTGG - Intronic
1053422495 9:37988262-37988284 AAGGTCACACAGCTGGTGAGCGG - Intronic
1054728079 9:68672791-68672813 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1054814463 9:69461680-69461702 CAGGTCACACAGCTGTGAAGTGG + Intronic
1054922971 9:70560209-70560231 AAGACCACACAGCTAATAAGGGG + Intronic
1055008114 9:71532418-71532440 AAGATCACACAGCTCATAAGTGG - Intergenic
1055034152 9:71800014-71800036 AAGAACACAGAGCTATTAAGTGG - Intronic
1055127060 9:72730997-72731019 CAGGCCACACAGCAGGCAAGTGG - Intronic
1056193794 9:84209818-84209840 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1056285270 9:85081277-85081299 AAGGCCACACAGCTGTTAAGTGG - Intergenic
1056411040 9:86327484-86327506 AAGGACACACAGCTGGGAAGTGG + Intronic
1056542765 9:87588078-87588100 AAGATCACACAGCTAGTAAATGG + Intronic
1056721060 9:89072400-89072422 CAGAACTCACAGCTAGAATGGGG + Intronic
1056910577 9:90696555-90696577 CAGGTCACACAGCTGGCTAGTGG - Intergenic
1057037873 9:91824861-91824883 AAGAAAATACAGCTGGCAAGAGG - Intronic
1057520547 9:95756311-95756333 AAGATCACACAGCTTCTAAGTGG + Intergenic
1057543064 9:95993948-95993970 CAGAAAAGCCAGCTGGTCAGAGG - Intronic
1057745085 9:97745096-97745118 AAGGTCACACAGCTGGTGAGTGG + Intergenic
1058067271 9:100563511-100563533 AAGAACACACAGCTAATAATTGG - Intronic
1058120365 9:101131843-101131865 CAGACCACACAGCCAGTAAGTGG - Intronic
1058425645 9:104873618-104873640 AAGAAAGCACAGCTGGCAAGGGG - Intronic
1058800531 9:108540826-108540848 AAGGACATAGAGCTGGTAAGTGG + Intergenic
1058891744 9:109367025-109367047 CAGGACATACAACTGGTAAATGG + Intergenic
1059247517 9:112861465-112861487 CAGGCCACACACCTGGTAAGTGG + Intronic
1059321423 9:113473347-113473369 CAAATCACACAGCCAGTAAGTGG - Intronic
1059376756 9:113888094-113888116 AAGGCTACACAGCTGGTAAGTGG + Intronic
1059408837 9:114119343-114119365 AAGACCACACAGCTGGCCAGGGG - Intergenic
1059419571 9:114182696-114182718 CAGATCACCCAGCTGCTAAGAGG - Intronic
1059459916 9:114423194-114423216 CAAGGCACACAGCTGGTAAGTGG + Intronic
1059524962 9:114982762-114982784 CTGATGACAGAGCTGGTAAGTGG - Intergenic
1059625190 9:116056628-116056650 CAGAACATATATCTGGTAATGGG + Intergenic
1059685146 9:116627956-116627978 AAGGTCACAGAGCTGGTAAGTGG + Intronic
1059694841 9:116721224-116721246 AAGATCACACATCTGGGAAGAGG + Intronic
1059695637 9:116727749-116727771 AAGGTCACACAGCTAGTAAGTGG - Intronic
1059704661 9:116810383-116810405 GAGGTCACACAACTGGTAAGTGG - Intronic
1059742167 9:117162584-117162606 AAGATCTCACAGCTGGTATGTGG - Intronic
1059802200 9:117761847-117761869 CAGATCACACAGCTAGCAATTGG + Intergenic
1059850444 9:118332336-118332358 AAAAACATACAGCTAGTAAGTGG + Intergenic
1059974626 9:119702250-119702272 AAGGAAACACAGCTAGTAAGTGG - Intergenic
1059980191 9:119763026-119763048 CAAATCACACAGCTGGTTAGAGG + Intergenic
1059990007 9:119856005-119856027 AAGGTCACACAGCTGGTAAATGG + Intergenic
1060000681 9:119955798-119955820 AAGGAGACACAGCTAGTAAGTGG + Intergenic
1060019263 9:120115114-120115136 AAAGACACACAGCTGGGAAGTGG + Intergenic
