ID: 951695164

View in Genome Browser
Species Human (GRCh38)
Location 3:25438744-25438766
Sequence TAGGGCATGAAACATTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 224}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951695164_951695170 19 Left 951695164 3:25438744-25438766 CCTGAAAAATGTTTCATGCCCTA 0: 1
1: 0
2: 1
3: 23
4: 224
Right 951695170 3:25438786-25438808 ACCATCGAGTGTTTTGGTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 45
951695164_951695174 26 Left 951695164 3:25438744-25438766 CCTGAAAAATGTTTCATGCCCTA 0: 1
1: 0
2: 1
3: 23
4: 224
Right 951695174 3:25438793-25438815 AGTGTTTTGGTTAAGGGGAAAGG 0: 1
1: 1
2: 1
3: 29
4: 269
951695164_951695175 30 Left 951695164 3:25438744-25438766 CCTGAAAAATGTTTCATGCCCTA 0: 1
1: 0
2: 1
3: 23
4: 224
Right 951695175 3:25438797-25438819 TTTTGGTTAAGGGGAAAGGTAGG 0: 1
1: 0
2: 2
3: 33
4: 715
951695164_951695173 21 Left 951695164 3:25438744-25438766 CCTGAAAAATGTTTCATGCCCTA 0: 1
1: 0
2: 1
3: 23
4: 224
Right 951695173 3:25438788-25438810 CATCGAGTGTTTTGGTTAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
951695164_951695169 13 Left 951695164 3:25438744-25438766 CCTGAAAAATGTTTCATGCCCTA 0: 1
1: 0
2: 1
3: 23
4: 224
Right 951695169 3:25438780-25438802 TAAAACACCATCGAGTGTTTTGG 0: 1
1: 0
2: 0
3: 9
4: 91
951695164_951695172 20 Left 951695164 3:25438744-25438766 CCTGAAAAATGTTTCATGCCCTA 0: 1
1: 0
2: 1
3: 23
4: 224
Right 951695172 3:25438787-25438809 CCATCGAGTGTTTTGGTTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951695164 Original CRISPR TAGGGCATGAAACATTTTTC AGG (reversed) Intronic
904066969 1:27760323-27760345 TAGGGCTTGAAACTTGGTTCAGG - Intronic
905904112 1:41605290-41605312 AGGGGCATGAAGCAGTTTTCTGG + Intronic
908117338 1:60953120-60953142 TAAGCCATGAAACATTTATGTGG + Intronic
908312680 1:62901231-62901253 TTGAGCATGAAACATTTTTAGGG - Intergenic
909082358 1:71128157-71128179 TAGAGCATCAAACATTTTTTTGG + Intergenic
910085403 1:83395917-83395939 TATGGCATGCAAAATGTTTCAGG + Intergenic
910378631 1:86600887-86600909 AAGGGTATGAAAATTTTTTCTGG - Intergenic
910432106 1:87168935-87168957 CAGGGTGTTAAACATTTTTCAGG - Exonic
911967702 1:104388130-104388152 TAGGGCAGCAAAAATTTTTGGGG - Intergenic
913213956 1:116604327-116604349 TAGGGCATAAAACAATTTATTGG + Intronic
914360295 1:146929776-146929798 GTAGGCATGAAACAGTTTTCAGG + Intergenic
914493451 1:148170121-148170143 GTAGGCATGAAACAGTTTTCAGG - Intergenic
914785228 1:150823345-150823367 GATGGCATGAAAACTTTTTCAGG - Exonic
916235977 1:162588896-162588918 TTAGGCATGAAACTGTTTTCAGG + Intronic
921456233 1:215375310-215375332 TAGAGAATGAAAGAATTTTCAGG - Intergenic
921789192 1:219270411-219270433 TAGGGCATGAAAAATTGGTTGGG + Intergenic
