ID: 951702662

View in Genome Browser
Species Human (GRCh38)
Location 3:25511791-25511813
Sequence CTCTGTGCACAACTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 198}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951702657_951702662 3 Left 951702657 3:25511765-25511787 CCGCTAACCCTTCCTCACATGCT 0: 1
1: 0
2: 2
3: 22
4: 297
Right 951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 198
951702653_951702662 20 Left 951702653 3:25511748-25511770 CCCTGCCTTACTGCCTGCCGCTA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 198
951702660_951702662 -9 Left 951702660 3:25511777-25511799 CCTCACATGCTGAACTCTGTGCA 0: 1
1: 0
2: 2
3: 15
4: 206
Right 951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 198
951702652_951702662 21 Left 951702652 3:25511747-25511769 CCCCTGCCTTACTGCCTGCCGCT 0: 1
1: 0
2: 2
3: 33
4: 307
Right 951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 198
951702659_951702662 -5 Left 951702659 3:25511773-25511795 CCTTCCTCACATGCTGAACTCTG 0: 1
1: 0
2: 4
3: 38
4: 261
Right 951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 198
951702658_951702662 -4 Left 951702658 3:25511772-25511794 CCCTTCCTCACATGCTGAACTCT 0: 1
1: 0
2: 4
3: 22
4: 271
Right 951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 198
951702654_951702662 19 Left 951702654 3:25511749-25511771 CCTGCCTTACTGCCTGCCGCTAA 0: 1
1: 0
2: 1
3: 6
4: 100
Right 951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 198
951702655_951702662 15 Left 951702655 3:25511753-25511775 CCTTACTGCCTGCCGCTAACCCT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 198
951702656_951702662 7 Left 951702656 3:25511761-25511783 CCTGCCGCTAACCCTTCCTCACA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951702662 Original CRISPR CTCTGTGCACAACTTGAGGA TGG Intronic
903766392 1:25737564-25737586 CTCTGTGCCCAGCCTGAGGATGG + Intronic
904571732 1:31471117-31471139 CTCTGTGCACAGACCGAGGAAGG - Intergenic
907215588 1:52860810-52860832 CTCTGTGAACAGCCTGTGGAGGG - Exonic
907612905 1:55890368-55890390 CTCTGGGCCCTACTTGAGGGAGG - Intergenic
907769016 1:57441028-57441050 CACTGTGGACTACTAGAGGAAGG - Intronic
908751593 1:67429743-67429765 CTCTGCTCACAACCTGAGGCGGG + Intronic
910370487 1:86510426-86510448 CACTGTGGTCTACTTGAGGATGG + Intergenic
911326233 1:96472654-96472676 TTCTGTGCATAGCTTGATGAAGG + Intergenic
911535194 1:99091066-99091088 CACTGTGCTCTACTTGAGGGTGG - Intergenic
916245075 1:162679202-162679224 CTCTGGGGCCTACTTGAGGATGG - Intronic
916815446 1:168347630-168347652 CACTGTAGACAACTAGAGGAGGG - Intergenic
917586268 1:176430215-176430237 CACTGTCAAAAACTTGAGGAAGG + Intergenic
918291092 1:183108698-183108720 CACTGTGAAGCACTTGAGGAAGG + Intronic
1063444154 10:6098237-6098259 CACTGTGCACAACACGAGCAAGG - Intronic
1069571758 10:69498464-69498486 CTCTCTTCCCAACTTGAAGATGG + Intronic
1070657013 10:78278635-78278657 CTCTGAGGACAAATTGAGCAAGG - Intergenic
1071733323 10:88270564-88270586 CTCTGTGAGCAACTTGAGTCTGG + Intergenic
1074501927 10:114033390-114033412 TTCTGCCTACAACTTGAGGATGG + Intergenic
1075845964 10:125545198-125545220 CTATGTGGACAACTTGGGGCAGG - Intergenic
1076170310 10:128313675-128313697 CTTTCTGCACAACTTGGGGCTGG - Intergenic
1076718789 10:132383405-132383427 CTCCGTCCACAACCTGAAGAGGG + Intergenic
