ID: 951698386

View in Genome Browser
Species Human (GRCh38)
Location 3:25469349-25469371
Sequence CATGAACATGATGCTGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951698384_951698386 9 Left 951698384 3:25469317-25469339 CCACATTGTTGTTTTTAATTGGA 0: 1
1: 0
2: 2
3: 111
4: 1371
Right 951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG 0: 1
1: 0
2: 2
3: 23
4: 173
951698382_951698386 19 Left 951698382 3:25469307-25469329 CCATTTAAAACCACATTGTTGTT 0: 1
1: 0
2: 2
3: 32
4: 356
Right 951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG 0: 1
1: 0
2: 2
3: 23
4: 173
951698381_951698386 25 Left 951698381 3:25469301-25469323 CCAAGGCCATTTAAAACCACATT 0: 1
1: 0
2: 1
3: 17
4: 256
Right 951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG 0: 1
1: 0
2: 2
3: 23
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951698386 Original CRISPR CATGAACATGATGCTGTCTT TGG Intronic
901425522 1:9180501-9180523 GATGAACAAGATGCTGCCCTTGG - Intergenic
902773320 1:18658808-18658830 CATAAACATGAAGTTGCCTTGGG + Intronic
906107920 1:43305771-43305793 CCTCAGCATGAGGCTGTCTTGGG - Intronic
907676639 1:56523825-56523847 CATGTACACTATGCTGTATTTGG - Exonic
909703272 1:78551949-78551971 CATCAGCCTGATGCTGTCCTGGG - Intergenic
910656587 1:89625661-89625683 CATAAACATGATTCTCTCTTTGG - Intergenic
910861286 1:91744499-91744521 CATAAACATGTTCCTTTCTTAGG - Intronic
911285327 1:95984543-95984565 ATTTAACATGAAGCTGTCTTAGG + Intergenic
912269262 1:108192729-108192751 CCTGAGGAGGATGCTGTCTTAGG - Intronic
912409346 1:109468841-109468863 CAGGGAAATGATGCAGTCTTGGG + Intronic
912600031 1:110921058-110921080 CATAAACATGATTCTGGTTTTGG - Intergenic
913083221 1:115409421-115409443 CAAAAACATAATCCTGTCTTTGG - Intergenic
913239044 1:116812182-116812204 CATGAACATGGTTCTTTCTAGGG - Intergenic
913290830 1:117270085-117270107 CTTCAACATCATCCTGTCTTTGG + Intergenic
914449463 1:147777975-147777997 CATGATCTTGATCTTGTCTTTGG - Intergenic
917964126 1:180167822-180167844 CAGGGACATGGTGCTATCTTTGG + Intronic
918975624 1:191481597-191481619 CCTGAGCATGATACTGTATTTGG + Intergenic
921106173 1:211981157-211981179 CTGGAACAAGATGCTGTCTTTGG - Exonic
924169053 1:241317956-241317978 CATAAACAATATCCTGTCTTGGG + Intronic
924243407 1:242060608-242060630 CATGAACTTGAGGCTGCCCTGGG + Intergenic
1063267630 10:4472152-4472174 TATGAAAATGTTGATGTCTTTGG + Intergenic
1063529700 10:6819370-6819392 CATGAACAGGAGGCTGACCTGGG + Intergenic
1064341708 10:14491563-14491585 GATGAAGATGAGGGTGTCTTGGG + Intergenic
1065571347 10:27073305-27073327 CACGCACATCATGCTGTCGTGGG - Intronic
1065775307 10:29114231-29114253 GATGAAAATGGTGCTCTCTTTGG - Intergenic
1066611058 10:37248942-37248964 CATGGCCATGCTGCTGTCTTGGG + Intronic
1074005379 10:109417540-109417562 CATGAGCCTAATTCTGTCTTAGG + Intergenic
1074168637 10:110909772-110909794 CATGAGAATGATGTTGTTTTAGG + Intronic
1076380306 10:130020788-130020810 CAGGAACACGAGGCTGTCATCGG + Intergenic
