ID: 951710945

View in Genome Browser
Species Human (GRCh38)
Location 3:25584495-25584517
Sequence GGCCCAAGAAAAGACACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951710939_951710945 1 Left 951710939 3:25584471-25584493 CCCAGTGTTTCCCAGAAAGAGCC 0: 1
1: 0
2: 0
3: 15
4: 190
Right 951710945 3:25584495-25584517 GGCCCAAGAAAAGACACTGATGG 0: 1
1: 0
2: 2
3: 18
4: 193
951710942_951710945 -9 Left 951710942 3:25584481-25584503 CCCAGAAAGAGCCAGGCCCAAGA 0: 1
1: 0
2: 2
3: 23
4: 260
Right 951710945 3:25584495-25584517 GGCCCAAGAAAAGACACTGATGG 0: 1
1: 0
2: 2
3: 18
4: 193
951710943_951710945 -10 Left 951710943 3:25584482-25584504 CCAGAAAGAGCCAGGCCCAAGAA 0: 1
1: 0
2: 2
3: 19
4: 211
Right 951710945 3:25584495-25584517 GGCCCAAGAAAAGACACTGATGG 0: 1
1: 0
2: 2
3: 18
4: 193
951710938_951710945 21 Left 951710938 3:25584451-25584473 CCTGAATGAAGAAACAATTTCCC 0: 1
1: 0
2: 1
3: 24
4: 238
Right 951710945 3:25584495-25584517 GGCCCAAGAAAAGACACTGATGG 0: 1
1: 0
2: 2
3: 18
4: 193
951710940_951710945 0 Left 951710940 3:25584472-25584494 CCAGTGTTTCCCAGAAAGAGCCA 0: 1
1: 0
2: 1
3: 20
4: 207
Right 951710945 3:25584495-25584517 GGCCCAAGAAAAGACACTGATGG 0: 1
1: 0
2: 2
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951710945 Original CRISPR GGCCCAAGAAAAGACACTGA TGG Intronic
901947137 1:12713051-12713073 GACCGAGGAAAAGACACTGCAGG - Intergenic
903281689 1:22253903-22253925 TGCCAAAGAAAAGACACCGAGGG - Intergenic
908036227 1:60057038-60057060 GGCCTAGGAAAAAACTCTGATGG + Intronic
910459104 1:87429292-87429314 AGCAGAAGAAAAGAAACTGAGGG - Intergenic
912083839 1:105975278-105975300 GGCCCCAGCAACGAAACTGATGG - Intergenic
913322797 1:117600955-117600977 GGCCCAGGAAAACACCATGAAGG - Intergenic
914316396 1:146516214-146516236 AGCAGAAGAAAAGAAACTGAGGG - Intergenic
914497960 1:148217147-148217169 AGCAGAAGAAAAGAAACTGAGGG + Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
918089161 1:181273276-181273298 GGCCAAAAAAAAGGCACTAAAGG - Intergenic
919807501 1:201389048-201389070 GGCCCAGGAAATGAGGCTGAAGG - Intronic
921138215 1:212282055-212282077 GACCCAAGAAAAAACACTCAGGG - Intergenic
921699124 1:218247158-218247180 GGACAAAGAAGAGACATTGAAGG + Intergenic
922410390 1:225368293-225368315 GGCCAAAGAAAGCAAACTGAGGG + Intronic
923195937 1:231667361-231667383 GGCTCAGGAAAGGTCACTGAAGG - Intronic
923776802 1:236986127-236986149 AGGCCAAGGAAAGACATTGAAGG - Intergenic
1065512072 10:26489267-26489289 GGCAAAAGAAAAGTCACTGCAGG + Intronic
1068394248 10:56441289-56441311 GGACTCAGAAAAGACAATGAGGG + Intergenic
1069304090 10:66946906-66946928 GCGCCAAGAAAAGAGACTGTAGG - Intronic
1070508543 10:77138820-77138842 TTCCCAAGAAAAGAAACAGAAGG - Intronic
