ID: 951713462

View in Genome Browser
Species Human (GRCh38)
Location 3:25611050-25611072
Sequence AAACTCAGCATGTCTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951713462_951713465 1 Left 951713462 3:25611050-25611072 CCAGTTTCAGACATGCTGAGTTT 0: 1
1: 1
2: 3
3: 30
4: 249
Right 951713465 3:25611074-25611096 ATGGGCTTCAAGCATTCAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 96
951713462_951713466 13 Left 951713462 3:25611050-25611072 CCAGTTTCAGACATGCTGAGTTT 0: 1
1: 1
2: 3
3: 30
4: 249
Right 951713466 3:25611086-25611108 CATTCAAGTGGCTATGAGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951713462 Original CRISPR AAACTCAGCATGTCTGAAAC TGG (reversed) Intronic