924102788 1:240621714-240621736 TAGAGCATGAAACCTGTCTCTGG - Intergenic
1063565311 10:7168148-7168170 GAAGGCATGAAACTTTTCTCTGG + Intronic
1064686068 10:17863569-17863591 TAAGGCCTGAAAAATATTTCTGG + Exonic
1065465626 10:26018186-26018208 TAGGGCTTGAAAGTTCTTTCTGG + Intronic
1065673978 10:28154702-28154724 CAGGGCATTAAACATTTCTTTGG + Intronic
1067495647 10:46757828-46757850 TAGGAGTTGAAACAGTTTTCTGG - Intergenic
1067555172 10:47264636-47264658 TAGAGGAGGACACATTTTTCAGG - Intergenic
1067599005 10:47582560-47582582 TAGGAGTTGAAACAGTTTTCTGG + Intergenic
1067948668 10:50709145-50709167 TAGGAGTTGAAACAGTTTTCTGG + Intergenic
1068107397 10:52635871-52635893 CAGGGTATGAAATATTTTTATGG - Intergenic
1068315454 10:55336196-55336218 CAGGGCATAAAACAATTCTCTGG + Intronic
1068324199 10:55462431-55462453 TGGAGCATAAGACATTTTTCTGG + Intronic
1068827736 10:61458226-61458248 TTGGGCAAGAAACACTTGTCAGG + Intergenic
1069388386 10:67905799-67905821 TATGTCATGAACCATTTTCCAGG + Intronic
1070883988 10:79874142-79874164 TAGGAGTTGAAACAGTTTTCTGG + Intergenic
1072035341 10:91558114-91558136 TAGGGCTTGCAATCTTTTTCTGG + Intergenic
1072413814 10:95230681-95230703 TAGGGCAAGAAGCTTCTTTCAGG - Intergenic
1072678111 10:97483915-97483937 GACAGCATGAAACTTTTTTCAGG + Intronic
1072685971 10:97537217-97537239 TAGGCCATGACACTTTTGTCTGG + Intronic
1073828773 10:107358056-107358078 CATGGCATTAAACATTTTTCAGG - Intergenic
1074530412 10:114293870-114293892 TACTTCATGAAACATTATTCTGG - Intergenic
1074803281 10:117024257-117024279 AAGAGCATGAAGCAATTTTCTGG + Intronic
1075608240 10:123831805-123831827 TAGGGTAGAAAAGATTTTTCTGG - Intronic
1076083524 10:127605385-127605407 TAGGGCATGAACATTTTTACAGG + Intergenic
1080869900 11:36228144-36228166 TATGGCATTAGACATTTTGCTGG + Intronic
1081366843 11:42245364-42245386 TAGTGCTTGAGACATTTTTAAGG - Intergenic
1081402011 11:42654309-42654331 GATGAAATGAAACATTTTTCAGG - Intergenic
1081849409 11:46264942-46264964 CAGGGCCTGAAACTTTTATCTGG + Intergenic
1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG + Intergenic
1086184889 11:84001652-84001674 CAGCGCATGAAACATTATCCAGG + Intronic
1088340913 11:108765500-108765522 TAGGGCTACAAATATTTTTCTGG - Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089794950 11:120972851-120972873 TAAGGCATGGCACATATTTCTGG - Intronic
1090911705 11:131126427-131126449 CAGGACATGAAACATTCTCCAGG - Intergenic
1094396299 12:30009471-30009493 TAGGCTATGAAAAAGTTTTCAGG - Intergenic
1095852241 12:46823533-46823555 TAGGACAAGGAATATTTTTCTGG + Intronic
1097005166 12:55911480-55911502 TACGGCAAGAAACATGTTTTGGG + Intronic
1098026706 12:66211807-66211829 TATAGCATGAAAGACTTTTCTGG + Intronic
1098755376 12:74355726-74355748 AAGGGGGTTAAACATTTTTCTGG - Intergenic
