ID: 951699407

View in Genome Browser
Species Human (GRCh38)
Location 3:25479889-25479911
Sequence CTTCCTCGTTATTGCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951699407 Original CRISPR CTTCCTCGTTATTGCACTGC TGG (reversed) Intronic
902227798 1:15007645-15007667 CTTCCTGGTTTCTGCTCTGCCGG + Intronic
907497502 1:54854555-54854577 CTAGCTCATTATTGCACTCCAGG - Intronic
913177846 1:116291512-116291534 CTACTTTGTTATTGCATTGCAGG - Intergenic
916267510 1:162905372-162905394 ATTCCTTGTTAATGCACTGTGGG - Intergenic
919402792 1:197140317-197140339 CTTCATCCTTATTGCAGTTCTGG - Intronic
922615821 1:226960697-226960719 CTTCCAAATTATTGCACTGTGGG + Intronic
1062981597 10:1727294-1727316 CTTCCTTGGTTTTGCTCTGCGGG - Intronic
1064580997 10:16792611-16792633 CTGCCTTGTTTTAGCACTGCAGG + Intronic
1072476014 10:95760542-95760564 CTTAATCATGATTGCACTGCGGG + Intronic
1088860084 11:113790927-113790949 CTTCCTCCTTTATGCACTGAGGG - Intergenic
1090703954 11:129319920-129319942 TTTCCTCCTTATTGTCCTGCAGG - Intergenic
1096455994 12:51787084-51787106 CTGCCACTTTATTACACTGCAGG - Intronic
1101254339 12:102963022-102963044 CTTCACCGTTCTTGCAGTGCTGG + Intergenic
1105503141 13:20989304-20989326 CTTCCTGTTTTTTCCACTGCAGG - Exonic
1106997094 13:35497665-35497687 CTTCCTCATTTTTGTACTTCAGG - Intronic
1108312518 13:49209952-49209974 CTTCCTGGTAGTGGCACTGCTGG + Intergenic
1109269481 13:60238422-60238444 CTTCCTGTTTATTTCAGTGCGGG + Intergenic
1110393148 13:74999253-74999275 CTTCATTATTATTGCAATGCAGG + Intergenic
1112138711 13:96613827-96613849 CTTCCTTTTAATTGCACTGTGGG + Intronic
1112317020 13:98371940-98371962 CTTTCTATTTATTGAACTGCAGG + Intronic
1113054699 13:106255576-106255598 CTTCCTCCTCATTCCATTGCTGG + Intergenic
1118881439 14:69829703-69829725 TTTCCTCTTTGTTGCACTCCGGG + Intergenic
1123058530 14:105583947-105583969 AATCCTCGTTACTGCACTGGAGG + Intergenic
1123082863 14:105704180-105704202 AATCCTCGTTACTGCACTGGAGG + Intergenic
1124291795 15:28457783-28457805 CTTCCTTGTTCATGCACCGCTGG + Intergenic
1124799630 15:32819042-32819064 ATTCCTTGTGATTGCACTTCAGG + Intronic
1126988728 15:54345486-54345508 CTTCCAGGTTATTGCACTGCAGG - Intronic
1151778509 17:76226173-76226195 CTTCCTCCTTTATGCACTGAGGG + Intronic
1152343500 17:79737992-79738014 CCTCCTCGTGATGGGACTGCTGG + Exonic
1156322019 18:36035440-36035462 CTTCCTCATTATTTCCCTGAGGG - Intronic
1156440616 18:37183641-37183663 CTTCTTAGTTTTTTCACTGCAGG - Intronic
1160235827 18:77085980-77086002 CTCTCTCCTTATTGCACTGAGGG - Intronic
1167967973 19:53163385-53163407 CATCATCCTTATTGCACTGCAGG - Intronic
927005215 2:18841594-18841616 CTGCCTCTTTGTTGCATTGCAGG + Intergenic
927114822 2:19889541-19889563 GTGCCTCGTTACAGCACTGCTGG - Intergenic
927463947 2:23323318-23323340 ATTCCTCGTGTTTGCATTGCAGG - Intergenic
931177641 2:59869921-59869943 CTTCTGAGTTCTTGCACTGCTGG - Intergenic
935114122 2:100119833-100119855 CTTCCTCCATAATGCACTGAAGG - Intronic
939369779 2:141284160-141284182 CTTCTTTTTTATTGCACTGCTGG - Intronic
945447993 2:209960781-209960803 CTTCCCCATTACTGCACAGCAGG - Intronic
947480965 2:230499688-230499710 CTTCTTCATTATTCCCCTGCTGG + Intronic
1169648529 20:7841567-7841589 CTTCCTGGATATTGCTCTGGTGG - Intergenic
1183713857 22:39522158-39522180 CTTCCTCCTTTATGCACTGAGGG - Exonic
