ID: 951716110

View in Genome Browser
Species Human (GRCh38)
Location 3:25648316-25648338
Sequence GGGAGCAGACAGATGGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 2, 1: 1, 2: 6, 3: 65, 4: 495}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951716105_951716110 8 Left 951716105 3:25648285-25648307 CCACAAGTAAAGCAGACAAAGAC 0: 1
1: 0
2: 1
3: 16
4: 226
Right 951716110 3:25648316-25648338 GGGAGCAGACAGATGGACAGAGG 0: 2
1: 1
2: 6
3: 65
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951716110 Original CRISPR GGGAGCAGACAGATGGACAG AGG Intronic
900177724 1:1298222-1298244 GGGAGCAGAGAGCTGGACACGGG - Intronic
900288800 1:1915087-1915109 GGGAGGAGACAGCAGGACATGGG - Exonic
900571955 1:3363021-3363043 GGGAGCAGAGAGAAGGACCCTGG + Intronic
900638363 1:3676428-3676450 GGGAGAGGACAGAGGAACAGGGG + Intronic
900643448 1:3698160-3698182 ATGGGCAGACAGATGGGCAGGGG + Intronic
901225735 1:7611966-7611988 GGGTGCACAGAGATGGGCAGGGG + Intronic
901633455 1:10658924-10658946 GGGGGCAGGCAGCTGGGCAGGGG + Intronic
902705075 1:18199003-18199025 GGGACCAGTGAGATGGGCAGGGG - Intronic
903226897 1:21898914-21898936 GGGAGCAGGGAGCTGGTCAGCGG + Intronic
903282356 1:22257276-22257298 GGGAGGACACAGAGGCACAGGGG + Intergenic
903564431 1:24253994-24254016 TGGAGCAGACAGACCCACAGAGG - Intergenic
904331657 1:29761666-29761688 GGGAGCAGAAACATCCACAGTGG - Intergenic
904392999 1:30198028-30198050 GGGAGGAGAGAGAGAGACAGGGG + Intergenic
904393005 1:30198068-30198090 GGGAGGAGAGAGAGAGACAGAGG + Intergenic
904393037 1:30198230-30198252 GGGAGGAGAGAGAGAGACAGAGG + Intergenic
904562509 1:31408264-31408286 CTGTGCAGAGAGATGGACAGAGG - Intergenic
905388712 1:37622647-37622669 GGGAGGAGACTGAGAGACAGAGG + Intronic
905483625 1:38279803-38279825 GGAAGCAGACAGTTAGACAGAGG - Intergenic
905628203 1:39502605-39502627 GGGGGCAGTCAGAAGGACACAGG + Intronic
905630168 1:39514165-39514187 GGGAGCAGAGACATGGGCTGGGG + Intronic
905667592 1:39772025-39772047 GGGAGCAGAGACATGGGCTGGGG - Intronic
905803185 1:40858935-40858957 GACAGCAGACAGATGGACAGGGG - Intergenic
906293416 1:44634573-44634595 GGGACCAGACTGATGGGGAGTGG - Intronic
906646315 1:47478047-47478069 GGGAGGGGACAAAGGGACAGTGG - Intergenic
907415409 1:54310881-54310903 GGGAGCATGCAGATTGGCAGTGG + Intronic
908930409 1:69311515-69311537 CGGAGCACAGAGCTGGACAGAGG - Intergenic
911260992 1:95685221-95685243 GGGAGGTGACAGAAGGACAGAGG - Intergenic
911518284 1:98895822-98895844 GTTAGCAGACAGATAAACAGAGG + Intronic
912274480 1:108242035-108242057 GGGGGCAGGCAGATGGGCAGGGG - Intronic
912286787 1:108377823-108377845 GGGGGCAGGCAGATGGGCAGGGG + Intronic
912293739 1:108452306-108452328 GGGGGCAGGCAGATGGGCAGGGG + Intronic
912412098 1:109486626-109486648 GGGAGGAGATAAAGGGACAGGGG + Intronic
912681928 1:111734240-111734262 AGGGGCAGACAGATGGAGAGGGG + Intronic
912716810 1:111989322-111989344 GGGAGCAGACAGCCGGCCCGGGG - Intergenic
912756574 1:112329504-112329526 GGCAGCTGACAGATGGGGAGAGG - Intergenic
912965177 1:114230879-114230901 GGGAGCAGACGGGAGGAGAGGGG + Intergenic
913243415 1:116850610-116850632 GGGAACAGAGGGAAGGACAGAGG - Intergenic
913414750 1:118592705-118592727 GGAAGCAGACACATGAAAAGAGG + Intergenic
913566554 1:120078501-120078523 GGGAACAGAAAGAAGGAAAGAGG - Intergenic
913631577 1:120715043-120715065 GGGAACAGAAAGAAGGAAAGAGG + Intergenic
914287312 1:146239213-146239235 GGGAACAGAAAGAAGGAAAGAGG - Intergenic
914456702 1:147843267-147843289 GGGAGCAGACATGTGCAAAGAGG + Intergenic
914548344 1:148689955-148689977 GGGAACAGAAAGAAGGAAAGAGG - Intergenic
914618337 1:149381753-149381775 GGGAACAGAAAGAAGGAAAGAGG + Intergenic
915326816 1:155085020-155085042 CGGAGCGGTCAGATGGAAAGCGG + Intronic
915633862 1:157173028-157173050 GAGAGCAGAGAGATGGACCAGGG + Intergenic
915658213 1:157379607-157379629 GGGAACAGAGAGATGGACCAAGG + Intergenic
915670804 1:157487084-157487106 GGGAACAGAGAGATGGACCAAGG - Intergenic