1098921903 12:76310287-76310309 TAGAGCATGACTCATTTATCTGG - Intergenic
1100179179 12:92065431-92065453 TAGGACATGAAACAGAGTTCAGG + Intronic
1104221804 12:126791895-126791917 TGGGACATGACACATTTTTAAGG + Intergenic
1105217184 13:18294878-18294900 TAGGGCATAAAACAATTTATTGG + Intergenic
1105534341 13:21250308-21250330 TAGGGCATGAATTAATTGTCAGG + Intergenic
1106646882 13:31644879-31644901 ATGCACATGAAACATTTTTCAGG + Intergenic
1106671951 13:31915471-31915493 AAGGGCATCAATCATTTTTAGGG - Intergenic
1107591021 13:41905648-41905670 TAGGACATTGAACATTTTTTAGG + Intronic
1109833116 13:67819643-67819665 GAGTACATGAAACATTTTTATGG + Intergenic
1109998109 13:70156382-70156404 TAGTGTATGAAACATTTTAGTGG - Intergenic
1111252847 13:85626992-85627014 TATGGCATGAAACTATTTTTCGG - Intergenic
1113672453 13:112184259-112184281 GAGTGAATGAAGCATTTTTCAGG - Intergenic
1115994581 14:39183287-39183309 CAGGAAATGAAACATTTTGCTGG - Intergenic
1117184397 14:53226089-53226111 TAGGGCTTGAATTCTTTTTCTGG + Intergenic
1117537320 14:56714463-56714485 TAGAGCATGCAAACTTTTTCTGG + Intronic
1122118840 14:99541149-99541171 TAGGGCTGCAGACATTTTTCTGG - Intronic
1123056955 14:105575266-105575288 GAGGGCAAGAAACATGTTTTCGG - Intergenic
1123081255 14:105696519-105696541 GAGGGCAAGAAACATGTTTTCGG + Intergenic
1202866424 14_GL000225v1_random:121817-121839 CAGGGGATGTAACAATTTTCTGG + Intergenic
1126480464 15:49113314-49113336 CAGCACATGGAACATTTTTCAGG + Intronic
1127403562 15:58616341-58616363 TAGCACATGAAACATTCTCCAGG + Intronic
1128553321 15:68612909-68612931 TAGGGCCTGGAACAACTTTCTGG + Intronic
1129728378 15:77915616-77915638 TAGGGCATGCAACATCTCTGTGG - Intergenic
1129824752 15:78627401-78627423 TAGGACATGAGATATTCTTCTGG - Intronic
1129960192 15:79677275-79677297 TAGTGCATGAAACATTTTCAGGG - Intergenic
1130056415 15:80530180-80530202 CAGGGCCTGAAATATCTTTCTGG - Intronic
1133526157 16:6607784-6607806 TAGGATGTGAAACATTATTCGGG - Intronic
1137011338 16:35323830-35323852 TAGGTCATGAAACATTCTCCTGG + Intergenic
1137029998 16:35513981-35514003 TAGGTCATGAAACATTCTCCTGG + Intergenic
1137330757 16:47492943-47492965 AAGGGCAAGAAAAATTTATCGGG + Intronic
1138045990 16:53725446-53725468 TATGGCTTGGAATATTTTTCTGG + Intronic
1139522072 16:67489176-67489198 AAGGGGAGGAAACATTTTCCTGG + Intergenic
1146340175 17:32012054-32012076 TATGGCCTGAAACATTTTTTAGG + Intronic
1148658792 17:49310330-49310352 AACAGGATGAAACATTTTTCAGG - Intronic
1148787386 17:50151964-50151986 GAGGGCATCAAACAGCTTTCTGG - Intergenic
1149813296 17:59698902-59698924 CAGTGCTTCAAACATTTTTCAGG - Exonic
1150233860 17:63576617-63576639 TAGGACATAAAAAATTTTTTGGG + Intronic
1150892688 17:69172213-69172235 TAGCACATAAAAAATTTTTCAGG + Intronic
1152499065 17:80696069-80696091 TAGGGCAGGATAGATTTTTCCGG + Intronic