1070586831 10:77772771-77772793 GGCCCAAGGAAAGACATTCCAGG - Intergenic
1070839706 10:79475638-79475660 GCCTGGAGAAAAGACACTGATGG - Intergenic
1073528501 10:104209118-104209140 GTCACAAGAAATGACATTGAAGG + Intronic
1073631471 10:105154197-105154219 GGCCCGATAAAGGTCACTGAAGG - Intronic
1074463775 10:113664271-113664293 GACCCAAGAAAAGAACCTAAAGG + Intergenic
1075085998 10:119414779-119414801 TGCTCAAGAAAAGGCAATGATGG + Intronic
1075117524 10:119639337-119639359 TGCACAAGAAAATACACTGAAGG + Intergenic
1075850239 10:125580848-125580870 GTCCCAGGAAAGGACTCTGATGG - Intronic
1076319057 10:129564787-129564809 GTCCCCAGAAAAGAGGCTGAGGG - Intronic
1077648833 11:3951324-3951346 CTCCCAAGAAAAGACAAAGAGGG + Intronic
1077706712 11:4493693-4493715 GTGCCAAGACAAGAGACTGAGGG - Intergenic
1078571157 11:12458926-12458948 GACCCAAGAAGAGACAATAAAGG - Intronic
1078929845 11:15904634-15904656 GTCTCAAGAACAGACACTAATGG + Intergenic
1079138288 11:17788938-17788960 GGACCATGGAAAGGCACTGAAGG - Intronic
1079330656 11:19530035-19530057 GGCCCAACAAAGCACACTGGTGG + Intronic
1082013030 11:47463457-47463479 GGCCCAGGAAGAGAGTCTGAGGG + Intergenic
1083150647 11:60789913-60789935 GGTCCAAGAAGAGTGACTGAAGG - Intronic
1084013894 11:66367637-66367659 ACCCCCAGAGAAGACACTGAGGG - Intronic
1084083562 11:66844279-66844301 GGCCCAGGAAAAGAATCTGAGGG - Exonic
1086214219 11:84358441-84358463 GGCACAAAAAAAGAAAATGAAGG - Intronic
1087631098 11:100650979-100651001 GGCCTAAGAAATGAGACAGATGG + Intergenic
1089221556 11:116876252-116876274 GGACAAAGAACAGACACTGCAGG - Exonic
1089937722 11:122382839-122382861 GTGCCAAGAACATACACTGAAGG + Intergenic
1090000898 11:122956908-122956930 GGCCACAGAGAAGACACTTACGG + Intronic
1097257581 12:57691679-57691701 GTGCCAAGAACAGACACTGGGGG - Intergenic
1097900036 12:64863385-64863407 GCCCCAAGAAAAGAAGCAGAAGG - Intronic
1099494819 12:83334275-83334297 GGTCCATGACAAGAAACTGAGGG + Intergenic
1101737222 12:107472076-107472098 GACCAAAGAGAAAACACTGAGGG + Intronic
1109650406 13:65316526-65316548 GACATAAGAAAAGAGACTGATGG + Intergenic
1111030825 13:82595978-82596000 GCACCAAGAAAATACACTGGGGG + Intergenic
1111839263 13:93428920-93428942 GGCCCAAGAAATCACACTATTGG + Intronic
1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG + Intergenic
1113772506 13:112919060-112919082 GGCACAAGGAAAGAGAATGAAGG - Intronic
1116224508 14:42132029-42132051 GGCCCAAGAATAGACATGAAAGG + Intergenic
1119170079 14:72528343-72528365 AGCCCAAGAAGAGAAAATGAAGG + Intronic
1119607606 14:76034283-76034305 ATACCAAGAAAAGACACTTAAGG - Intronic
1120337897 14:83181566-83181588 GGACAAAGAAAAGGCACAGAAGG - Intergenic
1121072460 14:91036936-91036958 TGCTCAAGACAAGACACTGTTGG + Intronic
1121414907 14:93772704-93772726 TGCCCAGGAAGAGACACAGATGG + Intronic