1076998311 11:310203-310225 CTCTGTGCATCTCTTGGGGACGG + Intronic
1077252116 11:1565329-1565351 CTCTGTGCAGAAGCTGAGCAAGG + Intronic
1077971422 11:7195590-7195612 CACTGTGAACTACTGGAGGAGGG + Intergenic
1078893683 11:15579590-15579612 CTCTGTGCCCACCTTGAGGGAGG - Intergenic
1081431923 11:42985854-42985876 CGCTGTGGACTACTAGAGGATGG + Intergenic
1081972272 11:47207701-47207723 CTCTGTGCCCAAGGTGAGGTTGG - Intergenic
1082913536 11:58405054-58405076 CACTGTGGACTACTAGAGGATGG - Intergenic
1083146543 11:60763970-60763992 CTCTCTGCACAACCTGAGGCAGG + Intronic
1085040707 11:73324723-73324745 TTCTGTGCCCACCTTGATGATGG - Intronic
1085303383 11:75471679-75471701 CTCTATGAACACCTTGAGCAAGG - Intronic
1086701150 11:89901346-89901368 CTCTGTGGACTACTTGAGGGTGG - Intergenic
1086705017 11:89943181-89943203 CTCTGTGGACTACTTGAGGGTGG + Intergenic
1090636009 11:128690991-128691013 CTCTGGGCCCAGCTTGGGGAAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091831273 12:3552713-3552735 CTCTGGCCACGCCTTGAGGAAGG - Intronic
1092602764 12:10084302-10084324 CCCAGTGCACAGCTTCAGGAGGG - Intronic
1095792089 12:46178526-46178548 ATAGGTCCACAACTTGAGGAGGG - Intergenic
1096808166 12:54153086-54153108 CTCAGTGCACACCTTGCAGAAGG - Intergenic
1097472395 12:60010723-60010745 CTCTGTGCACAATCAGAGGCAGG - Intergenic
1102126048 12:110481803-110481825 CTCTGTTTACAACTTGAAAAAGG + Intronic
1103335823 12:120188874-120188896 CTCTGTATACTACTTGAGAAAGG + Intronic
1106329349 13:28725064-28725086 CTCTAAGCACAAATTGTGGAAGG + Intergenic
1107558927 13:41543461-41543483 CTCTGGACACAATTTCAGGAGGG + Intergenic
1108066324 13:46581276-46581298 CTCTGTGTGCAACTGGAGTATGG + Intronic
1111646218 13:91034997-91035019 CTCTGTGGCCTACTTGAGGGTGG + Intergenic
1113711677 13:112469379-112469401 CTCTGTGCACCAGTTAAGAAAGG + Intergenic
1113874959 13:113588431-113588453 CCCTGTGCCCTACTTGAGGTTGG - Intronic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1118388772 14:65279555-65279577 CTCCGTGCTCATCTTGATGAAGG - Intergenic
1118687418 14:68304856-68304878 CTCTGTTCACCTCTTGAAGAAGG + Intronic
1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG + Intronic
1120312128 14:82842444-82842466 TTGTGTGCATATCTTGAGGAAGG + Intergenic
1121105913 14:91279668-91279690 CTCTGTGCAGTAATAGAGGAGGG - Intronic
1122435328 14:101691404-101691426 AGCTGTGCAGATCTTGAGGAAGG - Intergenic
1122986978 14:105216984-105217006 CTCTGTGCACAGCTTGCCGCTGG - Intronic
1123736850 15:23193645-23193667 CTCTCTCCCCAACTTAAGGAAGG - Intergenic
1124184723 15:27514402-27514424 TTCTGTCCACAACTTGAGTTTGG - Intronic
1124287549 15:28416622-28416644 CTCTCTCCCCAACTTAAGGAAGG - Intergenic
1125055995 15:35359375-35359397 TTCTGTCCAGAACTTGGGGAAGG - Intronic
1127392899 15:58521358-58521380 CCCTGTTCAGACCTTGAGGATGG - Intronic
1127597159 15:60497174-60497196 CTCTGTTTACAACAGGAGGAGGG - Intronic
1128621743 15:69157088-69157110 CTAAGTGCAAAACATGAGGAAGG + Intergenic
1128794675 15:70456892-70456914 CTTCGTGCACAATTTGGGGAGGG + Intergenic
1129726277 15:77903327-77903349 CCCTTTGCCCAACATGAGGAGGG + Intergenic
1130077802 15:80704710-80704732 CTCCATCCACAACTAGAGGAGGG - Intronic
1130123416 15:81071728-81071750 CACTGGGGACTACTTGAGGATGG - Intronic
1130381873 15:83378837-83378859 CTCTAAGCCCAACTTGAGAAAGG + Intergenic
1131788998 15:95944073-95944095 CTATGGGTACAAGTTGAGGAAGG - Intergenic
