ID: 951713462

View in Genome Browser
Species Human (GRCh38)
Location 3:25611050-25611072
Sequence AAACTCAGCATGTCTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951713462_951713466 13 Left 951713462 3:25611050-25611072 CCAGTTTCAGACATGCTGAGTTT 0: 1
1: 1
2: 3
3: 30
4: 249
Right 951713466 3:25611086-25611108 CATTCAAGTGGCTATGAGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 120
951713462_951713465 1 Left 951713462 3:25611050-25611072 CCAGTTTCAGACATGCTGAGTTT 0: 1
1: 1
2: 3
3: 30
4: 249
Right 951713465 3:25611074-25611096 ATGGGCTTCAAGCATTCAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951713462 Original CRISPR AAACTCAGCATGTCTGAAAC TGG (reversed) Intronic
900583882 1:3423215-3423237 AAACCTAGCAAGTCTGAAAATGG - Intronic
902054988 1:13593283-13593305 AAACTCATCATATCTAAAGCCGG - Intronic
904454497 1:30639195-30639217 AAACTCAGAAAGTCTGAAGTGGG + Intergenic
904966767 1:34380232-34380254 AAACTCAGCATCTCAGACAGTGG - Intergenic
905789296 1:40781983-40782005 ACACCCAGAATATCTGAAACTGG - Intergenic
906287948 1:44600199-44600221 AAGCTCAACATGTCTGAGATGGG - Intronic
908327680 1:63039614-63039636 AAACTTACCATATCTAAAACTGG + Intergenic
908419913 1:63949733-63949755 AACTTAAGCATGTCTGAAAATGG - Intronic
909176327 1:72365906-72365928 AAATTCAGCAGGTCTGAAGAGGG + Intergenic
909328183 1:74379526-74379548 AAACTGAGCATGTCAGAAATGGG - Intronic
911078705 1:93907452-93907474 ATAATCAGTATATCTGAAACAGG - Intronic
914704627 1:150160647-150160669 AACCTCAGCATGGCTGAAAGAGG - Intronic
915088387 1:153404437-153404459 ACACTCAGCATGACTGGAAGGGG + Intergenic
915772430 1:158441667-158441689 AATCTCAGCATGTCGGAAGGCGG - Intergenic
917486962 1:175464214-175464236 AAACTCAGCACTTCTGAATGAGG + Intronic
921924940 1:220703571-220703593 AAACTCACCTTATCTGTAACGGG + Intergenic
922221582 1:223612397-223612419 CCAGTCAGCATTTCTGAAACTGG + Intronic
923521945 1:234741644-234741666 CAACTCAACATGCCCGAAACTGG - Intergenic
924694590 1:246385786-246385808 TAACTCAGTAGGTCTGAAAGTGG + Intronic
924892767 1:248301799-248301821 AACCTCATCATGTCTGCAAGAGG + Intergenic
1063303343 10:4873771-4873793 CAACTTATCATGTCTGTAACTGG - Intergenic
1063490847 10:6462438-6462460 ATACACAGCATGTCAGAAAAAGG - Intronic
1064632875 10:17335091-17335113 AAACTCTGCAAGACTGAAAAAGG - Intronic
1064885070 10:20102702-20102724 AAATTTACCATGCCTGAAACAGG - Intronic
1065176322 10:23079729-23079751 ATACTCAGAATGTCTGGACCAGG - Intergenic
1066123821 10:32319251-32319273 AAACTGAGCAAGTCAGAATCTGG + Intronic
1072403140 10:95125976-95125998 AACCTGAGCATGACTTAAACAGG - Intergenic
1076803236 10:132842490-132842512 AAACCCAGTATGTCTGTAAATGG - Intronic
1078331916 11:10429343-10429365 GAACTCAGCAAGTCTGACTCTGG + Intronic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1079451003 11:20599661-20599683 ACACTCACCATGTCTGACACAGG - Exonic
1079486375 11:20939848-20939870 AAACTCAACATGCCTAAACCTGG - Intronic
