ID: 951704578

View in Genome Browser
Species Human (GRCh38)
Location 3:25530665-25530687
Sequence CAGGCCCACCTGGATTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 2, 2: 8, 3: 64, 4: 469}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951704574_951704578 11 Left 951704574 3:25530631-25530653 CCTCTTCCACTTTAAAGGAGTCT 0: 1
1: 0
2: 9
3: 84
4: 370
Right 951704578 3:25530665-25530687 CAGGCCCACCTGGATTTTCCAGG 0: 1
1: 2
2: 8
3: 64
4: 469
951704575_951704578 5 Left 951704575 3:25530637-25530659 CCACTTTAAAGGAGTCTTGTAAT 0: 1
1: 1
2: 4
3: 45
4: 365
Right 951704578 3:25530665-25530687 CAGGCCCACCTGGATTTTCCAGG 0: 1
1: 2
2: 8
3: 64
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951704578 Original CRISPR CAGGCCCACCTGGATTTTCC AGG Intronic
900490286 1:2945542-2945564 CAGTGGCACCTGGCTTTTCCTGG + Intergenic
900607075 1:3528568-3528590 TGGGCCCACCTGGATATGCCAGG - Intronic
900890945 1:5449283-5449305 TAGGCCCACCTGGATAATCCAGG - Intergenic
900892238 1:5457897-5457919 CAGGGGCACCTGGGTTTTCTGGG + Intergenic
900927586 1:5715994-5716016 CAGTCCCACCTGGATAGTCCAGG + Intergenic
900961220 1:5922027-5922049 TGGGCCCACCTGGATAATCCAGG - Intronic
901263691 1:7892828-7892850 CAGGCCCACCCAGATAATCCAGG + Intergenic
901870510 1:12135904-12135926 CAGGCCCTTCTGGAAATTCCCGG - Intronic
902098502 1:13966067-13966089 CAGGCCCACCTCGGTGTTACGGG - Intergenic
902180495 1:14684803-14684825 CAGGCCCACCTGGATAACCCAGG + Intronic
903028956 1:20449018-20449040 CAGGCCCGCCTGGGATGTCCGGG + Intergenic
903404416 1:23084463-23084485 AAGGCCCACCTGGATCATCTAGG + Exonic
903551825 1:24162435-24162457 TGGGCCCATCTGGATTATCCAGG + Intronic
904135601 1:28310027-28310049 AGGGCCCACCTGGATAATCCAGG + Intergenic
904276773 1:29390041-29390063 CAGCCCCACTGGGATCTTCCAGG - Intergenic
904416777 1:30366898-30366920 TATGCACACCTGGATTTTTCAGG - Intergenic
905531174 1:38679971-38679993 GAGGCCCACCTGGATAATTCGGG - Intergenic
905950942 1:41949995-41950017 CAGGACTACCTGGATTTCCTAGG + Intronic
906165189 1:43680796-43680818 TGGGCCCACCTGGATGATCCAGG + Intronic
907396056 1:54190774-54190796 CAGGCCAAGCTGGCTGTTCCCGG + Exonic
908581442 1:65521372-65521394 CAGGCCCACCATGATTATCTAGG + Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
909252774 1:73380089-73380111 TATGCCCACCTGGATAATCCAGG + Intergenic
910087787 1:83424448-83424470 CAGACCAACATGGAATTTCCTGG - Intergenic
910425815 1:87119239-87119261 CAGGCCCACCTGGATAATCTAGG - Intronic
910766766 1:90789965-90789987 TAGGCCCACCTGGATAATCCAGG - Intergenic
911367349 1:96954470-96954492 AGGGCCCACCTGGATAGTCCAGG + Intergenic
911478235 1:98400917-98400939 CAGGCCCACCTTTATAATCCAGG - Intergenic
911824836 1:102469336-102469358 TGGGCCCACCTGGATAATCCAGG - Intergenic
912913378 1:113786436-113786458 TAAGCCCACCTGGATAATCCAGG - Intronic
914394061 1:147247955-147247977 CAGGCCCACCTGGATAATTCAGG + Intronic
915191836 1:154157442-154157464 CTAGCCCAGCTGGATTCTCCGGG + Intronic
916847557 1:168668680-168668702 GAGACCCACCTGGATTATCAAGG - Intergenic
917902313 1:179554867-179554889 TAGGGCCACCTGGATAATCCAGG - Intronic
918399246 1:184147102-184147124 TGGGCCCACCTGGATAATCCAGG + Intergenic
918489712 1:185068408-185068430 AAGGCCTACCTGGATAATCCAGG - Intronic
919925393 1:202189349-202189371 CAGGCCCACGTGGATGTGTCAGG - Intergenic
920235391 1:204499937-204499959 TGGGCCCACCTGGATAATCCAGG - Intergenic
922108725 1:222536524-222536546 CAGGCCCAGATGGTTTTTCTTGG + Intronic
922413454 1:225397614-225397636 CAGGCACACCTGGAGTCACCTGG + Intronic
923032433 1:230260230-230260252 CAGGCCCTCCTTGTTTTTGCAGG - Intronic
923044692 1:230347165-230347187 CTGGCCCACCTGGTTTATTCAGG - Intronic
924530335 1:244888502-244888524 TAGGCCCAGCTGGATAATCCAGG - Intergenic
924811339 1:247405178-247405200 TAGGCTCACCTGGATGGTCCGGG + Intergenic
1065837784 10:29674957-29674979 AAGTCCCACCTGGATAGTCCAGG + Intronic
1066439052 10:35420367-35420389 CAGGCCCACCTGGGTTTTCCTGG + Intronic
1066642598 10:37571192-37571214 CATGCCCACCTGAATTTCCATGG - Intergenic
1068177020 10:53474233-53474255 TGGGCCCACCTGGATAATCCAGG - Intergenic
1068564202 10:58553266-58553288 TAGGCCCACCTGGATAACCCAGG - Intronic
1069824562 10:71247118-71247140 CAGGCCCAGCAGCATTGTCCAGG + Intronic
1069843317 10:71353658-71353680 CTGGGACACCTTGATTTTCCAGG - Intronic
1070342877 10:75513788-75513810 TAGGCCCACCTGGGTAATCCAGG + Intronic
1070512846 10:77176905-77176927 TGGGCCCACCTGGATACTCCAGG - Intronic
1070566529 10:77607501-77607523 AGGGCCCACCTGGATGATCCAGG - Intronic
1070762012 10:79029801-79029823 CAGGCCCACCCAGATAATCCAGG - Intergenic
1071051826 10:81459797-81459819 CAGGACCAGCTGGATTTCCTAGG + Intergenic
1071327465 10:84531040-84531062 CAGGACTACCTGGATTTCCTAGG - Intergenic
1071556946 10:86611719-86611741 CAGGACTAGCTGGATTTTCTAGG + Intergenic