1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG + Intergenic
1132535105 16:475035-475057 CTCTGTACACACCTTCAGGAAGG - Intronic
1133502896 16:6382280-6382302 CCCTGTGCTAAACTTTAGGACGG - Intronic
1134089438 16:11383805-11383827 CACTGTCCACACCCTGAGGAGGG + Intronic
1136085588 16:27882613-27882635 CTTGGTGGACAACTTGAGGAGGG - Intronic
1136392204 16:29972866-29972888 ATGTGTGCAGAAATTGAGGAAGG - Intronic
1137545341 16:49399163-49399185 ATCCTTGCACAACTTGAGCAAGG - Exonic
1137858127 16:51817356-51817378 CGCTGGGGACTACTTGAGGATGG - Intergenic
1138277131 16:55743234-55743256 CTCTGTGGACAACTGGAGCTGGG + Intergenic
1138283021 16:55786413-55786435 CTCTGTGGACAACTGGAGCTGGG + Intergenic
1139175730 16:64684822-64684844 CTCTGTGCCCAACCTAAAGAGGG + Intergenic
1139931999 16:70535212-70535234 CTTTCAGCACAACTTGATGATGG - Intronic
1142715590 17:1745373-1745395 CTGGTTGCCCAACTTGAGGAGGG - Exonic
1149138916 17:53405824-53405846 CTCTGTCCACATCTTCAGAAAGG + Intergenic
1150457330 17:65317359-65317381 CTCTGGGCAGAAGATGAGGAAGG + Intergenic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1151563326 17:74882699-74882721 GGCTGTGCACACCTAGAGGAGGG + Exonic
1155968859 18:32061752-32061774 GTCTGTTCACATCTTGAGTATGG + Intronic
1163187542 19:15649598-15649620 CTTTGTGGACAGCTTCAGGAAGG + Intronic
1164603177 19:29577483-29577505 ATCTGTGCACAACAAGAGCATGG - Intergenic
925442882 2:3903605-3903627 CTCTGTGCACAACTAGAGAAAGG - Intergenic
925814841 2:7737345-7737367 CTCTGTGCAAAAGTTAGGGAAGG + Intergenic
926075363 2:9938356-9938378 CTCTGGGCACCACTGGAGGGGGG + Intergenic
927224593 2:20750992-20751014 CACTATGGACCACTTGAGGATGG + Intronic
932543054 2:72677191-72677213 ATCTGTGTACAACTACAGGAAGG - Intronic
935047733 2:99497403-99497425 CTCTGTGCACAGCCCAAGGAAGG + Intergenic
936235514 2:110739390-110739412 CTCCATGCACAACGTGAGGCTGG + Intronic
937656122 2:124378833-124378855 CTCTGTTTACATCTTGAGAAAGG + Intronic
939484461 2:142792765-142792787 CACTGTGGTCTACTTGAGGATGG + Intergenic
940374308 2:152940374-152940396 CACTGTGGTCTACTTGAGGAGGG + Intergenic
941127270 2:161599353-161599375 CACTGTGGACTACTAGAGGAGGG + Intronic
945017354 2:205533360-205533382 TTCTGTACAGAACTTGAAGATGG + Intronic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
946877092 2:224140116-224140138 CACTGTGACCAACTTGAGGCTGG - Intergenic
948413466 2:237782823-237782845 CTCTGATCACCACTTGTGGATGG + Intronic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1174268468 20:49349190-49349212 CTTTGAGTACAACTTGAAGAAGG + Intergenic
1174500823 20:50982662-50982684 CTCTGAGCACAATTTGAGCTGGG - Intergenic
1174915864 20:54653177-54653199 CTATGTTCACTACTTGAGGTAGG - Intergenic
1175515668 20:59568384-59568406 CTCTGTGCCCAGGTGGAGGAGGG + Intergenic
1175535955 20:59712557-59712579 CACTGTGAACTTCTTGAGGACGG + Intronic
1175910591 20:62403542-62403564 GTCTGTCCACACCTTGAGGTTGG + Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1177287076 21:19065253-19065275 CTCTGTGCAGGACTTGTGGCTGG - Intergenic
1177466967 21:21497194-21497216 CACTGTGGACTACTAGAGGATGG + Intronic
1178419487 21:32432187-32432209 CTCTGTGCATCACATCAGGAGGG + Intronic
1179707195 21:43188381-43188403 CTCTCGCCACAACTTGAGGTGGG + Intergenic
1180033095 21:45225569-45225591 ATCTGTGCACAATGTGAAGACGG - Exonic