1121931192 14:97973892-97973914 GGCCTCAGAAAATAAACTGAGGG + Intronic
1125935349 15:43630652-43630674 GGCCCAGCAAAAGATAATGAAGG - Exonic
1125948124 15:43727132-43727154 GGCCCAGCAAAAGATAATGAAGG - Intergenic
1129065631 15:72901694-72901716 GCCCCAAGAAGAGACACTGCGGG + Intergenic
1129617887 15:77114389-77114411 GGCCCCAGAGCAGACACTGGAGG + Exonic
1131380757 15:91962083-91962105 GGCCCAAGAACAAACTCTGGCGG + Intronic
1131536193 15:93239952-93239974 GACCCAAGCAAAGAAACTGGGGG - Intergenic
1133676928 16:8082097-8082119 GGGCCATGAAATGTCACTGAAGG + Intergenic
1136548389 16:30968017-30968039 GGCCCAAGAAAAGAGTATGAAGG - Intronic
1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG + Intronic
1146282498 17:31553871-31553893 GGTCCCAGACAAGAAACTGAGGG - Intergenic
1147434550 17:40401405-40401427 GAGCAGAGAAAAGACACTGAGGG + Intronic
1147772558 17:42878002-42878024 ACTCCCAGAAAAGACACTGAAGG - Intergenic
1148519664 17:48260607-48260629 TGCCCAAGAATAAACACTGGAGG + Intronic
1149514710 17:57271831-57271853 CACCAAAGAAAAGAAACTGAAGG + Intronic
1150463189 17:65370276-65370298 GGCAGAGGAAAAGACACAGAGGG - Intergenic
1152130496 17:78473242-78473264 GGCTTAAGAAATGACAGTGATGG + Intronic
1152887112 17:82859008-82859030 GCCCCGAGCAAAGACAATGAGGG - Intronic
1153697659 18:7660624-7660646 GGCCCAAGAGAAGAAACTCAGGG - Intronic
1153720016 18:7892157-7892179 GGCCCAAGAGAAGAAACTCAGGG - Intronic
1153852544 18:9109519-9109541 AGCCCATGAAAAGACAATTAAGG + Intronic
1156003793 18:32416600-32416622 GTTCCAAGAAAATACACTGGGGG + Intronic
1157639256 18:49196743-49196765 GGGCAAAGAAAAGTCACTAAAGG + Intronic
1159486248 18:69062024-69062046 AGGCCAAGCCAAGACACTGAAGG - Intergenic
1162582733 19:11540442-11540464 GGGCCAAGAAAAGACAGCGCTGG + Intronic
1162791701 19:13066364-13066386 GGCTCAAGAAAAGCCATTGTTGG - Intronic
1162885183 19:13691706-13691728 GGCCCAAGAACAACCTCTGAAGG + Intergenic
1166142302 19:40811613-40811635 GGCCCAGGAGACGACTCTGAGGG - Intronic
1166497384 19:43313919-43313941 GGCCAAAAGAAAGAAACTGAAGG - Intergenic
1166699226 19:44872563-44872585 GGAGCCAGAAAAGACACTGTTGG - Intronic
1167239658 19:48335998-48336020 GGTCCAAGCAAAGAGACTAACGG - Intronic
926040476 2:9668794-9668816 AGCCCAAGAAAAGAGAATGCAGG - Intergenic
926358986 2:12067479-12067501 GCCCCAGGAGGAGACACTGATGG - Intergenic
926474109 2:13301022-13301044 GTCACAAGGAAATACACTGATGG + Intergenic
926634964 2:15169170-15169192 GGCCGGAGAAAAGACACTGAGGG - Intronic
930888661 2:56357607-56357629 GGCCCAAGAAGGGACATTGTAGG + Intronic
931200844 2:60096142-60096164 GCCCCAATAAAAGTAACTGAAGG - Intergenic
931959018 2:67461017-67461039 GCCACAGGAAAAGATACTGATGG - Intergenic
932413204 2:71559270-71559292 GACCCAGGAAAAGACAGTGCTGG - Intronic