1071744441 10:88400088-88400110 AGGGCCCACCTGGATGATCCAGG + Intronic
1072741236 10:97911166-97911188 GAGTCCCACCTGGAATTTCCAGG - Intronic
1073604376 10:104879448-104879470 TAGGCCCACCTGGATAACCCAGG + Intronic
1073961468 10:108934988-108935010 CGGGCCCACTTGGATAATCCAGG + Intergenic
1074763878 10:116686639-116686661 CAGGCCCACCTTGCTTTTTCTGG - Intronic
1074995905 10:118756810-118756832 ATGGCCCACCTGGATAATCCAGG - Intergenic
1075024598 10:118975319-118975341 TGGGCCCACCTGGATAATCCAGG + Intergenic
1075071303 10:119321592-119321614 TGGGCCCACCTGGATAATCCAGG + Intronic
1075392101 10:122099616-122099638 CTGGCCCAACTGGCTTTTGCTGG + Intronic
1075548004 10:123370085-123370107 AGGGCCCACCTGGATAATCCAGG - Intergenic
1075903406 10:126061552-126061574 CAGGCTCACCCAGATTGTCCAGG - Intronic
1076248014 10:128962423-128962445 CAGGCCCATCTGGGTCTGCCAGG + Intergenic
1076281533 10:129250622-129250644 TGGGCCCACCTGGATAGTCCAGG + Intergenic
1076563543 10:131382649-131382671 TGGGCCCACCTGGATGATCCAGG + Intergenic
1076918637 10:133440051-133440073 CTGGCCCCCCTGGCTTTCCCTGG + Intergenic
1077034077 11:486462-486484 CTGCCCCACCAGGATTTCCCTGG + Intronic
1077066497 11:643346-643368 CAGGACCACCTGGTTTATTCCGG - Intergenic
1077507753 11:2940027-2940049 GAGGCCCACCTGGGTAGTCCAGG - Intergenic
1077659070 11:4050638-4050660 AAGGCTCAACTGTATTTTCCTGG - Intronic
1079117463 11:17649413-17649435 CGGGCCCACCTGGATGACCCAGG - Intergenic
1079884332 11:25966931-25966953 CAGGACTAGCTGGATTTCCCAGG - Intergenic
1080228382 11:29986905-29986927 TAGGCCCATCTGGATAATCCAGG - Intergenic
1080615149 11:33939263-33939285 TGGGCCCACCTGGATGATCCAGG - Intergenic
1081070117 11:38601596-38601618 CAGGACTAGCTGGATTTCCCAGG + Intergenic
1083153202 11:60806534-60806556 CAGGCCCACCCAGATTATCTAGG + Intergenic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1084092530 11:66888056-66888078 GGGGCCCACCTGGATGATCCGGG + Intronic
1084725611 11:70939875-70939897 AGGGCCCACCTGGATGATCCAGG - Intronic
1085689292 11:78652408-78652430 CAGGCCCCTGTGGGTTTTCCAGG - Intergenic
1085789404 11:79484196-79484218 CAGGCCCACCTGGATAAACCCGG + Intergenic
1087023106 11:93622870-93622892 CAGGCCCTCTTGGATTTTCTAGG - Intergenic
1088359335 11:108974634-108974656 CAGGACCACCTGGTATTTACTGG - Intergenic
1088658041 11:112019837-112019859 CATACCCGCCTGGATTTTCAAGG - Intronic
1090376857 11:126295916-126295938 CAGCCCCAGCAGGATTTTCTAGG - Intronic
1091449018 12:561339-561361 CAGGCCCGCTTGGAGTATCCTGG - Exonic
1093478462 12:19580779-19580801 TAGGCCCACCTGGATAATCCAGG - Intronic
1094141571 12:27187190-27187212 CAGGCCCACTTGGCTAATCCAGG + Intergenic
1096352692 12:50913338-50913360 CAGGACTAGCTGGATTTTCTAGG - Intergenic
1097404246 12:59169709-59169731 TAGATCCACCTTGATTTTCCAGG - Intergenic
1097908328 12:64943629-64943651 CAGGCCCACCTAGATGATCCAGG + Intergenic
1097918316 12:65043365-65043387 AGGGCCCACCTGGATATTCTGGG - Intergenic
1100039399 12:90295515-90295537 CAGCCCCACCCTGACTTTCCAGG + Intergenic
1100667710 12:96772523-96772545 TAGGCCCACCTGGATAACCCAGG + Intronic
1101853358 12:108422218-108422240 CAAACCCACTTGGATTATCCAGG + Intergenic
1103029038 12:117597406-117597428 CAGGCTCACCTGGATAATCCAGG - Intronic
1103578367 12:121895743-121895765 CAGGCCCACCTGGATAATCCAGG + Intronic
1103901451 12:124305709-124305731 CAGGCCCACCTGGATGACCCAGG + Intronic
1103970819 12:124670342-124670364 TGGGCCCACCTGGATCATCCAGG + Intergenic
1104392389 12:128402012-128402034 CAGGGCCACCTGGATGATCCAGG - Intronic
1104424198 12:128661249-128661271 CAGGCCCACCCAGATTATGCAGG + Intronic
1104627105 12:130366477-130366499 CATCCCCACCTGGATTCTTCAGG - Intronic
1105435196 13:20371176-20371198 CAGGCCACCTTGGAATTTCCTGG - Intergenic
1107257321 13:38443921-38443943 CGGGCCCACCTGAATAATCCAGG + Intergenic
1107478381 13:40763397-40763419 CAGGGCCACATGCAGTTTCCAGG + Intronic
1107640523 13:42438679-42438701 CTGGCCCACCTGGGTAATCCAGG - Intergenic
1107687869 13:42922344-42922366 TGGGCCCACCTGGACTATCCAGG - Intronic
1107812684 13:44215500-44215522 AGGGCCCACCTGGATAATCCAGG + Intergenic
1108091198 13:46851938-46851960 TGGGCCCACCTGGATAATCCAGG - Intronic
1108111897 13:47082547-47082569 TAGGCCCACCTGGATAATCCAGG + Intergenic
1108251205 13:48569868-48569890 GGGGCCCACCTGGATAATCCAGG - Intergenic
1108286908 13:48917796-48917818 TAGGCCCACCTGAATCATCCAGG + Intergenic
1108562894 13:51664280-51664302 CAGGCCAGCTTGGTTTTTCCTGG - Intronic
1108574001 13:51776448-51776470 CAAGCCCACCTGGATACTCCAGG + Intronic
1109260360 13:60138122-60138144 CCGGACCAGCTGGTTTTTCCAGG + Intronic
1109281966 13:60367153-60367175 CAGGTCCACCTAGATAATCCAGG + Intergenic
1109533618 13:63686859-63686881 CAGGACTAGCTGGATTTTCTAGG + Intergenic
1110427743 13:75388182-75388204 TAGGCCCACTTGGATAATCCAGG + Intronic
1110441976 13:75536500-75536522 TAGGCCCACCTGGATAATCCAGG - Intronic