1080703593 11:34667223-34667245 AATCTCTGCCTGGCTGAAACCGG + Intergenic
1082301620 11:50512848-50512870 AATCTCAACATGGCTGCAACTGG - Intergenic
1085063510 11:73470905-73470927 AAACTCATCAGCTTTGAAACTGG + Intronic
1085777041 11:79376353-79376375 AACCTCAGCATGTAGAAAACAGG + Intronic
1087413398 11:97821725-97821747 GAAGTCATTATGTCTGAAACAGG - Intergenic
1089393471 11:118117853-118117875 AAAGTCAGATTATCTGAAACTGG - Intronic
1090193644 11:124796867-124796889 TAAATCTGCATTTCTGAAACTGG + Intronic
1090434562 11:126676077-126676099 AAATTCAGTATGTCCCAAACTGG - Intronic
1090687409 11:129138959-129138981 AAACCTACCATGTCTAAAACAGG + Intronic
1090913704 11:131144023-131144045 ATACTCAGCATATCTAAAAACGG - Intergenic
1091066565 11:132519065-132519087 AAACTATGCATGTCAGAAATGGG - Intronic
1091420762 12:338097-338119 AAACACAGCAGGCCTGAGACTGG + Intronic
1091974858 12:4816117-4816139 AAGCTTAGCATGTCTAAAAATGG + Intronic
1092044220 12:5416775-5416797 AAGCTCAGCATGCCTGAAACAGG - Intergenic
1092312245 12:7370260-7370282 AAACTCAGTATTTCAGGAACCGG - Intronic
1092763864 12:11835011-11835033 CATCTCAGAAAGTCTGAAACAGG + Intronic
1093033832 12:14314473-14314495 AAAGCCCTCATGTCTGAAACTGG - Intergenic
1093351638 12:18109586-18109608 AAATTTAACATGTCTAAAACTGG - Intronic
1094227059 12:28057453-28057475 AAACTCAACATGTTTGAGTCAGG - Intergenic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1095912685 12:47444899-47444921 AATCTCAACATGGCTGCAACTGG + Intergenic
1096407605 12:51355063-51355085 AAGCCCAGCATGTCTGTGACTGG - Intronic
1098000726 12:65939236-65939258 AAACACAGCTTCTCTGATACTGG + Intronic
1098101690 12:67024470-67024492 CAAGGCAGCATGTCTGAAATAGG + Intergenic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1098697609 12:73579468-73579490 TAATTCAACATGTCAGAAACTGG - Intergenic
1100238862 12:92689674-92689696 AAACTAAGCATGTTTTAAATTGG + Intergenic
1100327150 12:93550580-93550602 AAACTCAGATCCTCTGAAACTGG + Intergenic
1100336503 12:93635631-93635653 AAACTCTGAATTTGTGAAACTGG - Intergenic
1100608773 12:96173161-96173183 AAACCAAGCATGCCTGAAGCAGG + Intergenic
1101057298 12:100931530-100931552 ACACTTAGCATTTCTGAACCTGG + Intronic
1101521082 12:105483030-105483052 AAACTATGCATGTCACAAACAGG - Intergenic
1102652810 12:114454759-114454781 AAACCCAGCAAAGCTGAAACAGG + Intergenic
1103810594 12:123610582-123610604 AAACTCAGCATATTTGATGCAGG - Intronic
1106140726 13:27008694-27008716 AAACACAGCATCACTGAAACAGG - Intergenic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109536865 13:63733005-63733027 CAAATCAGCATGTGTGAAGCAGG - Intergenic
1109875662 13:68400889-68400911 AAACTCTGCAAGACTGAAAGAGG + Intergenic
1110708417 13:78622679-78622701 AAACTCAGAGAATCTGAAACTGG - Intronic
1110792029 13:79596989-79597011 AAAGTCAGCATTTCTCAAAATGG - Intergenic
1111015169 13:82371046-82371068 GAACTCTGAATGTCTGAGACAGG - Intergenic