1077535991 11:3124469-3124491 CATGAACAAGATCCTGGCTCAGG - Intronic
1078071066 11:8110894-8110916 CAGGAACATGTTTCTGGCTTTGG + Exonic
1080146521 11:28991653-28991675 CATGAACATATAGCTGACTTTGG - Intergenic
1081348570 11:42020583-42020605 CATGCACAAGCTTCTGTCTTCGG - Intergenic
1081990260 11:47333651-47333673 GATGAACAGGATGGTGTCTGTGG + Exonic
1084223282 11:67698036-67698058 CAAGAGCATGGTGCTGGCTTTGG - Intergenic
1088752768 11:112858648-112858670 CATGTCCCTGATGCTGTCTGGGG - Intergenic
1091738669 12:2944143-2944165 CATGAACATGAAGCTGTCCAGGG - Intergenic
1092999191 12:13979796-13979818 TATGAAAATAATGCTGTTTTGGG - Intronic
1094342214 12:29425212-29425234 TATGGAAATGATTCTGTCTTTGG + Intronic
1097640472 12:62174655-62174677 CCTCAAAATAATGCTGTCTTGGG + Intronic
1097724556 12:63059858-63059880 CTTTAAAATGATGCTGTATTTGG + Intergenic
1098842184 12:75489678-75489700 CATGAACCTGATTCATTCTTGGG + Intronic
1099646485 12:85363893-85363915 CAGGAACATGATGTTGATTTTGG + Intergenic
1099896916 12:88659741-88659763 CAGGAACATTTTGCTGTCTGAGG + Intergenic
1100566488 12:95799417-95799439 CATGAACAGAATTCTTTCTTTGG + Intergenic
1101048800 12:100839122-100839144 GATGGACATCATTCTGTCTTTGG + Intronic
1101794909 12:107964049-107964071 CATGAACCTGAAGCTGAGTTAGG - Intergenic
1109618415 13:64868049-64868071 AAAGAACCAGATGCTGTCTTTGG - Intergenic
1110712962 13:78670224-78670246 CTTGATCATGGTGCTTTCTTTGG + Intergenic
1111300842 13:86348427-86348449 CCTGAAAAGGATGCAGTCTTTGG + Intergenic
1115647596 14:35380297-35380319 CAAGAACAAGACTCTGTCTTGGG + Intergenic
1116112460 14:40604281-40604303 TCTGAAAATGATGCTGCCTTTGG + Intergenic
1116876148 14:50113994-50114016 ATTAAACATGATGCTGCCTTTGG - Intronic
1119744682 14:77035631-77035653 AATGAAAATGCTGCTGTCCTTGG - Intergenic
1121803087 14:96791742-96791764 CATGGTCATGGTGTTGTCTTGGG - Intergenic
1124995687 15:34721132-34721154 CATGAACAAGAGGCTTTTTTGGG + Intergenic
1126083176 15:44985517-44985539 CATGAAAATTATTCTGTTTTTGG - Intergenic
1126510965 15:49474168-49474190 AATGAACACTATTCTGTCTTAGG + Intronic
1127170075 15:56292162-56292184 CAAGAACATGATGCTGCATGAGG - Intronic
1127237402 15:57069925-57069947 CATTAAAATCAAGCTGTCTTGGG + Intronic
1127362297 15:58255067-58255089 CTAGTTCATGATGCTGTCTTAGG + Intronic
1128779900 15:70352386-70352408 TTTGGAAATGATGCTGTCTTGGG - Intergenic
1129857989 15:78838595-78838617 CCTGTGTATGATGCTGTCTTCGG + Intronic
1131232911 15:90672498-90672520 CTTGAACATGACGCTGTCCTGGG + Intergenic
1131929711 15:97427703-97427725 TTTGAAGATGCTGCTGTCTTTGG - Intergenic
1132700062 16:1218547-1218569 CCTGAACATGTAGCTGTCGTTGG - Exonic
1134331429 16:13254712-13254734 CATCAAAATGCTCCTGTCTTTGG + Intergenic
1137628968 16:49928612-49928634 CATGCACGTGATGCTATCGTTGG - Intergenic
1140507042 16:75479953-75479975 CATGAACATGATGGTCTCAGTGG + Intronic
1141434150 16:83989625-83989647 GATGAAAATGATGCTGTGTTGGG - Intronic
1141651023 16:85393297-85393319 TATGAACTTGAGGCTGTCTGAGG + Intergenic