1110494876 13:76156104-76156126 CTGGCTCACCTAGATTATCCAGG + Intergenic
1112742455 13:102490401-102490423 CAGGCCCACCCAGATTATCTGGG + Intergenic
1112800512 13:103104654-103104676 CTGGTCCACCTGGACTATCCAGG + Intergenic
1113802699 13:113094753-113094775 CAGGCCCATGTGGACCTTCCAGG - Intronic
1114254596 14:20990585-20990607 AAGTCCTACCTGGGTTTTCCAGG - Exonic
1114763815 14:25348209-25348231 AAGGCCCACCTGGATAATCCAGG + Intergenic
1115176030 14:30562669-30562691 CAGGCCCACCCGCAGTTACCTGG + Intronic
1115564352 14:34612403-34612425 AAGGCCCACCTGGATAATCCAGG - Intronic
1116064988 14:39971194-39971216 AAGGCCCACCTGGGTAATCCAGG - Intergenic
1117171763 14:53107757-53107779 CAGGACTAGCTGGATTTTCTAGG + Intronic
1117515610 14:56498315-56498337 CAGGCCCACCCAGATTATCTAGG + Intronic
1117794630 14:59379659-59379681 CGGGCCCACCTGGATAATCCAGG - Intergenic
1117799798 14:59431490-59431512 CAGGCCCACCTGCATAATACAGG - Intronic
1117914030 14:60658355-60658377 CAAGGCCACCTGGATTCTACTGG - Intergenic
1118069333 14:62228664-62228686 TGGGCCCACCTGGATAATCCAGG + Intergenic
1118315031 14:64721000-64721022 CAGGCCCACCGGGCTAATCCAGG + Intronic
1118316006 14:64726556-64726578 CAGGCCCACCTGGAGCAGCCGGG - Intronic
1118584362 14:67338762-67338784 CACCCCCACCTGTATTTTACAGG - Exonic
1119762121 14:77158959-77158981 CACCCCCACCTGGCTTCTCCAGG + Intronic
1119862015 14:77942922-77942944 TGGGCCCACCTGGATAATCCAGG + Intergenic
1119881185 14:78101165-78101187 CAGGCCCACCTAGATAATCCAGG + Intergenic
1119993447 14:79225968-79225990 CAGGCCCACCCAGATAATCCAGG + Intronic
1120060526 14:79977522-79977544 TGGGCCCACCTGGATAATCCAGG + Intergenic
1121151284 14:91637376-91637398 CAATCCCACATTGATTTTCCTGG - Intronic
1121173023 14:91870311-91870333 CAAGTCCAGCTGGATTTCCCGGG + Exonic
1121345880 14:93135657-93135679 CAGGCCTGCCTGGATATTTCTGG - Intergenic
1122659811 14:103287674-103287696 AGGGCCCACCTGGATGATCCAGG - Intergenic
1122769285 14:104090735-104090757 AGGGCCCACCTGGATTGTCCAGG + Intronic
1122938189 14:104969626-104969648 CAGGCTTACCAGGCTTTTCCAGG - Intronic
1123023821 14:105414460-105414482 CAGGCGACCCTGGATCTTCCGGG - Intronic
1124468729 15:29964170-29964192 AGGGCCCACCTGGATGATCCAGG - Intronic
1124509417 15:30310354-30310376 TAGGCCCACCTGGATTTTGGTGG - Intergenic
1124734142 15:32228308-32228330 TAGGCCCACCTGGATTTTGGTGG + Intergenic
1124846578 15:33297196-33297218 CAGGCCCACCCAGATTATCCAGG + Intergenic
1124877334 15:33607370-33607392 CAGGCCCACCTGAAGTGCCCAGG - Intronic
1125788562 15:42344447-42344469 AAGGCCCACCTGGATAATCTGGG + Intronic
1126449435 15:48789618-48789640 TGGGCCCACCTGGATAATCCAGG - Intronic
1126785338 15:52174023-52174045 TGGGCCCACCTGGATAATCCAGG - Intronic
1127120316 15:55766276-55766298 TGGGCCCACCTGGATGATCCAGG + Intergenic
1128360327 15:66957243-66957265 GAGGCCCAGCTGGCTTTTCCAGG - Intergenic
1128752385 15:70158792-70158814 AGGGCCCACCTGGATAATCCAGG - Intergenic
1129332354 15:74834184-74834206 GAGGCCCATCTGCATCTTCCAGG + Intergenic
1129356604 15:74995999-74996021 CAGCCCCACCTGGCGTTCCCTGG + Intronic
1129776474 15:78240002-78240024 CAGGACCAGCTGGATTTCCTAGG - Intronic
1130354064 15:83114069-83114091 AAGGCCCACATGCCTTTTCCTGG + Intronic
1130578612 15:85115363-85115385 GAGGACCACCTGGAGTTTCCAGG + Intronic
1131011018 15:89018484-89018506 CAGGCCCAACTGAAATTCCCAGG + Intergenic
1131771505 15:95742819-95742841 TGGGCCCACCTGGAGTATCCGGG + Intergenic
1131960793 15:97788387-97788409 CAGGCTCAGCCGGACTTTCCAGG - Intergenic
1132756953 16:1490176-1490198 TAGGGCCACCTGGATAATCCAGG - Intergenic
1133835921 16:9367077-9367099 TGGGCCCACCTGGATAGTCCAGG + Intergenic
1134395502 16:13858907-13858929 CATGCCCACCCAGATTATCCAGG + Intergenic
1134894125 16:17869450-17869472 CAGGCCCATCTGGATAATCCAGG + Intergenic
1135766049 16:25178685-25178707 CAGGCCCACCTGGATAACCCAGG - Intergenic
1136101196 16:27997511-27997533 CAGGCCCATTTGGATACTCCAGG + Intronic
1136102663 16:28007198-28007220 CGGACCCACCTGGATAATCCTGG - Intronic
1136655546 16:31707026-31707048 CAGGCCCACCTGGCTCCTGCTGG + Intergenic
1137938254 16:52656225-52656247 CTAGCCCAGCTGGATTCTCCGGG - Intergenic
1140808503 16:78554983-78555005 CAGGCCCTGCTGGTTTATCCGGG - Intronic
1141018719 16:80474851-80474873 TGGGCCCACCTGGATGGTCCAGG + Intergenic
1141145863 16:81529621-81529643 CTGGCCCCCCTGGATAATCCAGG - Intronic
1141607854 16:85165430-85165452 AATGCCCACCTGGATTCTGCAGG - Intergenic
1141645311 16:85364326-85364348 CAGGCCCACGTGGCTAATCCAGG + Intergenic
1142715598 17:1745392-1745414 CAGCCCCACCTGGTTGTACCTGG - Exonic
1143019960 17:3912225-3912247 CAGGCCCGGCTGGATCCTCCAGG - Intronic
1143375674 17:6465653-6465675 CAGCCCCACCGGGATTATCCTGG + Intronic
1143570536 17:7755270-7755292 CTGTCCCACCTGGGTTCTCCAGG - Intronic
1144217617 17:13070334-13070356 TAGGCCCACCTGAATAATCCAGG - Intergenic