1060161059 9:121364924-121364946 AAGATCACACAGCTAGTAAGTGG - Intronic
1060191206 9:121594189-121594211 TAGGTCACACAGCTGGCAAGTGG + Intronic
1060276535 9:122186972-122186994 AAGGTCACACAGCTGGTGAGTGG - Intronic
1060287627 9:122267924-122267946 AAGGTCACACAGCTAGTAAGTGG + Intronic
1060368653 9:123046504-123046526 CAGGTCTCACAGCTAGTAAGTGG - Intronic
1060438166 9:123614170-123614192 AAGATCGCACAGCTGGTCAGTGG + Intronic
1060506686 9:124203025-124203047 AAGGTCACACAGCTGATAAGTGG - Intergenic
1060516468 9:124269217-124269239 CAGACCCCACAGCTAGTGAGTGG + Intronic
1060556525 9:124510776-124510798 CAGGTCACACAGCTAGAAAGTGG - Intergenic
1060578176 9:124717775-124717797 AAGGTCACACAGCTGGTAAGTGG - Intronic
1060674362 9:125499103-125499125 AAGGTCACACAGCTAGTAAGTGG + Intronic
1060720121 9:125971072-125971094 AAGAGTACACAGCTGGTAGGAGG - Intergenic
1060720402 9:125972723-125972745 AAGATCACACAGCAGGTGAGTGG - Intergenic
1060736327 9:126068716-126068738 AAGGACACACAGCTAGTGAGAGG + Intergenic
1060741912 9:126104355-126104377 TAGGTCACACAGCTGGTAAGTGG - Intergenic
1060829660 9:126705704-126705726 GAGGCCACACAGCTGGGAAGCGG + Intergenic
1060912534 9:127362434-127362456 CAGAGCACACAGCTAGTAAGTGG + Intronic
1060967082 9:127717410-127717432 CTGGACCCACAGCTGGTGAGAGG + Exonic
1061045872 9:128164569-128164591 AAGACCACGCAGTTGGTAAGTGG - Intergenic
1061067735 9:128289200-128289222 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1061076924 9:128347314-128347336 AAGATCACACAGTTAGTAAGTGG + Intronic
1061101622 9:128496626-128496648 AAGATCACAATGCTGGTAAGTGG - Intronic
1061326092 9:129865626-129865648 CAGGCCACACAGCTAGTAAATGG + Intronic
1061353715 9:130086999-130087021 CAATACACCCAGCTAGTAAGTGG - Intronic
1061363034 9:130155812-130155834 CAGGTCACACAGCTGGTGACTGG - Intergenic
1061389988 9:130312132-130312154 AAGATCACACAGCTGGCGAGTGG + Intronic
1061404093 9:130384144-130384166 AAGGCCACACAGCTGGTCAGTGG - Intronic
1061733227 9:132633146-132633168 GGGGACACACAGCTGGGAAGTGG + Intronic
1061794060 9:133073800-133073822 CAGGCCACACAGCTGGGGAGCGG + Intronic
1061857113 9:133448458-133448480 GAGGTCACACAGCTGGTAAGTGG + Intronic
1062187569 9:135226906-135226928 CAGGACACAGAGCAGGTCAGAGG - Intergenic
1062426476 9:136508443-136508465 CAGAACGCACATCTGCCAAGGGG + Intronic
1062673887 9:137728583-137728605 CAGAACTCTCACCTGGCAAGGGG - Intronic
1186429317 X:9490908-9490930 CAGAAGAAACAGCTGGCAAAAGG - Intronic
1186684881 X:11915786-11915808 GAGTTCACACAGCTGGTTAGTGG - Intergenic
1186723254 X:12328782-12328804 AAGATCACACAGCTTCTAAGTGG - Intronic
1186826651 X:13346912-13346934 CAAAGCACACAGCTCTTAAGTGG + Intergenic
1186920771 X:14277215-14277237 TAGAATACACAGCTAGCAAGAGG - Intergenic
1187031445 X:15492620-15492642 CAGGTCACACAGCTGATATGTGG - Intronic
1187119857 X:16394190-16394212 AAGATCACACAACTAGTAAGTGG - Intergenic
1187227870 X:17391304-17391326 AAGGTCACACAGCTGGTAAGTGG - Intronic
1187246620 X:17558559-17558581 CAAATCACACAGCTGGTAACAGG - Intronic
1187294600 X:17986534-17986556 CAAGTCACACAGCTAGTAAGGGG + Intergenic