1111463648 13:88579013-88579035 AAACTCACCATCCCTGAAGCTGG - Intergenic
1112495698 13:99902465-99902487 AAAATCAGCATATTTTAAACTGG + Intergenic
1112763402 13:102715457-102715479 AATCTCAGCATCACTGAAAATGG + Intergenic
1112873733 13:104008395-104008417 AAACTGGGCAAGTCTGAAATAGG - Intergenic
1113052710 13:106231620-106231642 AAACTTAAAATGTCTAAAACAGG - Intergenic
1113112151 13:106834781-106834803 AACCCCAGCATCTCTGGAACTGG + Intergenic
1117883812 14:60338306-60338328 AAACTCAGCAAGTTTGTAAATGG + Intergenic
1118036432 14:61873369-61873391 AAACCCAGCATGACAGAAAGAGG - Intergenic
1118154584 14:63226610-63226632 AAACTCAGCATATGTATAACTGG + Intronic
1118412035 14:65490233-65490255 AAGCTCAGGATTTCTGAAACTGG + Intronic
1119347306 14:73936855-73936877 AACCCCAACTTGTCTGAAACTGG + Intronic
1122185149 14:99986724-99986746 CAATTCAGCATGTCTACAACTGG + Intronic
1123797817 15:23791120-23791142 GAAGTCAGTGTGTCTGAAACTGG - Intergenic
1124663361 15:31569087-31569109 CTACTCACCATGTGTGAAACCGG - Intronic
1125070007 15:35543611-35543633 AAACTGAGCACCTCAGAAACTGG + Intronic
1127557216 15:60099396-60099418 AAGCCCTGCAAGTCTGAAACGGG - Intergenic
1128357878 15:66941218-66941240 AAACTAACCATGTATTAAACAGG + Intergenic
1129567826 15:76642808-76642830 AATCTCAAAATGTCTCAAACTGG - Intronic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1129912926 15:79243130-79243152 ATACTCAGCATGTCTGAACTGGG - Intergenic
1131392832 15:92062951-92062973 AACCTCAGCATTTCTCAAAGTGG + Intronic
1133872883 16:9705916-9705938 AAATTCAGGAGGTCAGAAACTGG + Intergenic
1135574086 16:23571695-23571717 AAAGGCAGCATCTCTGAACCTGG - Exonic
1137880928 16:52047524-52047546 TAACTTACCATGTCTGAACCAGG - Intronic
1137996118 16:53215325-53215347 AAATTCAGCCTTTCTGAAAAAGG + Intronic
1139510698 16:67426962-67426984 AGCCTCAGCATGTCTAAAGCTGG - Intergenic
1142245395 16:88967962-88967984 AAACTGAACATGTGTGAAAATGG - Intronic
1143592637 17:7894761-7894783 ACAATCAACATTTCTGAAACTGG + Intronic
1144736339 17:17557663-17557685 AAGCTCAGCAGGACTGAAATGGG + Intronic
1145832937 17:27931973-27931995 AAACTCAACATGACCCAAACTGG - Intergenic
1145979434 17:29003096-29003118 AAACTCTGCATGTGTGAATGTGG - Intronic
1146321217 17:31848110-31848132 ATGCCCAGCATGTATGAAACAGG + Intergenic
1146394305 17:32450672-32450694 TAACTCAGTATGTATGAAAGTGG + Intronic
1148290102 17:46438782-46438804 AAGATCAGCATTTCTCAAACTGG - Intergenic
1148312270 17:46656355-46656377 AAGATCAGCATTTCTCAAACTGG - Intronic
1148932198 17:51136150-51136172 ACACTCAGCATATCTGTAGCAGG + Intergenic
1148970923 17:51480621-51480643 AACCTTAGCATATCTCAAACAGG - Intergenic
1150155354 17:62848635-62848657 AAACTCAATATACCTGAAACTGG - Intergenic
1151520526 17:74626031-74626053 AAACTCACCATGTCTAATATAGG + Intergenic
1151995544 17:77606513-77606535 AAACTCAGCCTGTCAGTCACGGG + Intergenic
1155011033 18:21777856-21777878 AAAATTAGAATGTCTGAATCTGG - Intronic
1155926026 18:31656027-31656049 AGACTCAGCAGGTCTGGAGCGGG - Intronic