1142944786 17:3415733-3415755 ATTAAACATGATGCTGTCTTTGG + Intergenic
1144249878 17:13405649-13405671 CATTCACAGGATGCTGCCTTGGG - Intergenic
1144330074 17:14214933-14214955 CCTGAACATGGCGCTGGCTTGGG - Intergenic
1144409882 17:14990599-14990621 CATTAACATGATGCCGTCAGTGG + Intergenic
1146966641 17:37036988-37037010 CAAAAAGATGATGCTGTCCTGGG - Intronic
1147851830 17:43449620-43449642 CAGAAGCAGGATGCTGTCTTGGG + Intergenic
1149045972 17:52246052-52246074 CAGAAACATGATGCTGTCATCGG - Intergenic
1149460210 17:56822989-56823011 CAGGAACATGATGCTGACCTTGG - Intronic
1150137083 17:62701980-62702002 GATGACCAAGATGCTGTCTTTGG - Intronic
1150360533 17:64529495-64529517 CATGAACATGCTGTTGATTTAGG + Intronic
1153337501 18:3939546-3939568 CATGAACAGAATGGTGTCATAGG - Intronic
1154488491 18:14898987-14899009 AATGAACAATATTCTGTCTTAGG - Intergenic
1155289709 18:24328493-24328515 CATGAACCTGTATCTGTCTTAGG + Intronic
1156807775 18:41207222-41207244 TATTAACATGATGATGTTTTGGG - Intergenic
1163338020 19:16686356-16686378 GATGAAGATGAGGCTGGCTTTGG - Exonic
1163895298 19:20053044-20053066 CATGAAGCTGATGATGACTTAGG + Intergenic
1164296876 19:23918483-23918505 CATAAAAATGATGTTTTCTTAGG + Intronic
1165610654 19:37149498-37149520 TATTAACAGGATGCTGTCATTGG + Exonic
1166496053 19:43303990-43304012 CATGAACCTGATGCTGTTATGGG - Intergenic
1167351509 19:48977965-48977987 CATGAACAAGATGCTGGATAAGG - Exonic
1168349860 19:55669539-55669561 CATGAACATGGTGCTGCCTGAGG + Exonic
926734782 2:16064785-16064807 AATCAACAAGATTCTGTCTTTGG - Intergenic
926921109 2:17941063-17941085 CATGTCCTTGAGGCTGTCTTGGG - Intronic
928388701 2:30891561-30891583 TTTGCACATGAAGCTGTCTTTGG - Intergenic
929473189 2:42217609-42217631 CATGAAAAAGATGCTTTCTGAGG + Intronic
938927482 2:136057524-136057546 CATCTACCTGATGCTGACTTGGG + Intergenic
941169573 2:162120250-162120272 CCAGAATATGTTGCTGTCTTGGG - Intergenic
943971692 2:194416862-194416884 TATGATTATGAGGCTGTCTTAGG - Intergenic
944651417 2:201834073-201834095 CAAGAACATGATGCTTTGTGAGG + Intronic
946280557 2:218662958-218662980 CATGAACACGATGCGGGCCTCGG - Exonic
947240980 2:227994276-227994298 TATGAACATGATGCAATCTGTGG - Intronic
1169234404 20:3918584-3918606 TATGCACATGGTGCTGTATTTGG + Intronic
1175003018 20:55650588-55650610 GTTGAACATGATGCTGTGATTGG - Intergenic
1176013739 20:62916646-62916668 CATGAACATGGAGCTGTCTTCGG - Intronic
1179578572 21:42322976-42322998 CGGGAACATGGTGTTGTCTTTGG + Intergenic
1180029310 21:45193205-45193227 CTTGGTCATGATGCTGTATTTGG - Intronic
1181307140 22:21923230-21923252 CATGACCGTGATGTTGTCGTGGG + Exonic
1181387019 22:22553706-22553728 CTTGAAAATGTTGCTGTCCTAGG - Intronic
1184488855 22:44797588-44797610 AATGAAGAGGATGCTGTATTTGG + Intronic
951347612 3:21565120-21565142 CATGAACCTTATGCTATGTTTGG + Intronic
951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG + Intronic
951742607 3:25940857-25940879 CTTGAAAATGATGCAGTCATGGG + Intergenic
953198173 3:40753647-40753669 CACTAACATGATGCTGGCTTTGG + Intergenic