1144755439 17:17677721-17677743 CCGGTCCACCTGGATAATCCAGG - Intergenic
1144770347 17:17756018-17756040 CAGGCCCTCCTGGCTTTCCATGG - Intronic
1146639429 17:34528822-34528844 CAGGCTCACCAGGATTTACTGGG + Intergenic
1148715697 17:49714155-49714177 CAAGATCATCTGGATTTTCCAGG - Intronic
1149047655 17:52266562-52266584 CAGGCCCAACTTGATTTCTCAGG - Intergenic
1149243163 17:54674141-54674163 CAGGACTAGCTGGATTTCCCAGG - Intergenic
1150627700 17:66852479-66852501 CAGGCCCACATGGTTTTACTTGG + Intronic
1150653468 17:67024706-67024728 CTGGCCCACCTCGAGTCTCCAGG + Intronic
1151943117 17:77305134-77305156 CAGGAACCCCTGGGTTTTCCTGG + Intronic
1153082408 18:1243123-1243145 AGGGCCCACCTGGATAATCCAGG - Intergenic
1153872121 18:9331136-9331158 CCAGCCCACCTGGATAATCCAGG - Intergenic
1153873323 18:9341112-9341134 CAGGTCCACCTGGATTTAAGTGG + Intronic
1154335101 18:13458699-13458721 CAGGCCTGCCTGGATGGTCCAGG - Intronic
1155254148 18:23979874-23979896 TGGGCCCACCTGGATAATCCAGG - Intergenic
1155443965 18:25891377-25891399 CAAGCCCACCCGGAGTTTCCAGG + Intergenic
1155498382 18:26464390-26464412 AGGGCCCACCTGGATTATCCAGG + Intronic
1156314219 18:35952168-35952190 TGGGCCCACCTAGATTATCCAGG + Intergenic
1156638979 18:39066985-39067007 TATGCCCATCTGGATCTTCCTGG - Intergenic
1156757964 18:40551531-40551553 TGGGCCCACCTGGATAATCCAGG + Intergenic
1157392116 18:47311566-47311588 AGGGCCCACCTGGATCATCCAGG + Intergenic
1158152245 18:54386601-54386623 CAGGACCAGCTGGATTTCCTAGG + Intergenic
1158424712 18:57328542-57328564 CAGGCCCACCCAGATAATCCAGG + Intergenic
1158774322 18:60557843-60557865 CAGGCCCACTTGGATAATCCAGG + Intergenic
1158805481 18:60966779-60966801 CATGCCCAGCTAGATTTTCTTGG - Intergenic
1159021084 18:63143704-63143726 CAGTCCCACCTGGAATATTCTGG - Intronic
1159631464 18:70753405-70753427 CAGCCCCACGTGTATTTTCTTGG + Intergenic
1159956638 18:74523027-74523049 CAGTCCCTCGTGGAATTTCCAGG + Exonic
1160042748 18:75360576-75360598 CAGGCCCACCAGCATGGTCCAGG + Intergenic
1160592901 18:79953713-79953735 AGGGCCCACCTGGATAATCCAGG - Intergenic
1160698543 19:495835-495857 CCGGCCCGCCTGCACTTTCCCGG - Intronic
1160874664 19:1291446-1291468 CACCCACACCTGGCTTTTCCAGG - Intronic
1161687595 19:5711086-5711108 CAGGCCCACCTGGGTTCTTGAGG - Intronic
1162216939 19:9143003-9143025 CAGACCCAAATGGTTTTTCCAGG - Intronic
1163067714 19:14811459-14811481 AAGGTCCACCTGGATAATCCAGG + Intronic
1164299417 19:23947834-23947856 CAGGACTAGCTGGATTTCCCAGG + Intergenic
1165357205 19:35311662-35311684 GACCCCCACCTGGATTCTCCAGG - Intronic
1165404202 19:35619918-35619940 CAGACCCACCTTGAAGTTCCTGG + Intronic
1167215142 19:48159579-48159601 CAGGCCCACCTGGATAGTCCAGG - Intronic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1168011218 19:53534723-53534745 CAGGCCCACCTAGATAATTCAGG + Intronic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1168635472 19:57992983-57993005 CTGGGCCACCTGGATAATCCAGG - Intronic
1168676390 19:58280960-58280982 AGGGCCCACCTGGATAATCCAGG + Intronic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
925920050 2:8632220-8632242 CAAGCCCACCTGGCTAATCCAGG + Intergenic
926009896 2:9399633-9399655 CAGGCCCAGATGGCTTTGCCAGG - Intronic
926652605 2:15362857-15362879 CAGACCCACCAGGATTATCTAGG - Intronic
926920873 2:17938643-17938665 TAGGCCCACCTGGATAATCCAGG + Intronic
927676726 2:25111640-25111662 CAGGCCCACCTGGATTATCCAGG - Intronic
928677552 2:33664154-33664176 CAGGACTACCTGGATTTCCTAGG + Intergenic
929057196 2:37888594-37888616 CAAGCCCATCTGGATAATCCAGG - Intergenic
931910842 2:66898118-66898140 CAGCCCTGCCTGGTTTTTCCAGG - Intergenic
933856091 2:86415900-86415922 CAGGCCCACTTGGATAATCCAGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934919263 2:98329747-98329769 CAGGCCCACCCAGATTATCTAGG - Intergenic
935300454 2:101689334-101689356 CAGGTCCTCCTGAATATTCCAGG - Intergenic
935886281 2:107623258-107623280 CAGGCTCATCTGGATAATCCAGG - Intergenic
936090187 2:109496845-109496867 AGGGCCCACCTGGATAATCCCGG - Intronic
938803242 2:134782677-134782699 TGGGCCCACCTGGATAATCCAGG + Intergenic
939493033 2:142899462-142899484 CAGGACTAGCTGGATTTTCTAGG - Intronic
940822556 2:158373060-158373082 TAGGCCCACCTGGATAAGCCAGG - Intronic
941001798 2:160209796-160209818 GAGGACCACAGGGATTTTCCAGG - Intronic
941650511 2:168087464-168087486 CAGGCCCACCCAGATTATCAAGG - Intronic
941738603 2:169008467-169008489 AGGGCCCACCTGGATAATCCAGG + Intronic
942539659 2:177002397-177002419 TAGGCCCACTTGGATAATCCAGG + Intergenic
942655133 2:178207389-178207411 AGGGCCCACTTGGATTATCCAGG + Intronic
944482546 2:200172556-200172578 TGGGCCCACCTGGATAATCCAGG + Intergenic
945794667 2:214347480-214347502 CAGCCCTACCTGGATTCCCCAGG - Intronic
946425092 2:219590371-219590393 TGGGCCCACCTGGATAATCCAGG - Intergenic
946611762 2:221465995-221466017 CATGACCAGCTGGAGTTTCCGGG - Intronic
948723443 2:239918039-239918061 CAGGCCCACCTGGACAGCCCAGG - Intronic
949010360 2:241674862-241674884 TGGGCCCACCTGGATAGTCCAGG + Intergenic
1169170903 20:3464222-3464244 AGGGCCCACCTGGATGATCCAGG - Intergenic
1169999818 20:11603457-11603479 CATGCCTACCTAGATTATCCAGG - Intergenic
1171322456 20:24258337-24258359 CAGTGCCACCTGGAATTCCCAGG + Intergenic
1172392736 20:34576896-34576918 TGGGGCCACCTGGATTGTCCAGG + Intronic
1172475908 20:35237452-35237474 TAGACCCACCTGGATAATCCGGG + Intronic
1172605835 20:36213025-36213047 GATGCCCTCCTGGTTTTTCCTGG + Intronic
1173002444 20:39114351-39114373 CAGGCAGACCTAGATTTTCTGGG + Intergenic
1173149873 20:40557773-40557795 TGGGCCCACCTGGATAATCCAGG + Intergenic
1173327223 20:42045064-42045086 TAGGTCTACCTGGATTATCCAGG + Intergenic
1173888071 20:46479280-46479302 CAGACCCACCCGGATAATCCAGG + Intergenic
1174698354 20:52582806-52582828 CAGGATTACCTGGAGTTTCCTGG - Intergenic
1174955293 20:55091174-55091196 AAGGCCCACCTGAGTTTGCCTGG + Intergenic
1175160743 20:57005784-57005806 CAGGCCCACCTGGGTCATCCAGG + Intergenic
1175705394 20:61172777-61172799 GAGACCCTCCTGGATTATCCTGG - Intergenic
1176063806 20:63183818-63183840 CAGGCCCACCTGGACCTTGGTGG - Intergenic
1176070530 20:63223970-63223992 CAGGCTCACCTGGAGGTTTCAGG - Intergenic
1176089967 20:63314381-63314403 TGGCCCCACCTGGATTCTCCAGG + Intronic
1176114444 20:63425171-63425193 CAGGCTCATCAGGATGTTCCAGG + Intronic
1176114855 20:63427732-63427754 CAGATCATCCTGGATTTTCCGGG - Intronic
1176409501 21:6440456-6440478 AGGGCCCACCTGGATGATCCAGG + Intergenic
1178055494 21:28793733-28793755 AGGGCCCACCTGGATAATCCAGG - Intergenic
1178117274 21:29430233-29430255 CAGGCCCACCCAGGTTGTCCAGG + Intronic
1178745572 21:35246887-35246909 TAGGCCCACCTGGATAATCTAGG - Intronic
1179140059 21:38717482-38717504 TAGGCCCACCTCAATATTCCAGG - Intergenic
1179684994 21:43048778-43048800 AGGGCCCACCTGGATGATCCAGG + Intergenic
1179943003 21:44651651-44651673 TGGGCCCACCTGGATAATCCAGG + Intronic
1180965822 22:19787487-19787509 CAGGACCACATGGCATTTCCAGG - Exonic
1181091521 22:20476250-20476272 CTGGCTCTCCTGGACTTTCCAGG + Intronic
1182164218 22:28156223-28156245 CAGGCCCACCTGGATGGTCTAGG - Intronic
1182667329 22:31969380-31969402 CAAGCCCACCTAAATTATCCAGG + Intergenic
1183671030 22:39272988-39273010 CAGGCCTGCCTGGATAATCCAGG + Intergenic
1184614859 22:45631152-45631174 CAGACTCACTTGGATTCTCCTGG - Intergenic
1184951524 22:47846065-47846087 CGGCCCCACCTGGATCATCCAGG + Intergenic
950162003 3:10767329-10767351 CTGGCCCATCTGGACTGTCCTGG + Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
951704578 3:25530665-25530687 CAGGCCCACCTGGATTTTCCAGG + Intronic
952921763 3:38290149-38290171 CAGGACTAGCTGGATTTCCCAGG - Intronic
952922744 3:38297296-38297318 CAGGACTAGCTGGATTTTCTAGG - Intronic
953531761 3:43745934-43745956 CTGGCCCACCTAGATTATCCAGG - Intergenic
954443650 3:50535167-50535189 CAGGCCCATGGTGATTTTCCAGG - Intergenic
954982250 3:54756865-54756887 CAGGCCTCCCTGGATTTTGCTGG - Intronic
955514058 3:59709220-59709242 CAGGCCCACCTGGATCATACAGG - Intergenic
956736739 3:72244242-72244264 CAGGCCCACCTGCATAATCCAGG + Intergenic
956781463 3:72606452-72606474 CAGGCACACCTGGATGGGCCTGG - Intergenic
958161312 3:89819116-89819138 CAGGCATTCCTGCATTTTCCGGG - Intergenic
958437963 3:94121379-94121401 CAGGCCCACTCGGATAATCCAGG + Intronic
959010840 3:101074201-101074223 TAGGACTACCTGGATTATCCGGG + Intergenic
960003757 3:112760862-112760884 GGGGCCCACCTGGATCATCCAGG + Intronic
960224528 3:115154239-115154261 TAGGCCCGCCTGGATAATCCAGG + Intergenic
960856937 3:122111463-122111485 TGGGCCCACCTGGATAATCCAGG - Intronic
960897972 3:122526157-122526179 TGGGCCCACCTGGATAATCCTGG + Intergenic
961611453 3:128143121-128143143 CAGGCCCACCCTGATACTCCAGG + Intronic
963919201 3:150889446-150889468 CGGGCCCACCTGGGTCATCCAGG + Intronic
964206443 3:154180159-154180181 TAAGCCCACCTGGATAATCCAGG + Intronic
964897556 3:161616142-161616164 CAGGCCCTCCAGGATTATCTAGG + Intergenic
965427400 3:168544633-168544655 TGGGCCCACCTGGATAGTCCAGG - Intergenic
965943610 3:174212986-174213008 TAGACCCACCTGGATAATCCAGG + Intronic
965950185 3:174299338-174299360 AGGGCCCACCTGGATAATCCAGG - Intergenic
967452117 3:189637179-189637201 CAGGTCTACATGGATGTTCCAGG - Intronic
968037713 3:195562088-195562110 AGGGCCCACCTGGATAATCCAGG - Intergenic
968929398 4:3570589-3570611 GAGGCCACCCTGGATTATCCAGG + Intergenic
969174718 4:5389843-5389865 TGGGCCCACCTGGATAATCCAGG - Intronic
969211781 4:5693360-5693382 CAGGCCCACCTGGATAGTCCAGG - Intronic
970081889 4:12296605-12296627 AAGGCCCACCTGGCTAATCCAGG - Intergenic
970176698 4:13346570-13346592 TGGGCCCACCTGGATAATCCAGG - Intergenic
970418490 4:15882588-15882610 AGGGCCCACCTGGATGATCCAGG - Intergenic
970774115 4:19652349-19652371 TGGGCCCACCTAGATTATCCGGG + Intergenic
970858732 4:20677726-20677748 TGGGCCCACCTGGATAATCCAGG - Intergenic
970860067 4:20692096-20692118 TAGGCCCATCTGGATAATCCAGG - Intergenic
970867846 4:20779662-20779684 AAGGCCCACTTGGATAATCCAGG - Intronic
971004925 4:22362556-22362578 TAGGCCCACCTGGATTATCCAGG + Intronic
971232602 4:24812103-24812125 TTGGCCCACCTGGATAATCCAGG + Intronic
972388021 4:38586560-38586582 TGGGCCCACCTGGATAATCCAGG + Intergenic
972636282 4:40886800-40886822 CAGGCCAACCTGGGTGCTCCTGG + Intronic
973878717 4:55247496-55247518 CAAGCCCAACTGGAATCTCCAGG + Intergenic
974519911 4:62971024-62971046 CTGGACTAGCTGGATTTTCCAGG + Intergenic
975313276 4:72926394-72926416 CAGGACTAGCTGGATTTTCTAGG - Intergenic
975324391 4:73043048-73043070 GGGGCCCACCTGGATAATCCAGG - Intergenic
976351672 4:84066947-84066969 CAGGCCCACCTAGATGATCTAGG - Intergenic
977556125 4:98489205-98489227 CAGGACTAGCTGGATTTCCCAGG + Intronic
978526099 4:109667197-109667219 CAGGTCCAGATGGATTTTCTTGG - Intronic
979153462 4:117350814-117350836 CAGTACAACCTGGATTTCCCTGG - Intergenic
980809382 4:137855077-137855099 CAGGCCAACCTGGATAATTCCGG - Intergenic
980989735 4:139728932-139728954 CAGGCACACCTGAGATTTCCTGG + Intronic
981665622 4:147222844-147222866 TATGCCCTCCTGAATTTTCCAGG - Intergenic
981827887 4:148964783-148964805 TAGACCCACCTGGATAATCCAGG - Intergenic
983484763 4:168320265-168320287 TGGGCCCACCTGGATAATCCCGG - Intergenic
984196162 4:176660355-176660377 AAGGCCCACCTGGATAATCCAGG + Intergenic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
985350681 4:189058278-189058300 CAGGACCAGCTGGATTTCCTAGG + Intergenic
985494910 5:199000-199022 CAGGCCCACCCCGGCTTTCCAGG + Exonic
986105791 5:4658173-4658195 TGGGGCCACCTGGATTGTCCAGG + Intergenic
986348491 5:6855921-6855943 AAGGCCCACTGGGGTTTTCCTGG + Intergenic
986492671 5:8308216-8308238 CAGGACTAGCTGGATTTTCTAGG - Intergenic
986669558 5:10130965-10130987 TAGGGCCACCTGGATAATCCAGG - Intergenic
986816137 5:11414027-11414049 AGGGCCCACCTGGATGATCCAGG - Intronic
986833260 5:11605948-11605970 GAGGCTAACCTGGATTATCCAGG + Intronic
986890575 5:12299717-12299739 CAGGCCCACCTGGTGGTTGCTGG + Intergenic
987030575 5:13973071-13973093 TGGGCCCACCTGGATAATCCAGG - Intergenic
988430102 5:31109555-31109577 CAGGACTACCTGGATTTCCTAGG - Intergenic
988475466 5:31581119-31581141 TGGGCCCACCTGGATGATCCAGG - Intergenic
988881417 5:35507755-35507777 CAGGACCAGCTGGATTTCCTAGG + Intergenic
989132213 5:38118650-38118672 CTGGCCCACCTGGGTTGCCCTGG + Intergenic
990245022 5:53856056-53856078 CAAGCCCACCTGGATAACCCAGG + Intergenic
990370654 5:55114819-55114841 TAGGGCCACCTGGATAATCCAGG + Intronic
990515656 5:56528757-56528779 CAGGCTCACCTAGATAATCCAGG + Intronic
991290560 5:65030489-65030511 CAGGGCTAGCTGGATTTTCTAGG + Intergenic
991608225 5:68424390-68424412 TTGGCCCACCTGGATAATCCAGG + Intergenic
992278184 5:75143216-75143238 AGGGCCCACCTGGATAATCCAGG + Intronic
992688789 5:79223231-79223253 TAGTCCCACCTGGATAGTCCAGG - Intronic
992751862 5:79869747-79869769 TGGGCCCACCTGGATAGTCCAGG + Intergenic
992777949 5:80104731-80104753 CGGGCCCACCTGGATGTGCTGGG + Intergenic
994669221 5:102746586-102746608 TTGGCCCACCTGGATAATCCAGG + Intergenic
995855417 5:116586394-116586416 TGGGCTCACCTGGATTTTCTAGG - Intergenic
996128227 5:119751157-119751179 CAGGACTAGCTGGATTTTCTAGG + Intergenic
996401648 5:123069378-123069400 CAGGTCCATCTGGGTATTCCAGG - Intergenic
998039280 5:138942074-138942096 TGGGCCCACCTGGATGATCCAGG - Intergenic
998529656 5:142872768-142872790 AAAGCTCACCTGAATTTTCCTGG - Intronic
998675466 5:144403118-144403140 CGGGCACACCTGGATAATCCAGG + Intronic
999873343 5:155774727-155774749 CAGGCCCACCTGGATGATCCAGG + Intergenic
1000305192 5:159988053-159988075 CAGGCCCACCAGGATAATCCAGG - Intergenic
1000379130 5:160613188-160613210 TAAGCCCACCCTGATTTTCCAGG - Intronic
1001288243 5:170438898-170438920 CAGGCCCACATGCAGTGTCCAGG - Intronic
1004279519 6:14269114-14269136 AGGGCCCACCTGGATAATCCAGG + Intergenic
1004472395 6:15940983-15941005 TGGGCACACCTGGATTATCCAGG + Intergenic
1004859294 6:19784661-19784683 AAGGCCCACCCAGATTTTCTAGG + Intergenic
1005252548 6:23964086-23964108 TGGGCCCACCTGGATAATCCAGG + Intergenic
1005358520 6:25008346-25008368 CAGGCCCTCCTGCATGATCCAGG - Intronic
1005527666 6:26667093-26667115 TAGGCTCACCTGGATAATCCAGG + Intergenic
1005543128 6:26834585-26834607 TAGGCTCACCTGGATAATCCAGG - Intergenic
1005677878 6:28174355-28174377 AGGGCCCACCTGGATATTCCAGG + Intergenic
1006442126 6:34059368-34059390 CAGGCCCAGCGTGATTCTCCAGG + Intronic
1006760424 6:36455831-36455853 CAGGCCCACCCAGATTATCTAGG + Intronic
1007691323 6:43703242-43703264 TAGGCCCACATGGATCTTACAGG - Intergenic
1008179683 6:48312959-48312981 CAGGCCCACCTGGAGAGTCCAGG - Intergenic
1009013946 6:57876755-57876777 TAGGCTCACCTGGATAATCCAGG - Intergenic