1187310112 X:18133693-18133715 GTGGTCACACAGCTGGTAAGTGG + Intergenic
1187338527 X:18401533-18401555 AAGGTCACACAGCTGGGAAGCGG + Intergenic
1187678354 X:21740761-21740783 AAGGCCACACAGCTGGGAAGTGG + Intronic
1187764152 X:22621018-22621040 CAGATGACACAGCTGATAACAGG - Intergenic
1188248483 X:27862431-27862453 AAGAACACACAACTGGGAAAAGG - Intergenic
1188440684 X:30213072-30213094 GAGTTCACATAGCTGGTAAGTGG + Intergenic
1188446860 X:30262930-30262952 AAGATCACACAGCTAGTAAATGG - Intergenic
1188856689 X:35205096-35205118 GAGATTACACAGCTGGTAAGTGG + Intergenic
1188943879 X:36272968-36272990 TAGATCACACAGTTAGTAAGTGG - Intronic
1189044971 X:37580894-37580916 CAGATCACACAGCTAGTCAGTGG + Intronic
1189107048 X:38247493-38247515 AAGATCATACAGCTTGTAAGTGG - Intronic
1189226929 X:39420745-39420767 AAGGTCACACAGCTGGTGAGTGG + Intergenic
1189299006 X:39938613-39938635 TAAATCACACAGCTAGTAAGAGG - Intergenic
1189519978 X:41756795-41756817 GAGATCACACAGCTTGTAAGGGG + Intronic
1189523309 X:41793299-41793321 TAAATCACACAGCTAGTAAGTGG + Intronic
1189731571 X:44026341-44026363 AACAACACACAGCTAGCAAGAGG - Intergenic
1189746538 X:44174268-44174290 AAGATCACACAGCTAATAAGTGG + Intronic
1189795230 X:44639611-44639633 AAGAGCACACAGATGGTAAGTGG + Intergenic
1189895459 X:45651138-45651160 AAGATCACATAGCTAGTAAGAGG + Intergenic
1190325762 X:49205996-49206018 CAGATCATGCAGCTAGTAAGTGG - Intronic
1190338289 X:49276405-49276427 CAGGTCACACAGCTGATAGGTGG + Intronic
1190407871 X:50105529-50105551 CAGACCACACAGCAAGTAAGTGG - Intergenic
1190485022 X:50915470-50915492 AAGGACACACAGCTGGTATGTGG - Intronic
1190827248 X:54028887-54028909 AAGATCCCACAGCTAGTAAGTGG - Intronic
1192207186 X:69104286-69104308 CATGACACACAGCTTGTAAGTGG - Intergenic
1192231534 X:69268604-69268626 CAGTTCACAAAGCTAGTAAGTGG - Intergenic
1192490989 X:71577506-71577528 GAGATCACACAGCTAGAAAGTGG - Intergenic
1192627449 X:72745056-72745078 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1192654259 X:72975757-72975779 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1192805347 X:74503825-74503847 TAGGTCACACAGCTAGTAAGTGG - Intronic
1193610136 X:83621381-83621403 TAGGTCACACAGCTAGTAAGTGG - Intergenic
1194694064 X:97023525-97023547 AAGGTCACACAGCTAGTAAGTGG + Intronic
1194773074 X:97928554-97928576 AAGGTCACACAGCTTGTAAGTGG - Intergenic
1194995756 X:100589834-100589856 AAAATCACACAGCTTGTAAGTGG + Intronic
1195004499 X:100672547-100672569 AAGATCAGACAGCTAGTAAGTGG + Intergenic
1195598572 X:106720722-106720744 AAGGTCACACAGCTGGTAGGTGG - Intronic
1195688928 X:107608308-107608330 AAGGTCACACAGCTGGTAAATGG + Intergenic
1195698789 X:107686295-107686317 CAAAACACACAGCTAGCAAAGGG + Intergenic
1195728165 X:107938257-107938279 AAGATCACACAGCTAGAAAGTGG - Intergenic
1196186073 X:112746440-112746462 AAGGCCACACAGCTAGTAAGTGG + Intergenic
1196187390 X:112759076-112759098 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1196329602 X:114455543-114455565 AAGATCACACAGCTAGTAAATGG + Intergenic
1196376511 X:115039260-115039282 CAAATTAAACAGCTGGTAAGTGG + Intergenic