1156717088 18:40024284-40024306 AAATGCTGCATGTCTGAAAAAGG - Intergenic
1159000751 18:62972879-62972901 AACATCAGTATGTCTCAAACCGG - Intronic
1159382117 18:67674110-67674132 AAACTTAACATGTCCCAAACTGG + Intergenic
1159572160 18:70128433-70128455 ATTCTCAGCATATCTGACACCGG + Exonic
1160475053 18:79176300-79176322 TATCTTAGCATGTTTGAAACTGG + Intronic
1161549916 19:4906791-4906813 AAACTCAACGTGGCTGAAAGAGG - Intronic
1167771216 19:51520222-51520244 AAACTATGCCTGTCTGGAACTGG + Exonic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
927336740 2:21933243-21933265 AAAATCATCATGTGTGAAAGAGG - Intergenic
927677536 2:25117278-25117300 AGACTCAGCATGTCTGGGAGGGG + Intronic
929529925 2:42743417-42743439 GGACTCAGCATGTCAGCAACAGG + Intronic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
931130766 2:59332920-59332942 AATATAAGAATGTCTGAAACAGG - Intergenic
931940514 2:67246988-67247010 AAACTTGGCATTTCTGACACAGG + Intergenic
932122227 2:69112468-69112490 GAAATCAGCATCTCTGAATCAGG - Intronic
932987511 2:76744554-76744576 AACCCCAGCATGTCTGATCCAGG - Intergenic
933130938 2:78673457-78673479 AAGCTCAGCATGCCTGCAAAAGG - Intergenic
933328652 2:80870051-80870073 AAGGTCAGCATTTCTGAAACAGG + Intergenic
933537761 2:83597941-83597963 AAACTTACCAAGTCTGAAAAAGG + Intergenic
934134895 2:88985853-88985875 AAACTCAGTATTTTTGAGACTGG + Intergenic
934235415 2:90227900-90227922 AAACTCAGTATTTTTGAGACTGG - Intergenic
935534374 2:104276605-104276627 AATCTCAGCATCTCTAAAACTGG + Intergenic
935689190 2:105715135-105715157 AAATGCAGCATGGCTGAGACGGG + Intergenic
936663554 2:114569133-114569155 AAAGTCAGCATATCTAAACCAGG - Intronic
937044220 2:118842754-118842776 AAACGCAGCATTTTTGAAAAGGG - Exonic
937377388 2:121346797-121346819 AAAATCAGCATTTCATAAACAGG + Intronic
937399288 2:121567695-121567717 AAACACAAAATGTGTGAAACGGG + Intronic
939154966 2:138514090-138514112 AAACCCCGAATATCTGAAACAGG + Intronic
940296815 2:152134967-152134989 AAGTTCAGCAGATCTGAAACAGG + Intronic
941721273 2:168815821-168815843 AAAGTCAATATGTCTAAAACAGG + Intronic
942753106 2:179310071-179310093 TAAATCAGCATTTCTCAAACTGG - Intergenic
944650763 2:201828156-201828178 GACCTCAACACGTCTGAAACAGG - Intronic
944891828 2:204125495-204125517 AAAATCAGGATGTCAGAAATGGG + Intergenic
947368709 2:229423308-229423330 AAACTCAGTATATCTTAAAATGG - Intronic
948711284 2:239827282-239827304 AAACTCAGCAGGTCTCAAGTGGG - Intergenic
1168919715 20:1521230-1521252 AAACTCAGCAAGGCAGAACCAGG + Intergenic
1169845357 20:9985686-9985708 AAGCTTTGCATGTCTGAAAATGG + Intergenic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1171231369 20:23489250-23489272 AAAATCAGAATCTCTGGAACAGG - Intergenic
1173598237 20:44273982-44274004 CATCTTAGCATCTCTGAAACTGG + Intronic
1175058866 20:56223239-56223261 AAACTCATCTTCTATGAAACAGG + Intergenic
1175568131 20:59997123-59997145 AAACTCAGCACTTAGGAAACTGG - Intronic