1153469187 18:5424261-5424283 TTGAGCATCATACATTTTTCAGG - Exonic
1157034980 18:43960719-43960741 TAGGGCATGTAAAATATTTTTGG + Intergenic
1157782317 18:50450426-50450448 TAAGGGATGAAACATTTTAGTGG + Intergenic
1159351162 18:67274413-67274435 TAGGGAATAAAATAATTTTCTGG + Intergenic
1160141855 18:76331143-76331165 TAGCACATGAAACATTCTCCAGG + Intergenic
1168456416 19:56513190-56513212 TAGTGTATGGAACATTATTCAGG - Intronic
928786336 2:34890822-34890844 TCTGCCTTGAAACATTTTTCAGG - Intergenic
930228668 2:48821539-48821561 TATGGCATGAAAAAGTTTTCTGG + Intergenic
930781775 2:55230944-55230966 TAGGGGATGAAAAATGTTCCAGG + Intronic
934297141 2:91751804-91751826 TAGGGCATAAAACAATTTATTGG - Intergenic
939570190 2:143831650-143831672 TAGTCCATGGAACATTTTTTGGG - Intergenic
940296020 2:152125235-152125257 GAGGGTAGGAAAGATTTTTCTGG - Intronic
940924204 2:159345583-159345605 GTGGGCCTGAAACATTTTCCTGG - Intronic
941204541 2:162554867-162554889 TAGGGCATGAACCTTTTTCCAGG + Intronic
941832297 2:169975383-169975405 TAGCACATGGAACATTTTCCAGG - Intronic
942334608 2:174869533-174869555 GAGGGCATGAGAGAATTTTCTGG + Intronic
943285047 2:185987475-185987497 AAGGGCAGGAAATATTTTTAAGG - Intergenic
943779418 2:191805563-191805585 TAGGCACTAAAACATTTTTCTGG + Intergenic
943986401 2:194625762-194625784 GAGGCCACGAAACATATTTCTGG + Intergenic
945866247 2:215179519-215179541 TAGCACATGAAACATTCTCCAGG - Intergenic
947773760 2:232691402-232691424 TAATGCATGCAACATTTTTGGGG + Intergenic
1168942790 20:1727705-1727727 TGGGGCAGCAAACATTTTTAGGG + Intergenic
1170354748 20:15479806-15479828 AAGAGCATCAAACATTTGTCTGG - Intronic
1171073464 20:22098668-22098690 TTGGGCATGTGGCATTTTTCAGG + Intergenic
1176734326 21:10529830-10529852 TAGGGCATGAAAGTTTTATGTGG - Intronic
1177023526 21:15893442-15893464 TAGGCCATGAAACATAATTCTGG + Intergenic
1177330157 21:19649145-19649167 CAAGTCATGAAGCATTTTTCAGG - Intergenic
1177403029 21:20630894-20630916 CAGGGCCTGAAAAATATTTCCGG + Intergenic
1177930706 21:27279555-27279577 AAGGGCATGAATCACTTTTGTGG - Intergenic
1178066373 21:28908673-28908695 CATGGCATGAAAAATATTTCTGG - Intergenic
1178164631 21:29959465-29959487 TAGAGCATGAAACACATTTTAGG + Intergenic
1178332114 21:31706963-31706985 TAGGTCTAGAAACATTTTTAAGG + Intronic
1179892521 21:44343908-44343930 TATGGCAGGAAACATGTTTCGGG + Intergenic
1181679664 22:24484944-24484966 TAGGGCATTAAACCTTTTTGTGG - Intergenic
1185391804 22:50565762-50565784 TATGGAATGTAACATTTTGCAGG + Intergenic
949650296 3:6150426-6150448 TAGTGCATAATACATTTTTGTGG - Intergenic
951213776 3:20004725-20004747 TAGGGCATGAGATATTTTCAAGG + Intronic
951334209 3:21401632-21401654 CAGCACATGAAACATTCTTCAGG + Intergenic
