ID: 951703124

View in Genome Browser
Species Human (GRCh38)
Location 3:25516147-25516169
Sequence AGGTGGGTTGATGCAATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951703124_951703132 20 Left 951703124 3:25516147-25516169 CCCCAAATTGCATCAACCCACCT 0: 1
1: 0
2: 1
3: 34
4: 162
Right 951703132 3:25516190-25516212 GCTATGCACTCCAAATTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 61
951703124_951703130 -3 Left 951703124 3:25516147-25516169 CCCCAAATTGCATCAACCCACCT 0: 1
1: 0
2: 1
3: 34
4: 162
Right 951703130 3:25516167-25516189 CCTAACTAGCTTTTTCTTTTAGG 0: 1
1: 0
2: 0
3: 24
4: 385
951703124_951703133 25 Left 951703124 3:25516147-25516169 CCCCAAATTGCATCAACCCACCT 0: 1
1: 0
2: 1
3: 34
4: 162
Right 951703133 3:25516195-25516217 GCACTCCAAATTAACAGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 65
951703124_951703134 26 Left 951703124 3:25516147-25516169 CCCCAAATTGCATCAACCCACCT 0: 1
1: 0
2: 1
3: 34
4: 162
Right 951703134 3:25516196-25516218 CACTCCAAATTAACAGGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 126
951703124_951703131 -2 Left 951703124 3:25516147-25516169 CCCCAAATTGCATCAACCCACCT 0: 1
1: 0
2: 1
3: 34
4: 162
Right 951703131 3:25516168-25516190 CTAACTAGCTTTTTCTTTTAGGG 0: 1
1: 0
2: 8
3: 82
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951703124 Original CRISPR AGGTGGGTTGATGCAATTTG GGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
903603572 1:24559000-24559022 AGGTGAATAGATGTAATTTGGGG - Intronic
905119794 1:35672845-35672867 AGGTGGGATGATGAGATGTGGGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906674771 1:47685288-47685310 AGGTGGGTGGAAGGAATTAGAGG + Intergenic
909322108 1:74302756-74302778 AGGTTGGTTCATGAAATTTAAGG + Intronic
912134228 1:106639803-106639825 ATGTTGATTGTTGCAATTTGAGG + Intergenic
915169912 1:153970304-153970326 AGGTGGGGTGAGGGAATCTGGGG + Intronic
915994737 1:160550917-160550939 AGGTGAGCTGATGCAATTCATGG - Exonic
916778766 1:167999645-167999667 AGGTTGGTTCATGCAGTTTAAGG - Intronic
918206820 1:182316846-182316868 AGGTGGCTTGATGGAATTCCAGG + Intergenic
919123372 1:193368268-193368290 AGGTTGGTTCATGCTATTTAAGG - Intergenic
919794197 1:201311372-201311394 AGGTTGGTTGACCCAGTTTGGGG + Intronic
922368679 1:224888770-224888792 AGGTGAGTTGCTGAGATTTGTGG - Intergenic
924123450 1:240825980-240826002 AGGTGGCTTAATGCACTTTTTGG + Intronic
1064715923 10:18176638-18176660 AGGTGGGTTGTAGCAAATGGTGG + Intronic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1068220306 10:54036087-54036109 AGGTGGGTTCATGAAATTTAAGG + Intronic
1068677138 10:59779792-59779814 AGGTGGGTGTATGCATTGTGAGG - Intergenic
1074629165 10:115230990-115231012 AGTTGGGATGATGAATTTTGTGG + Intronic
1074974746 10:118570990-118571012 GGCTGGCCTGATGCAATTTGAGG - Intergenic
1077072562 11:682718-682740 ATGTGGGTTGATGGAAATTGGGG + Intronic
1078893065 11:15574813-15574835 AGGTGGGTTAAGGCCATTTGAGG + Intergenic
1079531298 11:21457227-21457249 GGGTGGGTTGGTGAAATGTGTGG + Intronic
1080822404 11:35819872-35819894 TGGTGGGTTGATCCAATTCAAGG - Intergenic
1084020796 11:66416604-66416626 AGATGCATTGATGCAATTGGTGG - Intergenic
1084844745 11:71890133-71890155 AGGTGGTTTGATGCCCCTTGTGG - Intronic
1085173989 11:74470916-74470938 AGTGGGGTGGATGGAATTTGAGG + Intergenic
1086314044 11:85570814-85570836 AGTTGAGATTATGCAATTTGAGG - Intronic
1086471567 11:87118812-87118834 AGGTGGGTTCATGAGATTTAAGG - Intronic
1088312882 11:108478305-108478327 ATGTGGGTTGTTGCACTGTGGGG - Intronic
1088352270 11:108903295-108903317 AAGTGGATTCATGCAATATGTGG + Intronic
1091804058 12:3343383-3343405 AGGTGAACTGATGCATTTTGGGG + Intergenic
1093024526 12:14233900-14233922 AGGTGGGTTGCTGAGATTGGTGG - Intergenic
1095921097 12:47532326-47532348 AGGTGGGTGGATGGGTTTTGGGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096506635 12:52097895-52097917 AGGTGGTTTGATGCCCCTTGTGG - Intergenic
1096508884 12:52115936-52115958 AGGTGGTTTGATGCCCCTTGTGG + Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1105906430 13:24815015-24815037 AGGTGTGTGTATGTAATTTGGGG + Intronic
1106071691 13:26418161-26418183 AGGTGGGTTTATGAAATTTAAGG + Intergenic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108081895 13:46745776-46745798 TGGTGGGATGATGCCATTTTAGG + Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1108942283 13:55971649-55971671 AGGAGGGTGGATGGAATTAGAGG + Intergenic
1109188645 13:59299739-59299761 CCATGGGTTGATGCAATCTGTGG - Intergenic
1109285249 13:60400983-60401005 AATTGGGTTGAAGCATTTTGTGG + Intronic
1110468904 13:75835247-75835269 AAGTGGATTGATGCAACTTCTGG + Exonic
1111213977 13:85119413-85119435 AAGTGAGTTGGTGCAATGTGTGG - Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1113751197 13:112777623-112777645 AGCTGCATTGATGCAATTTGTGG + Intronic
1116242952 14:42370282-42370304 AGGGCAGTTGATTCAATTTGTGG - Intergenic
1118099750 14:62583781-62583803 ATGTGGTTTGGTGCTATTTGTGG - Intergenic
1122029310 14:98901052-98901074 AGGGGAGATGATGCAATTGGAGG - Intergenic
1124407736 15:29406850-29406872 AGGTGGGTTGTTGCTATATTTGG - Intronic
1127705116 15:61539390-61539412 AGGTTGGTTCATGAGATTTGAGG - Intergenic
1127850530 15:62908221-62908243 AGGTGGGCTGCTTCAAGTTGGGG - Intergenic
1128307129 15:66606122-66606144 AGGTGTGATGATGCTATCTGTGG + Intronic
1129595369 15:76959656-76959678 AGGCGGGTCGATGCAATCTGTGG + Intergenic
1132354647 15:101162473-101162495 CGGTGGCTGGATGCAAGTTGAGG + Intergenic
1133726660 16:8543703-8543725 AGGTGGGTTCATGCAATATAGGG - Intergenic
1133982121 16:10640853-10640875 AGGTGGCTAGATGAAAATTGTGG - Intronic
1135035065 16:19070247-19070269 AGGTGGGTTGGTGAAATTTGGGG - Intronic
1138707033 16:58926047-58926069 CTGTGGGTTGATGCAATATATGG + Intergenic
1140213378 16:72988201-72988223 TAGTGGGTTGATGTATTTTGTGG - Intronic
1141721394 16:85757729-85757751 AGTTGGGTTGTTTCCATTTGTGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1143406378 17:6680084-6680106 ACGTGGGCTGTTCCAATTTGGGG - Intergenic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1147049429 17:37780538-37780560 AGGTTGGTTGATGAGATTTAAGG + Intergenic
1148911046 17:50943030-50943052 AGGTGTGGTGATGCAATCTGTGG - Intergenic
1151082434 17:71344163-71344185 AGGTTGGTTGATTGAATTTTGGG + Intergenic
1152258053 17:79251806-79251828 AGGTGGGTTGGTGCCAGGTGTGG - Intronic
1152709043 17:81861082-81861104 AGTTGGGGTGACGCAATTTCCGG + Intergenic
1153521654 18:5959689-5959711 TGGTGGCTTGAAGCCATTTGCGG - Intronic
1153658119 18:7303436-7303458 AGGTGGTGTGATGCAACTGGAGG - Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1155915639 18:31554478-31554500 AGGTGGGTTTTTGTAATCTGTGG - Intergenic
1157076300 18:44471385-44471407 AGGTGGGTTAGTGCAATTGAGGG - Intergenic
1158007024 18:52684164-52684186 ATGTGGGTTTATTCACTTTGTGG + Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159740709 18:72166514-72166536 AGGTTGGTTCATGCAGTTTAAGG + Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
925104220 2:1276076-1276098 AGGTGGGTTCATGAAGTTTAAGG + Intronic
926855075 2:17246942-17246964 AGGTGGATTAATGTAATTTCTGG + Intergenic
929652003 2:43689282-43689304 AGGTGGGTGGATACAATCAGAGG + Intronic
929661447 2:43789465-43789487 AGGTGCTTTGATGCATTTTGAGG + Intronic
930686330 2:54312452-54312474 AGGTGGGTAGATGCAATGCTCGG - Intergenic
931617157 2:64171353-64171375 ACATGGGTTGATGCACTATGGGG + Intergenic
932353571 2:71050659-71050681 AGGTGGTTTGATGCCCCTTGTGG - Intergenic
933303697 2:80571183-80571205 AGGTGTGTTCATGCAGGTTGGGG + Intronic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
940089656 2:149901256-149901278 AGGTGGGTAGATCCCAGTTGGGG + Intergenic
940367484 2:152864118-152864140 GGGCTGGTTGCTGCAATTTGTGG + Intergenic
941908167 2:170737102-170737124 AGGTTGGTTGCTGCAGATTGTGG - Intergenic
944615421 2:201454025-201454047 AGATGGGTTCATCAAATTTGGGG + Intronic
945338676 2:208623426-208623448 ATGTGGGTAGATAAAATTTGGGG + Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1170904514 20:20501416-20501438 AGGTTGGTTCATGAAGTTTGAGG - Intronic
1170968262 20:21095575-21095597 AGGTTGGTTTATCCAATTTAGGG - Intergenic
1172286622 20:33745226-33745248 AGGTGGGTAGATGCTGTTGGTGG - Exonic
1173980123 20:47217569-47217591 AGGTGGGTGGGTGGGATTTGGGG - Intronic
1174301550 20:49585880-49585902 AGGTGGGTCCAAGAAATTTGGGG + Intergenic
1177332880 21:19684190-19684212 AGCTGGTGTGATGCACTTTGGGG + Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1179055963 21:37934497-37934519 AGGTTGGTTGGTTCCATTTGGGG - Intergenic
1179364486 21:40744115-40744137 AGGTGGGAAGATGGAATTGGAGG + Intronic
1179396609 21:41045909-41045931 AGGTGGGAAAATGGAATTTGGGG - Intergenic
1183008401 22:34923775-34923797 AGGTGGGTTCATGCAGTTTAAGG - Intergenic
951703124 3:25516147-25516169 AGGTGGGTTGATGCAATTTGGGG - Intronic
955081059 3:55658278-55658300 AGCTGGAGTGATGAAATTTGGGG - Intronic
955555885 3:60136714-60136736 TCGTGGGCTGATGCAATGTGCGG - Intronic
956405386 3:68923468-68923490 AGGTGGGTTGAGACAATATGAGG - Intronic
957076051 3:75603987-75604009 AGGTGGTTTGATGCCCCTTGTGG + Intergenic
957233570 3:77553802-77553824 GGGTTGGTTGATGAGATTTGAGG + Intronic
959521562 3:107327847-107327869 AGGTGGTCTGATGAAGTTTGTGG - Intergenic
961226298 3:125251126-125251148 ACGTGAGTTGATGGACTTTGTGG - Intronic
962426821 3:135277562-135277584 AACTGGAATGATGCAATTTGAGG + Intergenic
967603688 3:191418564-191418586 AGGTTGGTTCATGAAGTTTGAGG + Intergenic
967648695 3:191958792-191958814 GGGTTGGTTGCTGCAGTTTGTGG - Intergenic
967718666 3:192791724-192791746 AGGCGGGTTGAGGCAACCTGTGG - Intergenic
969729609 4:8946478-8946500 AGGTGGTTTGACGCAACTTGTGG - Intergenic
970282173 4:14469343-14469365 AAGTGTGTTGTTGCAAATTGAGG - Intergenic
970725316 4:19036989-19037011 AGGTGTGATGCTGCAATATGTGG - Intergenic
973532384 4:51845334-51845356 AGGTGGGTTAGTGGAATTTAGGG + Intronic
975156455 4:71078173-71078195 AGATGGTTTGATGCATTTTGAGG - Intergenic
975545905 4:75560434-75560456 AAGTGGGTTGATGCCATTTATGG - Intronic
979368310 4:119851649-119851671 ATGTGGGTAGATGGCATTTGAGG + Intergenic
981234783 4:142402342-142402364 AGGAAGGATGATGCAATTGGAGG + Intronic
982021764 4:151211831-151211853 AGGTTGGTTCATGCAATTTAAGG + Intronic
983413324 4:167424861-167424883 AGGTGGGCTGATGCTATCAGTGG - Intergenic
983680324 4:170345887-170345909 AGGTGGGTAAATGCTATTTGTGG - Intergenic
983793937 4:171836326-171836348 AGGTGAGCTGATGAACTTTGGGG + Intronic
983801520 4:171935808-171935830 AGGTGTGTAGATGAATTTTGTGG + Intronic
986406524 5:7430971-7430993 AGATGTGTTGATCAAATTTGGGG - Intronic
986408448 5:7450485-7450507 AGGTGGCTTCATGAGATTTGAGG + Intronic
989287789 5:39722202-39722224 AAGTTGGTTGATGAAATTTAAGG - Intergenic
990103515 5:52224098-52224120 AGGTTAATTGATGCAATTTGAGG - Intergenic
991241038 5:64459945-64459967 GGGTGGGTTGAATCTATTTGAGG - Intergenic
992062468 5:73068159-73068181 GAATGGGTTGATGTAATTTGGGG - Intronic
995053999 5:107739014-107739036 ATGTGGGTGCATGCAAGTTGAGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
997157478 5:131575195-131575217 AGGTGGGTTGCTGAGATTGGTGG - Intronic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
998510345 5:142708196-142708218 AGGTTGGTTCATGAAATTTAAGG + Intergenic
1000633207 5:163614487-163614509 AGGTGGGTGCATGGATTTTGGGG + Intergenic
1002405993 5:179031997-179032019 AGGTGGGCTGAGGAAATTAGGGG - Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1003473220 6:6456757-6456779 AGGTTGGTTCATGAAATTTAAGG + Intergenic
1004471099 6:15929784-15929806 AGGTGGTTTGATGTAAATTAAGG + Intergenic