949538178 3:5011907-5011929 CTTCCTCTGTCTTGCACTGGTGG + Intergenic
951699407 3:25479889-25479911 CTTCCTCGTTATTGCACTGCTGG - Intronic
955532947 3:59893289-59893311 CTTGCTCCTTATTGAACTACTGG - Intronic
961079604 3:124014862-124014884 TTTCCTCTTTATTGTACTTCAGG + Intergenic
965988775 3:174790104-174790126 CTTCATCGTTGATTCACTGCAGG - Intronic
970267146 4:14300774-14300796 CTTCCCCATTATTGGACTGTTGG - Intergenic
970448670 4:16145584-16145606 CTTTCTCTTTATTGCTCAGCTGG + Intergenic
970790888 4:19855980-19856002 TTTCTTTGTTCTTGCACTGCTGG - Intergenic
972684737 4:41341282-41341304 CTTCCTCTTTAATTCACTTCTGG - Intergenic
974849669 4:67389467-67389489 CTTCCTCCTTCCTCCACTGCAGG + Intergenic
977877743 4:102168803-102168825 TTTCCTCCTCATTGCACTTCTGG - Intergenic
979095263 4:116540800-116540822 CTTACTCATTATTCCACTTCAGG - Intergenic
980140871 4:128915018-128915040 CTTCTTTGGTGTTGCACTGCTGG + Intronic
989638584 5:43561333-43561355 CTACCTAGCAATTGCACTGCTGG + Intergenic
995055179 5:107751605-107751627 CTTTCTCGCTATTGGACTGTGGG + Intergenic
995952343 5:117731261-117731283 CTTCCTTGTAATTCCATTGCAGG + Intergenic
996682013 5:126238037-126238059 CTTCCTGATAGTTGCACTGCAGG - Intergenic
1000110210 5:158100735-158100757 TTTCCTCGTCAGTGCACTGAGGG + Intergenic
1000646991 5:163771017-163771039 CTTCATTGTTATTTCTCTGCAGG - Intergenic
1003157711 6:3610216-3610238 TTCCCTCGTCATTGCACTGGGGG - Intergenic
1013036872 6:106393463-106393485 CTTCCTTGGGCTTGCACTGCAGG + Intergenic
1015027208 6:128549621-128549643 CATCCTTGTAATTGCACTCCTGG + Intergenic
1018106474 6:160492121-160492143 CTTCTGCTTTATTGCAATGCAGG - Intergenic
1018107323 6:160501529-160501551 CTTCTGCTTTATTGCAATGCAGG - Intergenic
1018967469 6:168499819-168499841 CTCCTTCCTGATTGCACTGCTGG - Intronic
1019864639 7:3695825-3695847 CTTCCAGGTGATTACACTGCTGG - Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1024709474 7:51999211-51999233 CTTCCTCATAACTGCCCTGCAGG + Intergenic
1034881227 7:154764103-154764125 CTTCCTTGTTAAAGCATTGCTGG + Intronic
1037601134 8:20395182-20395204 CTTCCTGCTCATTGCACTGGTGG + Intergenic
1046827482 8:118707058-118707080 ATTCCTTGTTATTGCCCTGGGGG + Intergenic
1052247950 9:26361252-26361274 CTACCACATTATTGCACTACTGG - Intergenic
1053447376 9:38163575-38163597 CTCCCTCATTATTGCACAGGTGG + Intergenic
1054831737 9:69632867-69632889 CTTCCTCGTCCTTTCACTTCTGG + Intronic
1056357858 9:85820874-85820896 CTTCCTCATTGTTGAACTGAGGG + Intergenic
1058394560 9:104536087-104536109 CTTCCTGGTTCTTCCACTGATGG - Exonic
1058766076 9:108183955-108183977 CTTCCTCATTATTTCACTAATGG + Intergenic
1185526592 X:785024-785046 CTTCTTCGTGCTTGCACTCCGGG - Intergenic
1185551139 X:983275-983297 CCGCCTTGTTATTTCACTGCAGG + Intergenic
1186001489 X:5017019-5017041 TTTACTCATTATTCCACTGCCGG - Intergenic
1186918015 X:14244496-14244518 CCTCCTCCTAATTGCAGTGCTGG + Intergenic
1188913955 X:35887368-35887390 CCTCCTCGTTACTGCTATGCAGG + Intergenic
1195513854 X:105749003-105749025 CTTCCTCCTCCTTGTACTGCTGG + Exonic
1197120703 X:122888371-122888393 ATTCCTAGGAATTGCACTGCGGG - Intergenic
1198445836 X:136713271-136713293 CTTACTTGTTATTGGACTGCAGG + Exonic
1201687206 Y:16718687-16718709 AGTACTAGTTATTGCACTGCTGG - Intergenic