951695164 3:25438744-25438766 TAGGGCATGAAACATTTTTCAGG - Intronic
953200579 3:40774878-40774900 TAGGGCTTTTAATATTTTTCAGG - Intergenic
954535784 3:51358310-51358332 AAGGGCAGGGAACGTTTTTCAGG + Intronic
955399229 3:58579380-58579402 TTGGGTATAAAACAATTTTCTGG + Intronic
957696411 3:83644649-83644671 TATGCTATGAAACACTTTTCTGG - Intergenic
958551392 3:95618350-95618372 TTTGTCATGAAATATTTTTCAGG - Intergenic
959017651 3:101153793-101153815 AATGTCATGAAACACTTTTCAGG - Intergenic
960002495 3:112747921-112747943 TAAGGACTGAAATATTTTTCTGG - Intronic
960431368 3:117572709-117572731 GATGGCATGAAACATATTTGAGG + Intergenic
960472559 3:118085301-118085323 TAGTGAATTAAACATTATTCTGG + Intergenic
965094875 3:164212752-164212774 AAGCACATGAAACATTCTTCAGG + Intergenic
967550330 3:190786420-190786442 TAGGTGACGAAATATTTTTCTGG + Intergenic
969144229 4:5106784-5106806 TAGTAAATGAAACATTTTTCAGG - Intronic
970911544 4:21282641-21282663 TAGAGCATGAAATATTTTTTAGG + Intronic
971025000 4:22581368-22581390 TAGGCCATGAGAAGTTTTTCTGG - Intergenic
971171816 4:24241504-24241526 AAGGGATTGAAACATTTTTCTGG - Intergenic
971906796 4:32736436-32736458 AAAGGCAGGAAACATTTTACAGG - Intergenic
974752926 4:66164906-66164928 AAGGGGAGGAAACATTTTCCTGG + Intergenic
975347196 4:73305383-73305405 TAGGGCTTGATTCATTATTCAGG + Intergenic
976302674 4:83530140-83530162 AAGGCCATGACACATTCTTCAGG - Intergenic
977036525 4:91960301-91960323 TAGGTCCTTAAACATTTGTCAGG - Intergenic
977039132 4:91993222-91993244 GTGTGCATGAAACATTTATCAGG + Intergenic
978456914 4:108904358-108904380 GAGTTCATGAAACATTTTTAGGG + Intronic
978987336 4:115029456-115029478 GAGGACAAGAAACTTTTTTCTGG - Intronic
980254277 4:130357154-130357176 TAGTGCTTGAAATATTTTTCAGG - Intergenic
983586259 4:169358346-169358368 TTCAGCATGAAACATTTCTCTGG - Intergenic
983996045 4:174183465-174183487 TAGGGCATGTAACAGTGTTGTGG - Intergenic
984882268 4:184420480-184420502 TATGAAATGACACATTTTTCTGG + Intronic
985882726 5:2652549-2652571 GAGGGCATGAAACGTCCTTCAGG - Intergenic
987682791 5:21159603-21159625 TGAGGCATGAAACATTCTTCTGG + Intergenic
989267286 5:39490299-39490321 GTGTACATGAAACATTTTTCAGG + Intergenic
989554433 5:42776317-42776339 TAGAGCATGAAAAATTATCCAGG + Intronic
990134565 5:52630170-52630192 CAGGTCATGAATCATTTTACTGG + Intergenic
990517072 5:56540234-56540256 CAGGGTAATAAACATTTTTCAGG + Intronic
993204471 5:84862421-84862443 TAGGGCATGAAAGATTGGTTGGG - Intergenic
994339697 5:98611692-98611714 TACGGCAAAAAACAATTTTCAGG + Intergenic
995829449 5:116337721-116337743 CTGCACATGAAACATTTTTCAGG + Intronic
996468226 5:123827954-123827976 TAGCGCATGGAACATTCTTCAGG + Intergenic
998339802 5:141407411-141407433 AAGGGCAAGAGACATTTTTGTGG - Intronic
998705107 5:144750250-144750272 GAGAGCATGGAACATTTTTTAGG + Intergenic