1175698469 20:61120552-61120574 AAACTAAGCAAAACTGAAACAGG - Intergenic
1176425351 21:6545311-6545333 AGACCCAGCGTGTCTGAAACCGG - Intergenic
1177779389 21:25607025-25607047 AAACTCAGCATTTCTCATTCTGG - Intronic
1179233768 21:39527525-39527547 AAACTCAAAAAGTTTGAAACTGG + Intergenic
1179700842 21:43153628-43153650 AGACCCAGCGTGTCTGAAACCGG - Intergenic
1180510864 22:16087823-16087845 GATATCAGGATGTCTGAAACTGG - Intergenic
1181772131 22:25133302-25133324 AGACTTAGCATTTCTGAAAGTGG - Intronic
1181779585 22:25183073-25183095 AAGCACATGATGTCTGAAACAGG - Intronic
949416507 3:3820655-3820677 GAACAAAGCCTGTCTGAAACAGG - Intronic
949752346 3:7368864-7368886 AAATTCAACATGTTTGTAACAGG - Intronic
951056034 3:18147334-18147356 AAACTCAGCATGTTTGCTGCAGG + Intronic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952225599 3:31372412-31372434 AAATTCGACATATCTGAAACTGG - Intergenic
955821215 3:62897610-62897632 AAACTCAGTATTTCTGGAAAAGG + Intergenic
957376287 3:79363199-79363221 AAACTCATCATGGCTAAGACTGG - Intronic
957697805 3:83665375-83665397 AAAATCAGCGTGACTGAAACAGG - Intergenic
957931522 3:86884564-86884586 AAACTTAGCATGTCCAAATCTGG - Intergenic
958005149 3:87801358-87801380 GAACCCAGAATATCTGAAACAGG + Intergenic
958038199 3:88194472-88194494 AAACTCAAAATATCTGAGACAGG - Intergenic
958670653 3:97199423-97199445 TAAATCAGAATCTCTGAAACGGG - Intronic
958904112 3:99923339-99923361 ATACTCAACATGTCTAAACCAGG + Intronic
959037116 3:101380189-101380211 AAACTCTGTATCTATGAAACAGG - Intronic
959946452 3:112130517-112130539 AAACTCAACATATCAGAAACAGG + Exonic
962084938 3:132180765-132180787 AAACTCAGCAAGTCCGAGACAGG + Intronic
962179283 3:133188698-133188720 TTACTCAGCCTGTCTAAAACAGG - Intronic
963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG + Intergenic
964146008 3:153464236-153464258 TATCACAGAATGTCTGAAACTGG - Intergenic
964468163 3:157021476-157021498 AAAATCAGCAGAGCTGAAACTGG - Intronic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965629322 3:170715329-170715351 AAACTCAGAATGAGAGAAACAGG + Intronic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
965913365 3:173810542-173810564 ACAATCAGGATGTCTGGAACAGG + Intronic
966643545 3:182217073-182217095 AAACACAGCAAGTCTAAAATAGG + Intergenic
967705523 3:192645528-192645550 GAAGTCAGCAGTTCTGAAACTGG - Intronic
968210097 3:196841915-196841937 AAACTCTGCAATTCTGAAAGAGG - Intergenic
969461845 4:7333180-7333202 AAACTCAGCCAGTCAGAAATGGG - Intronic
969959467 4:10929237-10929259 AACCCCAGCATGTTTGATACTGG - Intergenic
970634724 4:17995474-17995496 AAACTCAGCATTAAAGAAACCGG + Intronic
970870354 4:20810026-20810048 AAACTCAGCATGACTCACTCAGG + Intronic
971267964 4:25111372-25111394 CCACTCAGCATGTGTGAACCTGG - Intergenic
973576769 4:52297576-52297598 AAACTCAGAAAGTCTCAAAGAGG + Intergenic
974845001 4:67341483-67341505 AAACTCAGGATGTGACAAACTGG - Intergenic