1011597117 6:89026562-89026584 CAGACCCACCTTGATAATCCAGG - Intergenic
1011614603 6:89186343-89186365 CAGGCCCACCCAGATTATCCAGG - Intronic
1011753339 6:90475061-90475083 CAGGCCTGCCTGGATAATCCAGG + Intergenic
1011791436 6:90903250-90903272 CAGGTCCACCTGGATCATCCAGG - Intergenic
1012119959 6:95354345-95354367 CAGGACTAGCTGGATTTCCCAGG + Intergenic
1012872513 6:104688858-104688880 CAGACCCATCTGGATAATCCAGG + Intergenic
1014270136 6:119327124-119327146 TGGGCCCACCTGGATAATCCAGG - Intronic
1015304707 6:131694980-131695002 CAGGCCCAACAGGGGTTTCCAGG - Intronic
1015402488 6:132801855-132801877 AGGGCCCACCTGGATAATCCAGG + Intergenic
1015948722 6:138529802-138529824 TAGGCCCACTTGGATAATCCAGG + Intronic
1016651968 6:146472379-146472401 CAGGCCCACCCAGATTATCTAGG - Intergenic
1016844967 6:148560887-148560909 CAGGCCCATCTGGATTGTCTAGG + Intergenic
1016872010 6:148826949-148826971 CGGGCCCACCTAGATAATCCAGG + Intronic
1017341769 6:153332454-153332476 CAGTCTCACCTATATTTTCCTGG + Intergenic
1017409499 6:154153348-154153370 CAGGCTCACCTGGATAATCCAGG - Intronic
1017753338 6:157509214-157509236 TGGGCCCACCTGGATGATCCAGG + Intronic
1018392078 6:163348241-163348263 TAGGCCCACCTGAATCATCCAGG - Intergenic
1018761520 6:166897937-166897959 CAGGACTAGCTGGATTTTCTAGG + Intronic
1018955180 6:168404907-168404929 CAGGCCTACTTGGATTTTGAAGG - Intergenic
1020329785 7:7005759-7005781 AAGGCCCACCTGGATAATCCAGG - Intergenic
1020911503 7:14137604-14137626 TAGGCCCACCTGGATAATCCAGG + Intergenic
1021086320 7:16424257-16424279 AGGGCCCACCTGGATAATCCAGG - Intergenic
1022134931 7:27438181-27438203 AAGGCCCACCTTGATTTGCCTGG - Intergenic
1022209501 7:28194897-28194919 CAGCCCCACCTGGAGAATCCAGG + Intergenic
1022502680 7:30892510-30892532 CAGGTCCACCTCCATTCTCCTGG - Intergenic
1022950938 7:35337320-35337342 AAGGCCTGCCTGGATTATCCAGG - Intergenic
1022960041 7:35417853-35417875 CATGCCCACTTGGCTTTTCAGGG + Intergenic
1023451110 7:40286402-40286424 TAGGCCCACATGGATAATCCAGG + Intronic
1023658532 7:42450305-42450327 CAGGCCAACCTAGATACTCCAGG - Intergenic
1024005100 7:45219591-45219613 TGGGCCCACCTGGATAATCCAGG + Intergenic
1024677648 7:51651638-51651660 AAATCCCACCGGGATTTTCCTGG - Intergenic
1024760537 7:52591502-52591524 AAGTCCCACCTGGCTTTCCCAGG + Intergenic
1024872706 7:53984474-53984496 CAGGCCCAACTCAATTCTCCTGG - Intergenic
1025192643 7:56907755-56907777 CGGGCCCGCCTGGATAATCCAGG + Intergenic
1025679302 7:63669165-63669187 CGGGCCCGCCTGGATAATCCAGG - Intergenic
1025715816 7:63954021-63954043 CAGGCCCACCAGGATTCCCTGGG - Intergenic
1026301390 7:69101120-69101142 CTTCCCTACCTGGATTTTCCAGG - Intergenic
1026552858 7:71382548-71382570 CAGACCCCCATGGCTTTTCCTGG - Intronic
1027304669 7:76880922-76880944 CAGACCAACATGGAATTTCCTGG - Intergenic
1027986241 7:85294680-85294702 TTGGCCCACCTGGATAATCCAGG + Intergenic
1029670242 7:102025155-102025177 TGGGCCCACCTGGATAATCCAGG + Intronic
1030082708 7:105791254-105791276 CAGGCCCAACTGTATTTTAAAGG + Intronic
1030875674 7:114810404-114810426 CAGGGCCACCAGGATTATCAAGG - Intergenic
1031063791 7:117082098-117082120 CAGGCCCACCCAGATTATCTAGG + Intronic
1031918253 7:127582980-127583002 CAGGGTCACCTGGCTTTTCCTGG + Exonic
1032726242 7:134592260-134592282 CAGGACTAGCTGGATTTTCTAGG + Intergenic
1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG + Exonic
1033765327 7:144483243-144483265 TGGGCCCACCTGGATAGTCCAGG - Intronic
1034401245 7:150863007-150863029 CAAGCCCACCTGGATGATCCAGG - Intergenic
1034965067 7:155385779-155385801 CAGGACTAGCTGGATTTCCCAGG - Intronic
1035048681 7:155985441-155985463 CAGGCCGCCCAGGATCTTCCAGG - Intergenic
1035466080 7:159078786-159078808 CAAGCCCACCTGCATTTTCCTGG - Intronic
1036152636 8:6312944-6312966 TGGGCCCACCTGGATCATCCAGG - Intergenic
1036195678 8:6711893-6711915 AGAGCCCACCTGGATATTCCGGG + Intronic
1038127038 8:24686010-24686032 TAGGCCCACCCAGATATTCCAGG + Intergenic
1040911073 8:52519773-52519795 CAGACCCACCTAGATAATCCAGG + Intergenic
1041501936 8:58548479-58548501 CAGGCCTACCTTGATAATCCAGG + Intergenic
1041734034 8:61091103-61091125 CAGGCCCACCTCGATAACCCAGG - Intronic
1041781393 8:61580806-61580828 AAGGCCCAACTGGATAATCCAGG + Intronic
1041812400 8:61926280-61926302 GGGGCCCATCTGGATATTCCAGG - Intergenic
1041979962 8:63846333-63846355 AGGGCCCACCTGGATAATCCAGG - Intergenic
1041993555 8:64025610-64025632 TAGGCCCAGCTGGATAATCCAGG - Intergenic
1042720081 8:71818149-71818171 AAGGCCCACCTGGATAATCTAGG - Intergenic
1042817676 8:72895260-72895282 GGGGCCCACCTGGATAATCCAGG - Intronic
1043447752 8:80335827-80335849 TGGGCCCACCTGGATAATCCAGG + Intergenic
1043514887 8:80986751-80986773 TGGGCCCACCTGGATAATCCAGG - Intronic
1044016008 8:87049570-87049592 CAGTCCAATCTGGATTTTCTAGG + Intronic
1044628043 8:94253837-94253859 CTGCCCCCCATGGATTTTCCAGG - Intronic