1196503619 X:116413950-116413972 AAGATTACACAGCTGGTAAATGG + Intergenic
1196623752 X:117854309-117854331 TAGATCACACAGCTTGTAAATGG + Intergenic
1196647530 X:118133795-118133817 AAGAACACACAGCTGGAATGTGG - Intergenic
1196774697 X:119327621-119327643 AAGGCCACACAGCTGGTAAGTGG - Intergenic
1196926927 X:120642577-120642599 CAGGTCACACAGCTAGGAAGTGG - Intergenic
1196934358 X:120714884-120714906 AAGATCACACAGGTGGTAAGTGG - Intergenic
1197117213 X:122847954-122847976 AAGACCACACAGGTAGTAAGTGG + Intergenic
1197261767 X:124327528-124327550 AAGATCACACAGCTAGGAAGTGG - Intronic
1197329999 X:125141908-125141930 GAGATCACACAGCTAGGAAGTGG - Intergenic
1197589414 X:128390218-128390240 CATATCACATAGCTAGTAAGTGG - Intergenic
1197610133 X:128628981-128629003 AAGGACACACAGCTAGCAAGTGG + Intergenic
1197610712 X:128635220-128635242 AAGACCACACAGCTAGTAAATGG - Intergenic
1197655654 X:129113436-129113458 AAGAACACACAGCTAGTGAATGG - Intergenic
1197681051 X:129385806-129385828 AAGGTCACACATCTGGTAAGTGG - Intergenic
1197749420 X:129954410-129954432 GAGGTCACACAGCTGGTTAGTGG + Intergenic
1197805881 X:130398152-130398174 TAGGTCACACAGCTGGTAAATGG - Intergenic
1197822312 X:130553754-130553776 AAGGTCACACAGCTGGTCAGTGG - Intergenic
1197829697 X:130628277-130628299 AAGGTCACACAGCTGGTAAGTGG + Intronic
1198128998 X:133675443-133675465 AGGAAAACACAGCTGGCAAGAGG - Intronic
1198250756 X:134877323-134877345 AAGATCACACAGCTAGTAAGTGG + Intergenic
1198320541 X:135515173-135515195 CAGGTCACATAGCTGGTAAATGG + Intergenic
1198398629 X:136248835-136248857 CAGTTCACACAGGTAGTAAGTGG + Intronic
1198419307 X:136453277-136453299 CATGTCACACAGCTAGTAAGTGG - Intergenic
1198729246 X:139710169-139710191 CAGACCATACATCTGATAAGTGG - Intergenic
1198732079 X:139742349-139742371 AAGGACACACAGCTAGTAAGTGG + Intronic
1198798321 X:140423540-140423562 AAGATCACACAGCTAGTCAGTGG - Intergenic
1198838324 X:140829071-140829093 AAGAACACACAGCTAGTAAATGG + Intergenic
1199026628 X:142946941-142946963 CAGCACTCACAGCAGTTAAGAGG + Intergenic
1199092003 X:143703657-143703679 CAGACCATACATCTGATAAGGGG - Intergenic
1199132770 X:144212357-144212379 AGGAACACACAGCTAGTAAATGG - Intergenic
1199507858 X:148586158-148586180 AAGATCACACAGCTTCTAAGTGG + Intronic
1199586112 X:149417964-149417986 AAGGTCACACAGCTTGTAAGTGG - Intergenic
1199697587 X:150353794-150353816 AAGGTCACAGAGCTGGTAAGAGG + Intergenic
1199780126 X:151050890-151050912 CAGGTCACACAGCAGCTAAGTGG - Intergenic
1200343012 X:155419188-155419210 AAGATTACACAGCTAGTAAGTGG - Intergenic
1200374363 X:155764219-155764241 AAGATCATACAGCTAGTAAGTGG - Intergenic
1201380206 Y:13367950-13367972 ATTATCACACAGCTGGTAAGTGG - Intronic
1201575021 Y:15454210-15454232 TAGGTCACACAGCTAGTAAGAGG - Intergenic
1202273367 Y:23091643-23091665 AAAGTCACACAGCTGGTAAGTGG - Intergenic
1202292659 Y:23329039-23329061 AAAGTCACACAGCTGGTAAGTGG + Intergenic
1202426364 Y:24725387-24725409 AAAGTCACACAGCTGGTAAGTGG - Intergenic
1202444425 Y:24944699-24944721 AAAGTCACACAGCTGGTAAGTGG + Intergenic