975353368 4:73370460-73370482 GAAGTCAGTATGTCTGAAATAGG - Intergenic
976268417 4:83206618-83206640 AAACGGAGCATTTCTGCAACCGG + Intergenic
978770902 4:112455744-112455766 AAACCCAGCATCTCAGAACCAGG - Intergenic
981542535 4:145860692-145860714 AAACTCAGGATGGCTTAAAATGG + Intronic
982467780 4:155751507-155751529 AAACACAGCATATGTGAAAATGG + Intergenic
984002475 4:174267183-174267205 AAACTCAGCATGCCTGAGGATGG + Intronic
984866383 4:184284042-184284064 AAGCTCAGCATGGCTGTGACGGG - Intergenic
985288132 4:188357952-188357974 TAACTCACCTTGCCTGAAACAGG - Intergenic
987265367 5:16247765-16247787 AAAGTCAGCATGTTAGAAAATGG + Intergenic
987361937 5:17115316-17115338 AAAATTAGCAGGTCTGAAACAGG - Intronic
987439123 5:17933693-17933715 AAACTCAGAAATTCTAAAACTGG + Intergenic
989989842 5:50748825-50748847 AAGCTCAGAAAATCTGAAACAGG - Intronic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
990988191 5:61660307-61660329 AGAATTAGCAAGTCTGAAACTGG - Intronic
993106070 5:83602369-83602391 AAACTTAACAGGTCTAAAACTGG + Intergenic
993189340 5:84661412-84661434 AAACCCAGCATTTCTGCAATTGG + Intergenic
994938123 5:106283028-106283050 TAAATCAGCATGTTAGAAACTGG + Intergenic
994942885 5:106347510-106347532 TTACTCAGCATGTCTAAAACTGG + Intergenic
995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG + Intergenic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
997963436 5:138338939-138338961 AACCTCAGCATCCCTGAAACAGG + Intronic
999732615 5:154486107-154486129 AAACCCATTATGTCTCAAACTGG + Intergenic
1000627434 5:163555300-163555322 AAAATCAGCATTTCAGAAACAGG - Intergenic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1002674490 5:180899730-180899752 TAACTCAGCATGTCTTTAGCTGG - Intronic
1002924454 6:1596862-1596884 GCATCCAGCATGTCTGAAACAGG + Intergenic
1004038716 6:11952618-11952640 TAACTATGCAAGTCTGAAACTGG + Intergenic
1005120057 6:22379803-22379825 TAATTTAGAATGTCTGAAACAGG + Intergenic
1005717222 6:28561492-28561514 AAACTCATCAAGTCAGAAAAAGG + Intergenic
1006029333 6:31167893-31167915 AAAGTCACTATGTCTGCAACAGG - Intronic
1008589079 6:52975367-52975389 AAAGTCAGCATGAGTGAGACAGG - Intergenic
1009611155 6:65943056-65943078 AAACTAAGCAATTCTGAAATTGG - Intergenic
1010771904 6:79841394-79841416 ACACTCAGCATGTCTAAAGATGG - Intergenic
1011293087 6:85797619-85797641 AAACTCAAGATGTCTGAAAATGG - Intergenic
1015210005 6:130686208-130686230 AAAGATAGCATGTCTGAAACTGG - Intergenic
1017105743 6:150886019-150886041 AAATTGAGCATGTTTAAAACAGG - Intronic
1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG + Intergenic
1018617841 6:165704793-165704815 AAAATGATCAAGTCTGAAACAGG - Intronic
1021855190 7:24848350-24848372 AAATTTAGCATATCTGAAGCAGG + Intronic
1022608623 7:31844633-31844655 AAACTCAGCAAACCTAAAACAGG - Intronic
1022733605 7:33055538-33055560 AAATTCAGCTTGACTGAAATAGG + Intronic
1024886644 7:54149534-54149556 AAATTTAACATGTCTGAAACTGG - Intergenic