1000523392 5:162325614-162325636 TAGAGCATGAAGCAGTTTCCTGG - Intergenic
1000801621 5:165734601-165734623 AAGCACATGAAACATTTTCCAGG - Intergenic
1002674571 5:180900559-180900581 GAGGCAAGGAAACATTTTTCAGG - Intronic
1004301325 6:14460653-14460675 TAGAGCATGTAACATTGTTTTGG - Intergenic
1005294960 6:24416592-24416614 TACAGAATGTAACATTTTTCTGG + Intronic
1006780088 6:36626687-36626709 TAGGGCTTGGAACATTTCTCAGG + Intergenic
1008740227 6:54597811-54597833 TAGAGCATTAAACTTCTTTCAGG - Intergenic
1009819023 6:68775491-68775513 TATGGCATGAAAACATTTTCTGG - Intronic
1009922302 6:70077064-70077086 CGGAGCATGAAACATTTTTATGG + Intronic
1010613719 6:77987601-77987623 CAGTGCATGGAACATTCTTCAGG + Intergenic
1011247700 6:85336938-85336960 TAGGGTATGAGACATGTATCAGG + Intergenic
1011873639 6:91927906-91927928 TGAGGCATCAAACATTTTCCTGG + Intergenic
1013089613 6:106888310-106888332 TAGTGCTTGAAATATTTTGCAGG + Intergenic
1013168866 6:107618315-107618337 TAGGCCATGAAGTATTTGTCTGG + Intronic
1013746194 6:113349479-113349501 AAGGGCCTGAAATATTATTCAGG - Intergenic
1014697061 6:124636001-124636023 CAGGACATGAAACATTCTCCAGG + Intronic
1014833824 6:126134702-126134724 TACCACATGAAACATTCTTCAGG + Intergenic
1015569415 6:134605471-134605493 AAGGGCATGAAAAATCTTTTTGG + Intergenic
1015874776 6:137811852-137811874 TAGGCAATGAATCATTTATCCGG + Intergenic
1016766724 6:147802910-147802932 AAGGGCATGAAGGAATTTTCTGG + Intergenic
1020154110 7:5708168-5708190 TTGCGCATGGAACATTTTCCAGG - Intronic
1020766061 7:12322788-12322810 AAAGACATGAAACATTTTTGTGG - Intergenic
1020902953 7:14028245-14028267 TAGGTAATGCAACATTTTCCTGG - Intergenic
1021088120 7:16448049-16448071 TATAGCAGGAAACATTTTCCTGG + Intergenic
1021157922 7:17234968-17234990 AATGTCATGAAACATTTTTCTGG - Intergenic
1021795510 7:24250121-24250143 TAGGGTATGTGGCATTTTTCTGG + Intergenic
1021812991 7:24421958-24421980 TAGAGAATTAAATATTTTTCTGG + Intergenic
1022676276 7:32502428-32502450 TAGGCCATGAAACATGATTATGG - Intronic
1027302276 7:76852378-76852400 TATGGCATGCAAAATGTTTCAGG + Intergenic
1027349799 7:77299582-77299604 CAGCACATGAAACATTCTTCAGG - Intronic
1027722072 7:81756098-81756120 CAGGGCATGACACATTTGGCCGG - Intronic
1028786977 7:94806775-94806797 TAGCACATGAAACATTCATCAGG + Intergenic
1029337218 7:99912119-99912141 AAGGGCATGAAAGAATTCTCTGG + Intronic
1030534953 7:110754801-110754823 TAGGGCAATAAACAGTTTTGTGG - Intronic
1030623515 7:111818135-111818157 TAGGGCATGCCACATTTTAAAGG - Intronic
1032897877 7:136272173-136272195 TGGGGAATGATACATTTTTATGG + Intergenic
1033626721 7:143117601-143117623 TAGGGCGTGAAAGATTGGTCAGG - Intergenic
1035959656 8:4123282-4123304 TAGGTCAACAAACATTTTCCAGG + Intronic