932839432 2:75067901-75067923 GTGCCAAGTAAAGTCACTGAAGG + Intronic
932981222 2:76669824-76669846 GGTCAAAGAAAAGAAACGGAAGG + Intergenic
940012896 2:149073384-149073406 GGACCAAGAAAACACCATGAGGG - Intronic
943541993 2:189227079-189227101 GGCCCAAGTAGAGATTCTGAAGG - Intergenic
945169645 2:206982236-206982258 AGACCAATAAAAGAAACTGAAGG + Intergenic
947680702 2:232029722-232029744 CCCCCAAGAAAACAAACTGAGGG - Intronic
1168985312 20:2043379-2043401 GGACACAGAAGAGACACTGAAGG + Intergenic
1169179780 20:3553554-3553576 GTCCAAAGGCAAGACACTGATGG - Intronic
1170060172 20:12250634-12250656 GTCCCAAGAAAACCAACTGATGG - Intergenic
1172788792 20:37488023-37488045 GGCCCATGGAAGGTCACTGAAGG - Intergenic
1177772532 21:25532407-25532429 GTGCCAAGACAAGAGACTGAAGG - Intergenic
1178458815 21:32782091-32782113 AACCCAAGAGAAGAGACTGAAGG - Intergenic
1181315919 22:21970840-21970862 GGCTGAAGAAAAGACAGGGAAGG + Intronic
1181661141 22:24349857-24349879 GTGTCAAGAACAGACACTGAGGG - Intronic
949452526 3:4202367-4202389 GTGCCAAGAACATACACTGAGGG - Intronic
950845585 3:16012579-16012601 GGCCCTAGGGAAGACAATGATGG + Intergenic
951710945 3:25584495-25584517 GGCCCAAGAAAAGACACTGATGG + Intronic
952004719 3:28830103-28830125 CGCCCAAGAAAAGTCAAGGATGG + Intergenic
952079422 3:29740018-29740040 GCTCCAAGCAAAGACACAGAGGG - Intronic
953810362 3:46107637-46107659 GGCTCAAAAACAGACACAGAGGG - Intergenic
956532747 3:70238655-70238677 GGGCCAAGAAAAGAAAGTAAAGG + Intergenic
959042270 3:101436151-101436173 GTGCCAAGAACATACACTGATGG + Intronic
959574198 3:107916873-107916895 GGCTCGAGAAAACACAATGATGG + Intergenic
961002608 3:123384183-123384205 GCCCCAAGAAAAGACCCTGAGGG + Intronic
962718639 3:138151286-138151308 GGACAAAGAAAAGCAACTGAAGG + Intergenic
962970569 3:140397565-140397587 GGGCCCTCAAAAGACACTGAAGG - Intronic
963199803 3:142574732-142574754 GGCCCAAGAAAGAACACAAAGGG + Intronic
964102552 3:153004780-153004802 GGACAAAGAAAAGCAACTGAAGG - Intergenic
965463657 3:169000325-169000347 GACCAAAGAAAGGACACAGAAGG + Intergenic
966663686 3:182446292-182446314 GGGCCAAGAAAAGGGACAGATGG - Intergenic
968782575 4:2594283-2594305 GGCCCCTGAACAGCCACTGAGGG - Intronic
969069295 4:4521213-4521235 GGCCAAAGAAATGTCAGTGAGGG - Intronic
970456724 4:16230161-16230183 TACCAATGAAAAGACACTGAGGG - Intergenic
970498380 4:16651547-16651569 GGTCCAAGAAAATCAACTGAGGG - Intronic
975199123 4:71565080-71565102 GGCCCAAGAATAGGGACTCAAGG + Intronic
976076270 4:81302525-81302547 TGGCAAAGAAAAGACACTGTGGG - Intergenic
977831494 4:101599241-101599263 GGCCCAACAAAAAAAACAGACGG - Intronic
979744468 4:124194059-124194081 GGCCCAAGAAGAGAAAGAGATGG + Intergenic
981298661 4:143162309-143162331 GGCCCAAGAGAAGAGAGTGGTGG - Intergenic