1044647924 8:94464214-94464236 TAGGCCCACCTGGGTAATCCAGG - Intronic
1044726870 8:95201485-95201507 TAGGGCCACCTGGATAATCCAGG + Intergenic
1045664871 8:104473498-104473520 AGGGCCCACCTGGATAATCCAGG + Intergenic
1047232206 8:123007245-123007267 CGGGCCCACCAGGATAATCCAGG + Intergenic
1047353026 8:124094190-124094212 TAGGGCCACCCTGATTTTCCAGG + Intronic
1047491560 8:125378977-125378999 CAGGCCCACATGGGCTTCCCTGG - Intergenic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1048100309 8:131343597-131343619 CAGGACCAGCTGGATTTCCTAGG - Intergenic
1050174592 9:2856467-2856489 CTGTCCCACCTGGACTCTCCTGG - Intergenic
1051589175 9:18758674-18758696 CAAGCCTACCTGGATAATCCAGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053458208 9:38247565-38247587 CAGGCTCACCCAGATTGTCCAGG + Intergenic
1053491213 9:38505079-38505101 CACGCCCACCTGGATTTGCTGGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053804090 9:41784026-41784048 GAGGCCACCCTGGATTATCCAGG + Intergenic
1053804095 9:41784034-41784056 AGGGCCCACCTGGATAATCCAGG - Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054141187 9:61531425-61531447 AGGGCCCACCTGGATAATCCAGG + Intergenic
1054141192 9:61531433-61531455 GAGGCCACCCTGGATTATCCAGG - Intergenic
1054192396 9:61995522-61995544 GAGGCCACCCTGGATTATCCAGG + Intergenic
1054192401 9:61995530-61995552 AGGGCCCACCTGGATAATCCAGG - Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054460877 9:65461861-65461883 AGGGCCCACCTGGATAATCCAGG + Intergenic
1054460882 9:65461869-65461891 GAGGCCACCCTGGATTATCCAGG - Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054646005 9:67593161-67593183 AGGGCCCACCTGGATAATCCAGG + Intergenic
1054646010 9:67593169-67593191 GAGGCCACCCTGGATTATCCAGG - Intergenic
1055821945 9:80276518-80276540 CAAGTCCAACTGGAGTTTCCTGG - Intergenic
1055893164 9:81144906-81144928 CAGGCCCACCTGGATAATCCAGG - Intergenic
1056328510 9:85502464-85502486 TGGGCCCACCTGGATAATCCAGG - Intergenic
1056898191 9:90571217-90571239 CAGGCCCAACTGCATAATCCAGG - Intergenic
1057058415 9:91981761-91981783 CAGGACTACCTGGATTTCCTAGG + Intergenic
1057076017 9:92138529-92138551 CAGGCCCACGTGGATGTGTCAGG - Intergenic
1057671521 9:97094280-97094302 CACGTCCACCTGGATTTGCTGGG + Intergenic
1057858787 9:98623763-98623785 CAGACCCACCTGGATAATCCAGG + Intronic
1057998975 9:99846440-99846462 CATGTCCACCTGGAAGTTCCAGG + Intronic
1058978862 9:110150529-110150551 CAGACCCAACTGGATATTTCAGG + Intronic
1059231946 9:112728753-112728775 AGGGCCCACCTGGATAATCCAGG - Intergenic
1060431833 9:123557155-123557177 CGGGGCCATCTGGCTTTTCCGGG + Intronic
1061627290 9:131848564-131848586 CAGTCCCACCTGCATAATCCAGG - Intergenic
1061941925 9:133888420-133888442 CACGCACACCTGGATCTTCCAGG + Intronic
1185623167 X:1465647-1465669 CAGGCGCAGCTGGAATTCCCGGG + Exonic
1186145242 X:6618123-6618145 CAGGGCCACCTGGCTAATCCAGG - Intergenic
1186765476 X:12766342-12766364 AAGGCCCACCTGGGTAATCCAGG + Intergenic
1186940986 X:14507096-14507118 CATGCCCAACTAGATTTTCCTGG + Intergenic
1187256807 X:17650631-17650653 AAAGCACACCTGGATTTTCTTGG + Intronic
1187506249 X:19880748-19880770 TGGGCCCACCTGGATAATCCAGG - Intronic
1187506469 X:19882365-19882387 TGGGTCCACCTGGATATTCCAGG - Intronic
1187806300 X:23125256-23125278 CAGAACCACCTGTTTTTTCCAGG + Intergenic
1187939506 X:24368135-24368157 TGGGCCTACCTGGATTTTCCTGG - Intergenic
1188281243 X:28272405-28272427 CAGGACCACATGGATAATCCAGG - Intergenic
1188354987 X:29179578-29179600 CAGGCCCACCCAGATAATCCAGG - Intronic
1188382252 X:29509292-29509314 CAGGCCCACCCAGATTATCCAGG + Intronic
1189328876 X:40130690-40130712 CAGGCCCAACTGCCTTTTTCAGG + Intronic
1189954330 X:46262378-46262400 CAGGACTAGCTGGATTTCCCAGG - Intergenic
1190024507 X:46911769-46911791 CAGGCCCACCTAGATTATCCAGG + Intergenic
1190249935 X:48715433-48715455 TGGGCCCACCTGGATTGTCCAGG + Intergenic
1192495560 X:71614728-71614750 TGGGCCCACCTGGATAATCCAGG + Intergenic
1193377717 X:80781466-80781488 CAGGACTAGCTGGATTTCCCAGG - Intronic
1193468032 X:81869978-81870000 CATGACCACTTGGATTTTCATGG + Intergenic
1196420536 X:115516250-115516272 TGGGCCCACCTGGATAATCCAGG - Intergenic
1197857546 X:130932680-130932702 CAGGCCCACTCAGATTATCCAGG - Intergenic
1197857754 X:130934842-130934864 CAGGCCCACTCAGATTATCCAGG - Intergenic
1199536248 X:148906399-148906421 CAGGACTAGCTGGATTTCCCAGG + Intronic
1199752051 X:150829301-150829323 AAGGCCCACCTGGATAATCCAGG - Intronic
1200833878 Y:7713921-7713943 CAGGCACACCTGGACATGCCTGG - Intergenic
1200980969 Y:9262988-9263010 CAGGCCTACCTAGACTTTGCAGG - Intergenic
1201543787 Y:15138331-15138353 CAGGCCCACCTGCAGCTACCCGG + Intergenic
1201761665 Y:17546294-17546316 CATGCCCTCCTGGATATTCGGGG - Intergenic
1201839887 Y:18359696-18359718 CATGCCCTCCTGGATATTCGGGG + Intergenic
1201905182 Y:19079944-19079966 CAGGACTAGCTGGATTTTCTAGG + Intergenic