916894895 1:169151817-169151839 GGGAGGAGGCAGATGGACAGAGG - Intronic
917659520 1:177164202-177164224 GGGAGAAGTCAGGTGCACAGAGG + Intronic
917972992 1:180220324-180220346 GGGAGCAGAGAAAAGGACTGGGG + Intergenic
918004921 1:180532980-180533002 GAGACCAGACAGATTCACAGTGG - Intergenic
918424373 1:184393230-184393252 GGGAGGAGCCAGATAGACAGTGG - Intronic
919278148 1:195447797-195447819 AGGACCAGACAGATTCACAGCGG + Intergenic
919714349 1:200759996-200760018 GGGAGCAGACATTGGGAGAGTGG + Intronic
919977162 1:202620180-202620202 CTGGGCAGACAGAAGGACAGCGG - Intronic
920856158 1:209663926-209663948 AGGAGGGCACAGATGGACAGAGG + Intergenic
920957778 1:210634896-210634918 GGCAGGAGAAAGAGGGACAGTGG + Intronic
921399165 1:214701751-214701773 GAGAGCGGACAGAAGGAAAGTGG - Intergenic
921496689 1:215851572-215851594 AGGACCAGACAGATTCACAGCGG + Intronic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
923386307 1:233468104-233468126 GGGATTAGACAAATGGACATAGG + Intergenic
923779231 1:237007410-237007432 GGGAGGAGAGAGAGGGAGAGAGG - Intergenic
923786647 1:237074445-237074467 GGGAGGACACTGATGGATAGAGG + Intronic
1063812720 10:9732117-9732139 GGGAGCAGGCAGCTGGAGAACGG + Intergenic
1064099383 10:12450579-12450601 GGCAGCTCACACATGGACAGTGG + Intronic
1064140113 10:12783336-12783358 GGGAGCAGCCTGGGGGACAGGGG - Intronic
1065168587 10:23005905-23005927 GGGAGAAGAGAGCTGGGCAGAGG + Intronic
1066199676 10:33132818-33132840 GGGAGTAGACACATGAACACAGG - Intergenic
1066491492 10:35899206-35899228 GGGAGCCGACAGAGTGGCAGCGG + Intergenic
1069372992 10:67766785-67766807 CAGAGCAGAAAGATGGAAAGAGG - Intergenic
1069393651 10:67964707-67964729 GGGAACAGAGAAATGGGCAGGGG - Intronic
1069830629 10:71280251-71280273 AGAAGCAGAAAGATGGAAAGTGG - Intronic
1069835829 10:71307481-71307503 GGGAGCAGGAAGATGGGAAGGGG + Intergenic
1070170393 10:73928476-73928498 GGGAGCAGACAGAAGGGCAATGG + Intergenic
1071364576 10:84885391-84885413 TGCAGAAGACAGATGAACAGTGG - Intergenic
1071564572 10:86665159-86665181 GGGAGCAGCCAGAGGGACCCTGG + Intronic
1074419092 10:113293413-113293435 AGGAGCAGACATGTGGTCAGTGG - Intergenic
1075609571 10:123841556-123841578 TAGAGCAGTCAGATGTACAGAGG - Intronic
1075891823 10:125958183-125958205 GGGAGCAGAGAGATAGGAAGAGG - Intronic
1075911123 10:126126683-126126705 GGGTGGAGACAGAAGCACAGTGG + Intronic
1076014205 10:127014834-127014856 GTAAGCAGACAGATGGGCAAAGG - Intronic
1076563891 10:131385575-131385597 AGGAGCAGAGAGAGGGATAGAGG + Intergenic
1076564109 10:131386566-131386588 AGGAGCAGAGAGAGGGGCAGAGG + Intergenic
1077471480 11:2762899-2762921 GTGGGCAGACAGATGAACAGTGG - Intronic
1077629898 11:3804282-3804304 GGAAGCAAGCAGATGAACAGGGG + Intronic
1077778918 11:5303543-5303565 TGGTGGAGAGAGATGGACAGAGG + Intronic
1078590077 11:12632941-12632963 GGGAGCAGCCAGAAAGACAGAGG - Intergenic
1078664440 11:13313119-13313141 GGGAGCAGTCAGCTGGGCATTGG - Intronic
1078715557 11:13836051-13836073 GGGAGTTGACTGATGAACAGAGG - Intergenic
1078958872 11:16239407-16239429 GGAAGCTGACAGAAAGACAGCGG + Intronic
1079146407 11:17856204-17856226 GGCAGCAGAGATATTGACAGAGG - Intronic
1080847941 11:36042746-36042768 GGAAGCAGAAATATGTACAGAGG + Intronic
1081736863 11:45410427-45410449 GGGAGAAGATGGAGGGACAGAGG - Intergenic
1082085966 11:48049794-48049816 GTGGGCAGACAGATTGACAGTGG + Intronic
1083016342 11:59457902-59457924 GTGAGCAGTCAGATGGAGAGTGG + Exonic
1083427122 11:62593920-62593942 GGGTGCAGGTAGAGGGACAGGGG + Exonic
1083738687 11:64696066-64696088 GGGAGCAGAGAGATGGAGGAAGG - Intronic
1084179186 11:67438115-67438137 GGGAGCAGAGGGCTGGGCAGTGG + Exonic
1084432974 11:69121864-69121886 GGGCTGAGACAGATGGGCAGGGG - Intergenic
1084536095 11:69758047-69758069 GGGCGCAGACAGAGGGAAACTGG + Intergenic
1084596970 11:70122765-70122787 AGGAGGAGACAGAGAGACAGAGG - Intronic
1084668707 11:70592586-70592608 GGGTGCAGACAGAGGGACAGAGG - Intronic
1086114821 11:83237872-83237894 GGGAGCAGTCAAAGGGAGAGAGG - