ID: 951703530

View in Genome Browser
Species Human (GRCh38)
Location 3:25521360-25521382
Sequence GTGTGATGAGTTTGGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951703530_951703535 -5 Left 951703530 3:25521360-25521382 CCTCCCATCCAAACTCATCACAC 0: 1
1: 0
2: 0
3: 26
4: 199
Right 951703535 3:25521378-25521400 CACACACGTTCCTGTTTCAAGGG 0: 1
1: 0
2: 2
3: 6
4: 116
951703530_951703534 -6 Left 951703530 3:25521360-25521382 CCTCCCATCCAAACTCATCACAC 0: 1
1: 0
2: 0
3: 26
4: 199
Right 951703534 3:25521377-25521399 TCACACACGTTCCTGTTTCAAGG 0: 1
1: 0
2: 0
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951703530 Original CRISPR GTGTGATGAGTTTGGATGGG AGG (reversed) Intronic
900692028 1:3986807-3986829 GTGTTAGGAGTCTGGGTGGGGGG + Intergenic
901011464 1:6205090-6205112 GAGGGATGGGTTTGGGTGGGAGG - Intronic
902129486 1:14246642-14246664 GAGTAATTAGTTTGGCTGGGGGG - Intergenic
908106710 1:60852029-60852051 GTGTGTTGAGTTGTGTTGGGTGG + Intergenic
908261318 1:62341381-62341403 GTGTGAGGAGTATGGAAGTGGGG - Intergenic
909306086 1:74079244-74079266 ATGAGATGAGTTTGGCTGTGTGG - Intronic
909346407 1:74592738-74592760 CTGAAATGAGTTTGTATGGGAGG - Intronic
911244743 1:95504372-95504394 GTGTGGGAAGTTGGGATGGGTGG + Intergenic
912205957 1:107509951-107509973 GTTGGAAGAGTTTGGAGGGGTGG + Intergenic
913108976 1:115641441-115641463 GTGTGTTGAGTGGGGTTGGGGGG + Intergenic
915622846 1:157096587-157096609 GTGTGTAGAGTTTGGGTTGGAGG - Intronic
915951824 1:160194634-160194656 GTGTGATGTGTGTGAATGTGTGG - Intronic
916064942 1:161128776-161128798 GTTTGATGGGTTTGGATGGAGGG - Intronic
916715517 1:167443781-167443803 GTGTGCTGTGTGTGGTTGGGTGG + Intronic
920440030 1:205974347-205974369 GTGTGCTGTGTTTGCATGTGTGG - Intergenic
920920604 1:210294540-210294562 GTGTAATGAGTGAGGGTGGGGGG + Intergenic
922128515 1:222753865-222753887 TTGTGATGATTTTGGAGGTGGGG + Intergenic
922206949 1:223456355-223456377 GTGTGGTGGGGGTGGATGGGTGG - Intergenic
922348197 1:224714651-224714673 GTCTGTTGAGTGTGGATGGATGG + Intronic
923119266 1:230975904-230975926 GTGTGTTGTCTTTGGATTGGTGG + Intronic
1064498084 10:15937046-15937068 GGGTTATGAGTTTTGGTGGGGGG + Intergenic
1066449606 10:35516753-35516775 GAGTGATAAGATTGGATGGGTGG + Intronic
1069884883 10:71617428-71617450 GGGTGGTGGGTCTGGATGGGTGG - Intronic
1070418948 10:76217477-76217499 GAGTGATGAGTTCTGATGTGAGG + Intronic
1070468464 10:76750152-76750174 GTGTGGTGAGTTGGGAGGGGAGG - Intergenic
1073271524 10:102268633-102268655 TTGTCCTGAGTTTGAATGGGTGG - Intronic
1075794945 10:125113288-125113310 GTGAGATGGGTTTTGAAGGGTGG - Intronic
1076874475 10:133209052-133209074 GTGTGATGTGTGTGCATGTGTGG + Intronic
1077477915 11:2799457-2799479 GTGTGGTGTGTTTGTATGTGAGG + Intronic
1078088929 11:8251762-8251784 GTGTGGTGTGTGTGGAGGGGTGG + Intronic
1078253414 11:9637143-9637165 ATGGGATGAGTGTGGGTGGGTGG + Intergenic
1081284794 11:41254666-41254688 GTGTAAGGAATTTGGATGTGAGG + Intronic
1082779333 11:57274289-57274311 GTGGAATGAGTGTGGATGTGTGG - Intergenic
1083766212 11:64842793-64842815 GAGTGATCAGTCAGGATGGGGGG + Intronic
1084022739 11:66427439-66427461 ATGAGATGATTTGGGATGGGTGG - Intergenic
1084367370 11:68711179-68711201 GTGTGTTGAGTGTGAATGTGTGG + Intronic
1084488308 11:69463891-69463913 GTGTGATGATTTGGGGCGGGGGG - Intergenic
1084868440 11:72079624-72079646 GTGTGAAGATTGTGGGTGGGCGG - Intronic
1084916123 11:72430225-72430247 GTGTGATGACTTTGCTTTGGAGG - Intronic
1086535689 11:87842346-87842368 ATGTGCTGAGTTTGGGAGGGGGG + Intergenic
1087322055 11:96675079-96675101 GTGGGAGAAGTTTGGATGGGTGG - Intergenic
1088609136 11:111560413-111560435 GAGTAAGGAGTCTGGATGGGTGG + Exonic
1088609491 11:111563695-111563717 GTGTGCTGAGCTTAGATGGAAGG - Intergenic
1090855230 11:130605184-130605206 GTCTGCTGTGTTTGGATTGGTGG + Intergenic
1091028494 11:132162471-132162493 GTGTGGGAAGTGTGGATGGGGGG + Intronic
1091585610 12:1814635-1814657 GTGTGCAGACGTTGGATGGGAGG - Intronic
1091776797 12:3189944-3189966 GTGAGAGGTGTCTGGATGGGTGG - Intronic
1092219764 12:6705002-6705024 GAGTGATGACTTTGGGTGGGTGG - Intergenic
1096007092 12:48182590-48182612 GTGTGGAGGGTATGGATGGGGGG - Intergenic
1097018868 12:56006231-56006253 GAGGGATGACTTTGAATGGGAGG - Intronic
1097123182 12:56752140-56752162 GTGTGAGGAGGTTGGAGGCGGGG - Intronic
1098784870 12:74739999-74740021 GTGTTATCAGTTTGGGTGGCTGG - Intergenic
1098823360 12:75261437-75261459 GTGTGATGGGTTGGGAAGGGAGG - Intergenic
1101560215 12:105850259-105850281 CTGTGATGAATTTGGGAGGGAGG - Intergenic
1101787779 12:107900735-107900757 GTGGGAGGAGATTGGATGGTGGG + Intergenic
1104138426 12:125962694-125962716 GTGTGAGGTGATTGGATTGGGGG - Intergenic
1104590302 12:130079405-130079427 GTGAGATGAGGTTGGAAGGGAGG + Intergenic
1105834202 13:24193920-24193942 TTGTGATGAGTTTAGAAGGGTGG + Intronic
1105853522 13:24357328-24357350 GTGTGATGAGTTTGTGTGTGTGG - Intergenic
1110331797 13:74281406-74281428 GTGTGATAAGTGTGGATGCAAGG + Intergenic
1110345941 13:74448023-74448045 GTGGGGTGTGTGTGGATGGGTGG + Intergenic
1112701086 13:102009263-102009285 ATGTGAACAGTTTAGATGGGTGG + Intronic
1113518071 13:110918416-110918438 GAGTGATGACTTGGGATGGAGGG + Intergenic
1115770053 14:36658519-36658541 CAGTGATGACTGTGGATGGGAGG - Intronic
1116535154 14:46018121-46018143 ATTTGATGAGTTTGGAAGAGAGG - Intergenic
1116934717 14:50727613-50727635 GTGTGGTGTGTGTGCATGGGTGG + Intronic
1120603002 14:86536041-86536063 ATGTGAAGAGTTTGTTTGGGAGG + Intergenic
1122484450 14:102069279-102069301 GTGCATTGAGTGTGGATGGGTGG + Intergenic
1123054674 14:105563638-105563660 GTGGGATGTGTGTGGATGTGTGG + Intergenic
1124648729 15:31459017-31459039 GTGTGGCGAGTGTGGAAGGGGGG - Intergenic
1125185693 15:36927240-36927262 GTCTGATGAGTGATGATGGGGGG + Intronic
1125443334 15:39726726-39726748 GGGTGATCAGTCTGGCTGGGTGG - Exonic
1126035176 15:44538571-44538593 GTCCGATGAGGTTGGATGTGTGG + Intronic
1126876171 15:53044180-53044202 ATGTGATGAGTTTGGATACATGG - Intergenic
1129385420 15:75193553-75193575 GTGTGTGGAGTGTGGAGGGGCGG - Intergenic
1130253697 15:82316170-82316192 GTGAGATGAGATTGGCTGGGAGG + Intergenic
1132088123 15:98924447-98924469 GTGTGGTGAGTTTAGTTGGCAGG + Intronic
1134260070 16:12644006-12644028 GAGGGATGAGTGTGGAGGGGGGG + Intergenic
1135184885 16:20307053-20307075 ATGAAATGAGTTAGGATGGGTGG + Intergenic
1141369275 16:83472280-83472302 GTATTGTGAGTCTGGATGGGAGG + Intronic
1141620263 16:85233630-85233652 ATGTGGTGTGTGTGGATGGGGGG + Intergenic
1143158455 17:4853347-4853369 GTGGGAAGAGTGTGGTTGGGGGG + Intronic
1143462575 17:7113259-7113281 GTGGGGTGAGTTGGGATGGGTGG - Intronic
1146705702 17:34999271-34999293 GTGAGATGAGTGTGGGTTGGAGG - Intronic
1147369824 17:39984693-39984715 GGGAAATGAGTTTGGCTGGGAGG - Intronic
1148612270 17:48972269-48972291 GTGTGTTGGGTTGGGTTGGGGGG + Intergenic
1152226807 17:79096541-79096563 GTGGGATGGGATGGGATGGGAGG + Intronic
1152367155 17:79862955-79862977 GTGCGAGGAGTTTGGATGCGGGG + Intergenic
1153240727 18:3029289-3029311 GTGTGTTGTGTTTTGAGGGGAGG - Intergenic
1156451403 18:37268303-37268325 GTGTGATGTGCTTGGGAGGGTGG + Intronic
1157905637 18:51567509-51567531 GACTGATGAATTTGGAAGGGAGG - Intergenic
1159904359 18:74076796-74076818 GTGCAATGAGGTGGGATGGGCGG - Intronic
1160031402 18:75263822-75263844 GTGTTTTGAGTTTGGAGGGGAGG + Intronic
1160376869 18:78420332-78420354 GTGGGATGAGTGTGGCTGGCAGG - Intergenic
1160739949 19:681035-681057 GTGGGTGGAGTTTGGGTGGGCGG + Intronic
1161511231 19:4673002-4673024 GTGTGATGATTTGTGGTGGGTGG - Intergenic
1161901147 19:7120597-7120619 GTGAGTTGTGTGTGGATGGGTGG - Intronic
1162799947 19:13104796-13104818 GAGTGTTGAGTCTGTATGGGAGG - Intergenic
1163099088 19:15082754-15082776 GTATGATGAGTTTGGGAGCGGGG + Intergenic
1163566720 19:18056188-18056210 GAGTGATGAGTGGGGATGTGAGG - Intergenic
1163860093 19:19738218-19738240 GTGGGCTGAGTTTGGGCGGGGGG + Intergenic
1164638179 19:29806617-29806639 GTGTGATGAGGTTGGGGAGGTGG - Intergenic
1166327463 19:42059920-42059942 ATCTGATGTGTTTGGAAGGGAGG - Intronic
1167427874 19:49438724-49438746 GGGTGATGGGTTCTGATGGGTGG - Intronic
1167734916 19:51288198-51288220 GTGTGATGTGTTAGGGTGGTTGG + Intergenic
925287951 2:2728153-2728175 GTGTGATGTGTATTTATGGGTGG - Intergenic
925696567 2:6586225-6586247 GTGAGTTGAGCTTGGATGTGAGG + Intergenic
925914830 2:8597440-8597462 GTGTGGTGTGTTTGCATGTGTGG + Intergenic
926152623 2:10433249-10433271 GTGTGGTGTGTTTGGGTGTGTGG + Intergenic
926152632 2:10433315-10433337 GTGTGGTGTGTTTGCATGTGTGG + Intergenic
926152850 2:10434487-10434509 GTGTGGTGTGTTTGCATGTGTGG + Intergenic
927005878 2:18847915-18847937 TTATGGTGAGTTTGGGTGGGTGG + Intergenic
927662583 2:25005384-25005406 GTCAGATGAGATTGGATGGTGGG + Intergenic
928115346 2:28542150-28542172 GTGTGAAGAGTGTGGTGGGGAGG + Intronic
929904198 2:46031914-46031936 GTGAGATGAGTTTGTGTGGGTGG - Intronic
930199564 2:48540197-48540219 TTTTGAAGTGTTTGGATGGGAGG + Intronic
930301950 2:49627728-49627750 GTGCAATGAGTTTGAATGTGAGG - Intergenic
932575423 2:72960019-72960041 GTGTGATCAGGGTGGGTGGGGGG - Intronic
935253113 2:101282913-101282935 GTGTCAGGAGTAGGGATGGGAGG - Intronic
935617570 2:105102195-105102217 GTGTGCTGAGATGGGATGGCGGG + Intergenic
935717027 2:105948117-105948139 CTGTGATGTGTTATGATGGGAGG + Intergenic
936411300 2:112260485-112260507 GTGTGAGGAGATGGGAAGGGGGG + Intergenic
938798850 2:134741337-134741359 GAGAGATGAGTTTGGAAGAGTGG + Intergenic
940047458 2:149424611-149424633 GTGTGAGGAGAGGGGATGGGAGG + Intronic
943813897 2:192226576-192226598 CTGTGAAGAGTTTAGTTGGGTGG + Intergenic
944393697 2:199246192-199246214 GGGTGAGGAGTTTGGGTGTGGGG - Intergenic
946216135 2:218185239-218185261 GGGTAATGAGGTGGGATGGGGGG - Intergenic
947430167 2:230021102-230021124 GTGTGGTATGTGTGGATGGGGGG - Intergenic
948274679 2:236699304-236699326 GTGTGGTGTGTGTGTATGGGGGG + Intergenic
948817361 2:240519227-240519249 GTTTCTTGAGTGTGGATGGGTGG + Intronic
948985087 2:241516710-241516732 GTGTGTTGAGTGTGTATTGGGGG - Intergenic
948985162 2:241517161-241517183 GTGTGTTGAGTGTGTATTGGGGG - Intergenic
949053554 2:241911263-241911285 GTGTGTTGGGTTTGTGTGGGGGG - Intergenic
1168850732 20:975190-975212 GGGTGATCAGGTTGGATAGGTGG - Intronic
1168978659 20:1986868-1986890 GTGTGATGGGAGTGGATGAGTGG - Intronic
1170346295 20:15390328-15390350 GGGGGATGAACTTGGATGGGTGG - Intronic
1170658805 20:18316279-18316301 GTCTGATGAGGTTGGATTGCTGG - Exonic
1171049308 20:21840470-21840492 GGGTGAGGAGTTTGTATGGGAGG - Intergenic
1174904091 20:54531953-54531975 GTGTTCTGAGTGTGGATGAGAGG + Intronic
1175390377 20:58623416-58623438 GTGTGATGTGTGTATATGGGTGG + Intergenic
1175845024 20:62053671-62053693 GGGGGATGAGTTTGGTTGGTTGG - Intronic
1178309339 21:31516619-31516641 GTGTGTTGAGTTTTGCAGGGTGG - Intronic
1178566020 21:33686469-33686491 AAGTGATGAGTCTGGCTGGGTGG + Intronic
1179328918 21:40379517-40379539 GTGTGAGGTATTTGGAGGGGAGG - Intronic
1180024971 21:45155877-45155899 GGGTGATGAGGGTGGGTGGGTGG - Intronic
1183766109 22:39876640-39876662 GTTGGATGAATTTGGATGAGTGG - Intronic
1184744662 22:46449321-46449343 GTGTGATGTGGTTGGATGGATGG - Intronic
951703530 3:25521360-25521382 GTGTGATGAGTTTGGATGGGAGG - Intronic
952769988 3:36991123-36991145 TTGTGATCAGTTTGGACGGCTGG + Exonic
953469602 3:43155560-43155582 GTGTGAGGTGCTGGGATGGGAGG + Intergenic
953929959 3:47000911-47000933 GGGTGCTGAGTGGGGATGGGTGG + Intronic
954220405 3:49150165-49150187 ATGTCAGGAGTGTGGATGGGTGG - Intergenic
954597207 3:51836483-51836505 GTGTGAGTAGTTTGGTTGAGAGG + Intergenic
955760971 3:62282067-62282089 GTGGGATGAGTAAGCATGGGGGG + Intronic
955945221 3:64187402-64187424 GAGAGATGAGTTGGGAAGGGAGG - Intronic
956407039 3:68938612-68938634 GTTGGATGAGTTTGGATTAGAGG + Intergenic
961091213 3:124114250-124114272 GTATGATGGATTTGGATGGGAGG + Intronic
962829685 3:139129086-139129108 GGGTGATGACATTGGAAGGGTGG + Intronic
964661879 3:159129013-159129035 GTGTGATGAGTTGGTATGCGTGG - Intronic
966888249 3:184388463-184388485 AGGTGATAAATTTGGATGGGTGG - Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
972241229 4:37195067-37195089 ACGTGAAGAGTTTGGAAGGGAGG - Intergenic
973555917 4:52082945-52082967 GTATGATGTGTATGGAGGGGAGG + Intronic
982170824 4:152660265-152660287 GTATGATGAGGTTGGGTGTGGGG + Intronic
982685551 4:158484495-158484517 TTTAGATGACTTTGGATGGGAGG + Intronic
982916526 4:161216985-161217007 GTGTGATGACATAGGATGCGTGG + Intergenic
983732473 4:171012469-171012491 GTGTGAGGAGTTTGGATTGTTGG - Intergenic
984568405 4:181359560-181359582 ATGTGGAGAGTTTGGATAGGTGG + Intergenic
984700049 4:182813397-182813419 GTGTGGTGAGTGTGCATGTGTGG - Intergenic
984700060 4:182813504-182813526 GTGTGGTGAGTGTGCATGTGTGG - Intergenic
984700067 4:182813578-182813600 GTGTGGTGAGTGTGCATGTGTGG - Intergenic
985211684 4:187602600-187602622 GTGTGCTGAGTGTGGGTGCGTGG - Intergenic
985825032 5:2185431-2185453 GTGTGATGAGAAAGGATGAGGGG + Intergenic
985838622 5:2289244-2289266 GTGGGAGGTGTTTGGATGGTGGG - Intergenic
986206970 5:5633978-5634000 GGGTGATAAGTGTGGGTGGGTGG - Intergenic
987206629 5:15634225-15634247 GTGTGGGGAGGTGGGATGGGAGG + Intronic
987921129 5:24283301-24283323 GTGTGGTGTGTGTGGGTGGGTGG - Intergenic
989241615 5:39209006-39209028 GTGTGATGAGAAGGGATGGAGGG - Intronic
995523933 5:113035720-113035742 GGGACATGAGTTTAGATGGGTGG - Intronic
997197793 5:131991209-131991231 GTGTGTGGAGTTTGTATGTGGGG - Intronic
998519757 5:142789517-142789539 GTGAGATGGGTTGGGATGGGAGG - Intronic
1000459784 5:161500264-161500286 GTTTTATGAGTTTGGTTGGTTGG + Intronic
1000985157 5:167858437-167858459 GAGTGAGGAGTTTGCATGTGAGG - Intronic
1002803880 6:552879-552901 TTGTCATGAGTTTGAAGGGGGGG - Intronic
1003948422 6:11095855-11095877 TTGTGATATGTTTGGATGTGGGG + Intronic
1003991935 6:11494802-11494824 GTGTGATGAGGTAGGCAGGGAGG - Intergenic
1004118726 6:12797695-12797717 GTGTGATGAGTGAGGAAGAGAGG - Intronic
1005419760 6:25636951-25636973 GTGTTAGGTGTTAGGATGGGAGG - Intergenic
1005470757 6:26160041-26160063 CTGTGATGGGTTTGTATGTGTGG - Intronic
1008537833 6:52520748-52520770 CTGTGATGGGGTGGGATGGGGGG - Intronic
1008708860 6:54198920-54198942 GTGTGAAGAGAGTGGATGTGTGG + Intronic
1015670611 6:135685685-135685707 CTGTGATGGGTTTGGATGAGTGG + Intergenic
1015842831 6:137492101-137492123 GGGTGAGGAATTTGGATGGGTGG - Intergenic
1016618548 6:146080664-146080686 GTGGGATGGGGTTGGGTGGGAGG + Intronic
1017362759 6:153595288-153595310 GTGTGTTTGGGTTGGATGGGGGG + Intergenic
1018658352 6:166062194-166062216 GGGTGATGAATTTGGATGTCTGG - Intergenic
1019433701 7:1011244-1011266 GTGTGTTGGGTATGGGTGGGTGG - Intronic
1022120073 7:27299493-27299515 GTGGGATGAGTTCGGAAGTGAGG + Intergenic
1024466314 7:49714664-49714686 GTCAGATTAGTTTTGATGGGAGG + Intergenic
1024802706 7:53099475-53099497 GTGTGAAGAGTTTTCCTGGGTGG - Intergenic
1024992748 7:55249103-55249125 GTGTGGCTAGTTTGGTTGGGAGG - Intronic
1027613003 7:80386066-80386088 GTGTGAGGAGTAAGGATGAGAGG + Intronic
1027651652 7:80875608-80875630 GTGTGATGGAGTTGGATGGAGGG - Intronic
1028245257 7:88469166-88469188 GTGTGATGAGGTTGGAGCGGAGG - Intergenic
1028923572 7:96332746-96332768 GTATGATGAATTTGGTTGGAGGG + Intergenic
1033629884 7:143147334-143147356 GTCTGATGATTTTGGTTGAGTGG + Intergenic
1035140695 7:156757628-156757650 GTGTGAGTAGTTTGGATGTGAGG - Intronic
1038633994 8:29270848-29270870 GTGTGAAGAGTATGGAAGAGCGG - Intergenic
1041462918 8:58131494-58131516 GTTTCATGAGTTTGGAGAGGAGG - Intronic
1048166960 8:132070623-132070645 GTGTAATGAGTTGAGATGAGTGG - Intronic
1048254804 8:132897737-132897759 GTGTGATGCGTTTGGAAGTTGGG + Exonic
1048300951 8:133250782-133250804 AAGTAATGAGTTTGGAAGGGTGG - Intronic
1050362110 9:4839964-4839986 ATTTGGTCAGTTTGGATGGGTGG + Intronic
1053504369 9:38628855-38628877 GTGTGGTGTGTGTGTATGGGGGG - Intergenic
1057335319 9:94150596-94150618 GTGTGAGAAGGTTGGATGGTTGG + Intergenic
1058006290 9:99918886-99918908 GGGTGAGGAGCTTGGAGGGGTGG + Intronic
1060716497 9:125935039-125935061 GTGAGATGAGTCTGGAAGGATGG - Intronic
1187378630 X:18780204-18780226 GTGTGATGAGTTTGTAAAGGGGG + Intronic
1187571822 X:20511720-20511742 GTGTGATCACTTTGGCTGGCTGG + Intergenic
1189245348 X:39559017-39559039 GGGTGATGTATTTAGATGGGGGG - Intergenic
1191033633 X:56002340-56002362 GTGTGATGAGTGTGAATGAGGGG - Intergenic
1191084150 X:56546459-56546481 GTTTGAACAGTTTGGATGGAAGG - Intergenic
1191109717 X:56794900-56794922 TTGTGATGGGACTGGATGGGAGG + Intergenic
1192128545 X:68525782-68525804 ATCAGATGATTTTGGATGGGAGG + Intronic
1198542470 X:137654348-137654370 GGGTGCAGAGTTTGGTTGGGTGG + Intergenic
1198777369 X:140194492-140194514 GTCTGATGAGGGTGGATGGATGG + Intergenic