1005418049 6:25622238-25622260 AGGTGGGTGGATGAACTTTGAGG + Intergenic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1008378406 6:50817536-50817558 AGGAGGGATGGGGCAATTTGGGG - Intergenic
1008987369 6:57561191-57561213 AGGTGGGTTTATGAGATTTAAGG - Intronic
1010055753 6:71561829-71561851 AGGTTGGTTCATGCATTTTAAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1013337510 6:109179318-109179340 ATCTGGGTTGTTTCAATTTGGGG - Intergenic
1014590638 6:123263362-123263384 AGGTTGGTTCATGAAATTTAAGG + Intronic
1017181922 6:151562790-151562812 AGGTGCCTTGATGCGTTTTGGGG + Intronic
1018574601 6:165246132-165246154 ATTTGGGTTGTTACAATTTGGGG + Intergenic
1020473426 7:8566031-8566053 AGGTGGGATGATGCCAGATGAGG + Intronic
1023223604 7:37946259-37946281 TGGTGGGTTGATGGTATTTCTGG + Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1024757217 7:52548992-52549014 TGTTGGGTTTATGCTATTTGTGG + Intergenic
1025313585 7:57986205-57986227 TGGAGGTTTGGTGCAATTTGCGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029448478 7:100627670-100627692 AGGTGGGTTGGAGCGATCTGTGG + Intronic
1030028807 7:105350357-105350379 AGGTGGGTGGATGCGAGTTCAGG - Intronic
1031548180 7:123076366-123076388 AGGTTGATTGATGCAGTGTGTGG - Intergenic
1031912926 7:127536496-127536518 AAATGGGATGCTGCAATTTGTGG - Intergenic
1036911963 8:12765209-12765231 GGGTGCGTTTATGCAGTTTGTGG + Intergenic
1037780701 8:21867081-21867103 AGGTGGGATGATGCGATTGGGGG + Intergenic
1041131244 8:54703856-54703878 AGGTTGGTTGATGAAGTTTAAGG - Intergenic
1041208838 8:55525842-55525864 AGGCAGGCTGATGGAATTTGTGG - Exonic
1045297957 8:100888706-100888728 TGGTGGTTTGATGCAATCTTTGG + Intergenic
1051607005 9:18926365-18926387 AGGTGGTTTGATGTGGTTTGTGG + Intergenic
1053023298 9:34710108-34710130 AGGTGGGCAGCTGCAAGTTGGGG + Exonic
1054797560 9:69316857-69316879 TGGTGGGTGGATGCAGTCTGGGG - Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1055174842 9:73305001-73305023 AGATGGGTTCAAGCAATTTGGGG + Intergenic
1055187385 9:73473169-73473191 AGGTAGCATGATGCAATTTAGGG + Intergenic
1055774317 9:79751696-79751718 GGGTGCGTTGATGCAAGATGTGG + Intergenic
1058789734 9:108431135-108431157 ATTTGTGTTGATGTAATTTGTGG + Intergenic
1059857961 9:118422219-118422241 AGGTGGGTAGATTAAATTTTTGG + Intergenic
1060042208 9:120309442-120309464 AGGTGTGGTAATGCTATTTGAGG + Intergenic
1186204630 X:7188425-7188447 GGTTTGGTTGTTGCAATTTGGGG - Intergenic
1186858665 X:13649597-13649619 AGGTTGGTTTAAGCAATCTGTGG + Intergenic
1190112114 X:47597463-47597485 AGGTGAGATGATCCAATCTGAGG + Intronic
1191951679 X:66599840-66599862 AGGAGGTTTGCTGCAGTTTGAGG - Exonic
1193518065 X:82494653-82494675 AGGAGGGTTGATCTATTTTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1198301470 X:135337940-135337962 AGGAAAGATGATGCAATTTGAGG + Intronic
1198501681 X:137255796-137255818 AGGTGGGTAGATGACATTTAAGG - Intergenic
1200119212 X:153782560-153782582 AGTTGGGATGGTGCATTTTGTGG - Intronic