953815772 3:46154936-46154958 CATGCAGATGTTGCTGTCTGTGG - Intergenic
954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG + Intronic
956555453 3:70517131-70517153 GATGAACATTTTGCTGTGTTGGG - Intergenic
957542375 3:81589115-81589137 TATGAAAATGATTCTGTGTTTGG + Intronic
959710797 3:109384031-109384053 CATGAACATTAGTCTGTCTAAGG - Intergenic
960199797 3:114818005-114818027 CATTTTCATGATGCTGTCATTGG - Intronic
962556830 3:136561785-136561807 CTTGAGCATGACGCTGGCTTTGG + Intronic
962753388 3:138450919-138450941 CCTGAACATGAGGCTGGCTTGGG - Intronic
963692668 3:148524503-148524525 CATGAACATGAAACAGTTTTTGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966431043 3:179832057-179832079 TATAAACATGTTGCTGTCTTCGG - Intronic
967336142 3:188346612-188346634 CATACACATGATCCTGTGTTTGG + Intronic
968541829 4:1171928-1171950 CGTGAAGGTGATGCTGTATTTGG + Exonic
969560686 4:7945728-7945750 CATGGAAATGAAGCTTTCTTTGG - Intergenic
969584009 4:8081496-8081518 CATGCCCATGATGCTGGCTGTGG - Intronic
969937829 4:10700166-10700188 GATGAAGAAGATGCTGACTTTGG + Intergenic
970726717 4:19054808-19054830 AATGAACATATTGCTGTCATTGG + Intergenic
972588583 4:40462021-40462043 CATGAACAAGATTCTGTATTAGG - Intronic
973702393 4:53550298-53550320 CAGGAACAAGATCCAGTCTTGGG - Intronic
974281644 4:59802823-59802845 CGTGATCATGTTGCTTTCTTTGG - Intergenic
976688212 4:87839495-87839517 AAGGAACAAGTTGCTGTCTTCGG + Intronic
977346146 4:95818920-95818942 ATTTAGCATGATGCTGTCTTAGG + Intergenic
979322102 4:119336633-119336655 CATGGACAAGATGGTGTCTAAGG + Intergenic
981054305 4:140344601-140344623 CATAAACATGCTGGGGTCTTTGG + Intronic
982985971 4:162206491-162206513 CAAAAACATGTTGCTGTTTTGGG + Intergenic
983993825 4:174157164-174157186 CATGTAGATTATGCTGTCTGAGG + Intergenic
987675397 5:21066994-21067016 GATGAATATGTTTCTGTCTTTGG + Intergenic
989190692 5:38667147-38667169 CATGAACATACTGTTATCTTTGG + Intergenic
989228619 5:39060801-39060823 CTTATACATGATGCTGTCTTTGG + Intronic
989994825 5:50817342-50817364 TATGAAAAAAATGCTGTCTTTGG - Intronic
992621053 5:78593457-78593479 CATGAAAATGATACTGTTTTTGG - Intronic
993404626 5:87495890-87495912 GATAAACATGATGCTGCCTATGG - Intergenic
993772384 5:91945610-91945632 CATAAACATTATGCATTCTTTGG - Intergenic
995753562 5:115477878-115477900 GATGAACATGATCCCGTCTTTGG + Intergenic
996145273 5:119967149-119967171 CATGAACATGCAGTTGTCTAGGG + Intergenic
996226010 5:120997248-120997270 AATAAATATGATGCTTTCTTGGG - Intergenic
999055094 5:148565849-148565871 CCTTTACATGATTCTGTCTTTGG - Intronic
1002970166 6:2008208-2008230 TAAGAAAATGTTGCTGTCTTGGG - Intronic
1003121833 6:3324395-3324417 CCTGTCCATGATGCTGTATTAGG + Intronic
1004133723 6:12946312-12946334 CTTGAACATTATGCTGTCAAGGG + Intronic
1005179243 6:23084840-23084862 CCTGAACATCCTGCTGTGTTTGG - Intergenic
1007702042 6:43771246-43771268 CATGAACTTTCTGCTGTCTTGGG + Exonic
1008062518 6:47013630-47013652 CCTCCACATGATGCTCTCTTAGG - Intronic