982915896 4:161208924-161208946 GTGCCAAGAAAATACACTGAAGG + Intergenic
984633527 4:182086423-182086445 GTGGCAAGAAAAGACACAGAAGG - Intergenic
986634248 5:9804257-9804279 GACCTAAGAAATGACATTGATGG + Intergenic
988491567 5:31709638-31709660 GGCCTTGGAAAAGATACTGAAGG - Intronic
992369878 5:76131970-76131992 GGCTCAAGTGAAGCCACTGAGGG + Exonic
993228318 5:85199191-85199213 GCCCCAAGAACATACATTGAGGG - Intergenic
994855977 5:105119620-105119642 GGCCCAATTGAAAACACTGAAGG - Intergenic
996059010 5:119012083-119012105 GGCCCAGCAAAAGATAATGAAGG + Intergenic
996839132 5:127827360-127827382 GGCCCAAGAAAAGCAAATGCTGG - Intergenic
997337172 5:133116569-133116591 GGCCCAAGAAAACAGCATGAAGG - Intergenic
997887392 5:137642463-137642485 TGCAAAAGACAAGACACTGATGG - Intronic
999090279 5:148929983-148930005 GGCCCTAGAAATGACAGGGAAGG + Intronic
1000247968 5:159465459-159465481 GGCCAGAGAAAAGACAGTGCTGG + Intergenic
1002916790 6:1535623-1535645 GGCCCAGGAAAAGACTGTCAAGG - Intergenic
1004959596 6:20771765-20771787 GGAACAAGAAAAGACACGAAGGG - Intronic
1007289521 6:40774833-40774855 AGCCCAAGTGGAGACACTGAGGG - Intergenic
1012182414 6:96171374-96171396 AGCCCAAGAAAAGGCACTGTTGG + Intronic
1012460385 6:99454188-99454210 GGGCCAAGAACAAACACTGGGGG + Intronic
1016360203 6:143259492-143259514 GGCCCAAGAAAAAACCTTGAAGG - Intronic
1017000010 6:149990126-149990148 GGCCCGAGAAAACACAGTGGCGG - Intergenic
1017143269 6:151211355-151211377 GTGCCAAGAAGATACACTGAGGG + Intergenic
1018586210 6:165362297-165362319 TGACCAAGAAAAGACAGAGAGGG + Intronic
1020462330 7:8439854-8439876 GTCCAAAGAAAAGACATTGCTGG - Intronic
1020467102 7:8493040-8493062 GCCCCAAGATAAGATCCTGAGGG - Intronic
1022236973 7:28471336-28471358 GGGCCAAGAAGATACACTGGAGG - Intronic
1022861423 7:34370958-34370980 TGCCCAAGGATAGACAGTGATGG + Intergenic
1025987833 7:66471036-66471058 TACCAATGAAAAGACACTGAGGG + Intergenic
1026187372 7:68092426-68092448 GGGCCAAGGAAAGTCACTGTGGG + Intergenic
1027210820 7:76146950-76146972 TACCAATGAAAAGACACTGAGGG + Intergenic
1028714284 7:93946837-93946859 GGGCCCAGAAAACACACTGAAGG - Intergenic
1028963783 7:96778879-96778901 GGGCCTAGGAAAGAAACTGATGG + Intergenic
1029346563 7:99983120-99983142 TGCAAAAGAAAAGACTCTGAGGG - Intergenic
1029558652 7:101287745-101287767 TGCAAAAGAAAAGACTCTGAGGG + Intergenic
1031756322 7:125647636-125647658 GGTCCAAGAAAGGAGACTGTAGG - Intergenic
1036458606 8:8931587-8931609 TGTCCTAGAAAAGACATTGAGGG + Intergenic
1036993698 8:13630076-13630098 GCCCCAAGTAGAGACAATGAGGG + Intergenic
1037983954 8:23275052-23275074 GGCAATAGAAAAGACAGTGAAGG - Intronic
1041530177 8:58856850-58856872 GGCACAAGAAAGGAGGCTGAGGG + Intronic