1181047345 22:20221864-20221886 CTCTGTGCACAAAGAGAGGTGGG + Intergenic
1181088735 22:20457744-20457766 CTCTTTGCACATCCTGGGGAAGG + Intronic
1181132158 22:20738323-20738345 CTGTGTGCCCAACTTAAGCAGGG - Intronic
1182334555 22:29575069-29575091 CTCAGTGCCCAACCTGAGGTGGG - Intronic
1182474784 22:30571157-30571179 CTCAGTGCACCAAGTGAGGAAGG + Intronic
1182518255 22:30871103-30871125 CGCTGTGCACAACAAGGGGAGGG + Intronic
1183947455 22:41334719-41334741 GTCTGTGCACAACTCACGGAAGG - Intronic
1185044837 22:48523644-48523666 CTCTGTGCCCAACTTGGGCCAGG + Intronic
949910804 3:8906020-8906042 CTCTGTTCACAGCTTCATGATGG - Intronic
950019763 3:9779031-9779053 GTCTGGGAACAACTTGAGGCAGG + Intronic
950915700 3:16642934-16642956 CACTGTGTTCAACTGGAGGAAGG - Intronic
951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG + Intronic
951732524 3:25826184-25826206 CACTGTGTACTACTAGAGGAAGG + Intergenic
953464759 3:43109895-43109917 CTCTCTCCATAGCTTGAGGATGG + Intergenic
954313972 3:49791198-49791220 CTCTGCCCACAACGGGAGGAGGG - Intronic
957772819 3:84716436-84716458 CTCTGTGGACTACTAGAGGGTGG + Intergenic
958538651 3:95438483-95438505 CTCTGGGGACAGCTTGAGGTGGG - Intergenic
959670209 3:108968636-108968658 TTCTTTGCACAACTCCAGGAAGG + Intronic
960670253 3:120148737-120148759 CTCTGAGCAACACTGGAGGATGG - Intergenic
961133177 3:124487686-124487708 CACTGGGAACAACTTGAGGTTGG - Intronic
962668948 3:137685455-137685477 CACTGTGACCAACTTGAGGACGG + Intergenic
965813468 3:172614526-172614548 GTCAGTGCACAACATCAGGAGGG + Intergenic
966231489 3:177657351-177657373 CTCTGTGCACAATTAGGGCAAGG + Intergenic
966667595 3:182489330-182489352 CTCTGTGACCTACTTGGGGATGG - Intergenic
966885799 3:184377559-184377581 CTCTTTGCACAACTTGTGAAAGG - Intronic
972987322 4:44780405-44780427 CTCTGTCAACAAATTGAAGAGGG - Intergenic
978279447 4:106992484-106992506 CACAGAGCACAAATTGAGGATGG - Intronic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
984491146 4:180436634-180436656 CTCTGGGAACAATTTCAGGAAGG + Intergenic
987161649 5:15150852-15150874 GTCTGTGAGCAACTTGAGGGTGG + Intergenic
988367998 5:30326882-30326904 CTCTGTGGACTACTTGAGTTTGG - Intergenic
989182722 5:38594828-38594850 CTCTGTGGAAACCTAGAGGAAGG - Intronic
990408989 5:55521583-55521605 CTCTGTGTACCTTTTGAGGATGG + Intronic
990769594 5:59228237-59228259 CACTGGGGCCAACTTGAGGATGG + Intronic
992697365 5:79303349-79303371 CACTGTGCCCAGCCTGAGGAGGG + Intronic
995977434 5:118057207-118057229 TTCTGTGCAAAACTTCTGGATGG + Intergenic
1000078668 5:157822021-157822043 ATGTGTGCAAAACTTGAGGATGG - Intronic
1001263469 5:170254077-170254099 CTCTGTCCAGATCTTGAGTAAGG + Intronic
1001858233 5:175031366-175031388 CAATGTGCCCAACTAGAGGAGGG + Intergenic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1004538096 6:16522311-16522333 CTCTGTGCACCAGTTGCTGAGGG + Intronic
1004972438 6:20926007-20926029 CTCTGTTAATAACCTGAGGATGG + Intronic
1006915104 6:37588755-37588777 GTCTGTGCACGCCTTGAGGCTGG - Intergenic
1007167957 6:39841545-39841567 CATCGTTCACAACTTGAGGAGGG + Intronic
1007317359 6:41000124-41000146 CTTTGTGCCTCACTTGAGGATGG - Intergenic
1007947396 6:45838573-45838595 CTCTTGGCAAAACTGGAGGAGGG - Intergenic
1009713834 6:67361392-67361414 CACTGTGGACTACTAGAGGAGGG + Intergenic
1009815362 6:68726335-68726357 CTGTGTGCACATCTTGAGAAAGG - Intronic