1026341566 7:69438752-69438774 ATACTCAGCATCTGGGAAACAGG - Intergenic
1028954330 7:96672416-96672438 AAACTCAGCAGGGATGAAGCTGG - Intronic
1030052333 7:105549312-105549334 AAACTACGCATGTCTTATACAGG - Intronic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1031718426 7:125137305-125137327 AAACTCAGCATGTTTGATCTGGG - Intergenic
1032382690 7:131501691-131501713 AAGCTCAGCATGACTTAAACAGG - Intronic
1032487158 7:132296618-132296640 AAAGCCAGCATTTCTGAACCTGG - Intronic
1033633758 7:143189055-143189077 AAAATGAGCACGACTGAAACAGG + Intergenic
1034692454 7:153024662-153024684 AAACTGAAGATGTCTGAAGCCGG + Intergenic
1038228787 8:25681637-25681659 GAACTCAGGATGCCTGAAACTGG + Intergenic
1038717759 8:30007192-30007214 AAACCCAAAGTGTCTGAAACAGG - Intergenic
1043825826 8:84927333-84927355 TAAATCAGAATATCTGAAACTGG - Intergenic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1044596235 8:93961477-93961499 AAACATAGCATGTCTGAGGCTGG - Intergenic
1044965549 8:97570606-97570628 TAACTCAACATCTCAGAAACTGG + Intergenic
1046029125 8:108762271-108762293 AAACCCAGCATGTTGGAAGCTGG - Intronic
1046980565 8:120332107-120332129 AAACACAGCATGTCAGCAAGTGG - Intronic
1047448531 8:124941673-124941695 ATACTCAGCGTTTCTGACACTGG - Intergenic
1050248868 9:3722254-3722276 AAACACAGCATCACTGAAAACGG - Intergenic
1053754756 9:41294141-41294163 AATCCCAGCATGTCTCAATCTGG + Intergenic
1054260278 9:62858444-62858466 AATCCCAGCATGTCTCAATCTGG + Intergenic
1054331490 9:63761561-63761583 AATCCCAGCATGTCTCAATCTGG - Intergenic
1055503812 9:76928328-76928350 ACACTAAGCATGTAAGAAACAGG + Intergenic
1058305046 9:103429834-103429856 AAACTCAGCATTCCTCCAACTGG + Intergenic
1059632912 9:116143657-116143679 AAACTGAGTATGACAGAAACAGG - Intergenic
1059819159 9:117952420-117952442 AAACTCAGCATGGATGAAGCAGG - Intergenic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1060245355 9:121941455-121941477 AAAGTCAACCTGTCTAAAACTGG + Intronic
1202798861 9_KI270719v1_random:154475-154497 AATCCCAGCATGTCTCAATCTGG - Intergenic
1185698784 X:2214779-2214801 ACAGGCAGCAGGTCTGAAACTGG - Intergenic
1186786654 X:12962281-12962303 AAAGCCAGCATGGCTGAAGCAGG - Intergenic
1187956990 X:24529044-24529066 TAACTCAGCATGTTGGAAACAGG + Intronic
1187978393 X:24728472-24728494 AAACTCAGTTTGTTTGAATCAGG + Intronic
1190481157 X:50878210-50878232 AAACTCAGCATGAGGGAATCTGG + Intergenic
1191881650 X:65848750-65848772 AAACTCAGGATGTATCAAATGGG - Intergenic
1194149872 X:90310371-90310393 AAAAACAGATTGTCTGAAACTGG - Intergenic
1196530415 X:116779966-116779988 AAATTCAGCATGTGGGAAGCAGG - Intergenic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1197415386 X:126166475-126166497 AAACAACGCATGTCTGATACTGG - Intergenic
1199470088 X:148185612-148185634 AAAATGGGCATGTCTGAAATTGG - Intergenic
1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG + Intronic
1200157139 X:153982920-153982942 ACACACAGGATGTCTGACACTGG - Exonic