1037283949 8:17275688-17275710 TAGGGCATGAAACATTTAAAGGG + Intronic
1039733689 8:40306928-40306950 TAAGGCTTGAGACATTTGTCAGG - Intergenic
1043198186 8:77327695-77327717 TAGGACATGAAACATTCTTCAGG - Intergenic
1044085615 8:87938703-87938725 TATGGGATGAAACATTTAGCAGG - Intergenic
1045376190 8:101576542-101576564 GAGTCCATGAAATATTTTTCAGG + Intronic
1045610012 8:103828630-103828652 TATGTCATGAAACCTTTGTCAGG + Intronic
1046142411 8:110111220-110111242 TAGGCCATAAGATATTTTTCAGG - Intergenic
1046231059 8:111358759-111358781 TAGGGACTGACACATTTATCTGG - Intergenic
1046425255 8:114039341-114039363 CAGTGCATGAAAGATTTTCCAGG + Intergenic
1047615475 8:126558803-126558825 TAGGGCAAGAAATATGTTCCAGG - Intergenic
1047660317 8:127026647-127026669 TGGGGCAGGAAACATTCTACAGG - Intergenic
1048418632 8:134254572-134254594 TAGGGCATGAAAGTTATTTTAGG + Intergenic
1048566480 8:135603834-135603856 CTGCGCATGAAACATTCTTCAGG - Intronic
1048598469 8:135892556-135892578 TAGGGAATGACTCTTTTTTCAGG + Intergenic
1048804798 8:138230040-138230062 TAGCACATAAAATATTTTTCAGG + Intronic
1050687052 9:8183593-8183615 TAGAGGATGACACATTTTTATGG + Intergenic
1053598398 9:39586231-39586253 TTGGGCATGAAGCATTTGTCTGG - Intergenic
1055132089 9:72787143-72787165 AAAGGCATGAAATAATTTTCTGG - Intronic
1059894221 9:118842254-118842276 TAGGACATGAAATATATTTGGGG + Intergenic
1186226550 X:7405187-7405209 TAGTGAATGAGACATTTCTCAGG - Intergenic
1187756541 X:22533691-22533713 TTGGGGAAGACACATTTTTCTGG - Intergenic
1187811741 X:23186492-23186514 GAGGTCATCAAACTTTTTTCTGG + Intergenic
1188360814 X:29250972-29250994 TAAGCCAGGAAACATTTTTTTGG + Intronic
1188470319 X:30530656-30530678 TGGGGCAAGAATGATTTTTCAGG + Intergenic
1189564391 X:42225845-42225867 CAGCACATGAAACATTTTCCAGG - Intergenic
1191690284 X:63932418-63932440 TAGGTGGTGAGACATTTTTCTGG - Intergenic
1192622484 X:72693240-72693262 TGGCACATGGAACATTTTTCAGG - Intronic
1194693704 X:97018876-97018898 TAGGGCACGGAAGATTTTTAGGG - Intronic
1195234234 X:102881084-102881106 TAGCTCATCAAACATTATTCTGG - Intergenic
1195329326 X:103784295-103784317 CAAAGCATGAAACATCTTTCTGG - Intronic
1195353003 X:104012420-104012442 TAGGGCATGAGCCATTTCTGTGG + Intronic
1197981867 X:132225774-132225796 TATGGCATGAAATAATTTTGAGG - Intergenic
1198388525 X:136150119-136150141 TAGGACATGAAAGACATTTCAGG + Intronic
1198682538 X:139198062-139198084 AAGGGCATGAAAGAACTTTCTGG + Intronic
1201177534 Y:11318546-11318568 CAGGTGATGTAACATTTTTCTGG - Intergenic
1201451374 Y:14119047-14119069 TAGCTTATGTAACATTTTTCAGG + Intergenic
1201509390 Y:14741599-14741621 TAGGACATCAAACATTTTATAGG - Intronic
1201984132 Y:19945335-19945357 CAGCGCATAAAACATTCTTCAGG - Intergenic
1202087124 Y:21149990-21150012 AAGGGGAGGAAACATTTTCCTGG - Intergenic