1009878392 6:69534901-69534923 CAGGAACAGGAAGCTATCTTTGG - Intergenic
1013384377 6:109610602-109610624 CATGAAAATAATACTTTCTTGGG - Intronic
1015260464 6:131231752-131231774 CAAGAACATTATACTTTCTTAGG - Intronic
1016981675 6:149860493-149860515 CATGTACATGATACTGTTCTAGG - Intronic
1018306253 6:162459194-162459216 CAGTAATATGATGCTGCCTTTGG - Intronic
1019155817 6:170038195-170038217 CATGGACATTCTGCTGTCCTGGG + Intergenic
1022508224 7:30920054-30920076 CATGAAAAGCATGTTGTCTTTGG + Intronic
1024810134 7:53200837-53200859 CATCTACATCATGCTGTATTTGG - Intergenic
1024985686 7:55191638-55191660 CATGAACATGACCCTGAATTCGG + Intronic
1025270300 7:57505700-57505722 CATGATCATGATGTTTTCTCTGG - Intergenic
1032063819 7:128748722-128748744 TATGACCATGATGCCTTCTTGGG + Exonic
1032342173 7:131084520-131084542 CATCTCCATGATGCTGTCATGGG + Intergenic
1034738207 7:153448776-153448798 CCTGTACATACTGCTGTCTTGGG - Intergenic
1035698596 8:1620857-1620879 CATAAACATCAAGCTGTCTGGGG + Intronic
1035938644 8:3870838-3870860 CATTAACACCATTCTGTCTTAGG + Intronic
1036037499 8:5035302-5035324 CATGAGCATGATAATGTGTTTGG - Intergenic
1037825354 8:22157102-22157124 CATGCCCATGATGCTGCCTAGGG - Intronic
1041167994 8:55110300-55110322 CAACAACATGATGGTGTCCTTGG + Intronic
1042346939 8:67737119-67737141 CATGAGCATGCTGTTGCCTTTGG + Intronic
1042430356 8:68699445-68699467 TATGAACATAATCCTTTCTTTGG + Intronic
1043024941 8:75054871-75054893 AATGAAAAAGATGCTGTCTGTGG - Intergenic
1045283091 8:100766423-100766445 CATGACCATCATGCTGTCAAGGG + Intergenic
1046105858 8:109665613-109665635 AATGACCATGAAGCTCTCTTTGG + Intronic
1046256289 8:111700330-111700352 CTTGAAAATGAAGCTGTTTTGGG + Intergenic
1048333104 8:133484556-133484578 CAGGAAGAAGATGCTGTCTCTGG + Intronic
1048745213 8:137606904-137606926 CCTGAACATGTTTCTTTCTTAGG - Intergenic
1049397643 8:142408998-142409020 CATGAACACGATGGTGACTGTGG + Intergenic
1050749559 9:8921248-8921270 CATGAACTTGATTCTATTTTAGG + Intronic
1051777178 9:20647865-20647887 CATTAACATGATGCTGGCTTTGG - Intergenic
1053590963 9:39514191-39514213 CATGACCATGATGTAGTCGTGGG + Intergenic
1053848811 9:42269559-42269581 CATGACCATGATGTAGTCGTGGG + Intergenic
1054575343 9:66851099-66851121 CATGACCATGATGTAGTCGTGGG - Intergenic
1054979577 9:71189493-71189515 CATGCAAATAATCCTGTCTTTGG - Intronic
1057794093 9:98143353-98143375 CATGACTATGATGCTGTTGTAGG - Intronic
1185874059 X:3687854-3687876 GAGGAACACGATGCTGTCCTTGG - Intronic
1186293366 X:8122745-8122767 CATAAACATGAGGCTGTTTATGG - Intergenic
1187580815 X:20605462-20605484 CATGTACACGAACCTGTCTTTGG + Intergenic
1188270367 X:28132130-28132152 AATGAGCATGATGCTGGATTTGG + Intergenic
1189498987 X:41536789-41536811 AATGAACATGAGGCTCTCTGTGG + Intronic
1193995118 X:88356728-88356750 AATAAACATGATGTTATCTTTGG - Intergenic
1197951900 X:131907285-131907307 GATGAACATGATGGTGTTTTAGG + Intergenic
1197958632 X:131979826-131979848 CAGGAAGCTCATGCTGTCTTTGG + Intergenic