1011650437 6:89501333-89501355 CTCCAAGCTCAACTTGAGGAAGG - Intronic
1015543799 6:134342302-134342324 CTCTCTGCACAGCTTGAGGTTGG - Intergenic
1020626990 7:10593341-10593363 CTCTGTGGACAAGTTTATGAAGG + Intergenic
1020684201 7:11273388-11273410 CTCTTTCCACCACATGAGGATGG - Intergenic
1022581678 7:31561371-31561393 CTCTGCCCACAGCTTCAGGAAGG - Intronic
1024136715 7:46416165-46416187 CTCTAGAAACAACTTGAGGAGGG - Intergenic
1029544516 7:101203174-101203196 CTCTGTGCAGAAGTTGGCGAAGG + Intergenic
1029881228 7:103812313-103812335 CTCTGTGCACAAGGTCAGAAGGG - Intronic
1030513915 7:110518495-110518517 GCCTGAGCAAAACTTGAGGAAGG - Intergenic
1030583966 7:111393432-111393454 TTTGGTGCAAAACTTGAGGAAGG - Intronic
1031114466 7:117653193-117653215 TTCTGTGCACAACTTCAAAATGG + Intronic
1032945668 7:136849492-136849514 CTCTTTGCACATCCTGAGGTTGG + Intergenic
1035227309 7:157440852-157440874 CACTTTGCACAACATGATGATGG + Intergenic
1036288341 8:7463993-7464015 CTCTCTGTATAACTTCAGGAAGG - Intergenic
1036333134 8:7847535-7847557 CTCTCTGTATAACTTCAGGAAGG + Intergenic
1036637317 8:10560254-10560276 CGCTGTGCAGAACTCCAGGATGG + Intergenic
1038317498 8:26500209-26500231 CTCTGTGGCCTACTTGAGGGTGG + Intronic
1038947565 8:32378049-32378071 CTCTGTGCCCACCCAGAGGAGGG + Intronic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1042835181 8:73073061-73073083 CTCTGTTGTCATCTTGAGGAAGG + Intronic
1046891844 8:119430653-119430675 CTATGTCCACAAAATGAGGATGG + Intergenic
1047478539 8:125258576-125258598 TTCTGTGTGCAACTGGAGGATGG + Intronic
1048343788 8:133561081-133561103 CTCTGGGCAAACCTTGAGTAAGG - Intronic
1049181174 8:141223208-141223230 CACTGCACACAACTTCAGGAAGG + Intronic
1050231950 9:3535849-3535871 CTCTGAGCAGAACATTAGGAAGG + Intergenic
1051108484 9:13608017-13608039 CTCCTTGCCAAACTTGAGGACGG - Intergenic
1052490504 9:29160948-29160970 CCCTGTGCACAACATCAGCAGGG - Intergenic
1052808777 9:33037736-33037758 CTTTGTTAACAAGTTGAGGATGG + Intronic
1054247665 9:62684091-62684113 CTCTGTGCACAACTCCTGCAGGG - Intergenic
1055694425 9:78868390-78868412 CTTTGAGCACACCTGGAGGATGG - Intergenic
1057719262 9:97518954-97518976 CACAGTGAACATCTTGAGGATGG - Intronic
1058593993 9:106595196-106595218 CTCTGCGGCCTACTTGAGGATGG - Intergenic
1059155480 9:111985109-111985131 ATCTGTGCAGAACTTCAGGCTGG + Intergenic
1061296409 9:129679217-129679239 CTTTGTTCACAAGATGAGGAAGG + Intronic
1062452037 9:136619889-136619911 CTCTGTGCGCAACCTCTGGACGG - Intergenic
1186638300 X:11428509-11428531 CTCTGGGCTCAACTTGTGGGAGG - Intronic
1187567181 X:20462622-20462644 GTCTGTGAGCAACTTGAGGGTGG + Intergenic
1188694092 X:33167297-33167319 CTCCTTGCACAACTTCAGGGAGG + Intronic
1188921340 X:35981681-35981703 CTTTGCGTACTACTTGAGGATGG - Intronic
1189619263 X:42818450-42818472 CTCTGTGCAGTGCTTGAGGCTGG + Intergenic
1192465447 X:71352197-71352219 GTCTGTGGACTACTAGAGGATGG - Intergenic
1192472842 X:71414285-71414307 GTCTGTGGACTACTAGAGGATGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195620522 X:106950055-106950077 ATCTGTGTTCAGCTTGAGGACGG + Intronic
1199602515 X:149550536-149550558 CTCTGGGGACAACTTGACCAAGG - Intergenic
1199647872 X:149928939-149928961 CTCTGGGGACAACTTGACCAAGG + Intergenic
1200800889 Y:7386351-7386373 TGCTGTGCCCTACTTGAGGAGGG - Intergenic
1201666549 Y:16463363-16463385 CTCTGGGACCTACTTGAGGATGG + Intergenic