1041787279 8:61649007-61649029 GGCTAGAGAAAAGTCACTGAAGG + Intronic
1042137707 8:65647646-65647668 GGCCCAAGAAAACAAACCCATGG - Intronic
1042388394 8:68203824-68203846 GGCCAAAGAGAAAACAATGATGG + Intronic
1042653221 8:71066427-71066449 GACAGAAGAGAAGACACTGAAGG + Intergenic
1045724756 8:105159460-105159482 GGCCCAAAAAAAGACTTTGTGGG - Intronic
1046395095 8:113631499-113631521 GGCTAAAGAAAAGACAGAGAAGG + Intergenic
1047508058 8:125495426-125495448 GGGCCAAGAAGAGACACTCAGGG - Intergenic
1048311801 8:133328570-133328592 AGCCCAAGGAAAGACAGTGTGGG - Intergenic
1049394906 8:142395431-142395453 GGCCCCAGCAAAGACACGGGGGG + Intronic
1049745579 8:144261848-144261870 GGCCCCAGAACAGGCACTGCTGG + Exonic
1051881372 9:21843277-21843299 GGCCTAAGAAATGACATAGATGG + Intronic
1053409411 9:37905895-37905917 TGCCCAAGAAGAGCCAATGAAGG - Intronic
1055695709 9:78881925-78881947 TGCCCAACAAAAGCCACTGAAGG - Intergenic
1056155450 9:83831168-83831190 GGCCTAACAACATACACTGAAGG - Intergenic
1056355036 9:85791930-85791952 GGCCTAACAACATACACTGAAGG + Intergenic
1056590352 9:87962033-87962055 TGCCTAAGACAAGACACTGAAGG - Intergenic
1057549209 9:96039716-96039738 CACCCAAGAGAAGACTCTGAAGG + Intergenic
1058483137 9:105417165-105417187 GGCCCCAGTAAGGACACCGATGG - Intronic
1060421404 9:123472248-123472270 GGTCCAAGAAAGGCCACTGGGGG + Intronic
1061743836 9:132725685-132725707 TGCCCAAGAAAATCCCCTGATGG - Exonic
1061873522 9:133532926-133532948 GAGCCAAGAGAAGACACTGGGGG + Intronic
1186822728 X:13307546-13307568 TGCCCATGAAATGATACTGAGGG - Intergenic
1187118153 X:16374830-16374852 AGCCCAGGAAAAGACAGTGTGGG + Intergenic
1187740064 X:22345937-22345959 GGCCCAAGACAAGACACATGAGG - Intergenic
1188388791 X:29593880-29593902 GGGCCAAGAAAAGACACATTTGG - Intronic
1188423518 X:30017875-30017897 CACCCAAGAAAACACAATGAAGG - Intergenic
1189749539 X:44205742-44205764 GACCTAAGAAAAGACATAGATGG + Intronic
1191999284 X:67131134-67131156 TGCCAAAGCAATGACACTGACGG + Intergenic
1192194150 X:69017507-69017529 GGTCAAAGAAAAGAGCCTGAAGG - Intergenic
1192904748 X:75539257-75539279 GGCCTAAGAAATGAGACAGATGG - Intergenic
1193649482 X:84112195-84112217 GACCTAAGAAAAGAGATTGATGG + Intronic
1196134849 X:112197698-112197720 GACCCAAGCAATGACACGGAGGG - Intergenic
1197081545 X:122424363-122424385 GGCCTAAGAAATGAGACAGATGG - Intergenic
1197192747 X:123666458-123666480 GGCCCATGAAGTGACACTGACGG + Intronic
1197412474 X:126136369-126136391 GACCTAATAAAAGACACTGATGG - Intergenic
1197831419 X:130647055-130647077 GTCACTAGAAAAGAAACTGAGGG - Intronic
1200575482 Y:4884151-4884173 GTACCAAGAACATACACTGAGGG - Intergenic
1200935680 Y:8736250-8736272 AGCCCAAGAAAAGCCACACAGGG + Intergenic
1201930799 Y:19344289-19344311 GGCCGAAGAAATGAGACAGATGG - Intergenic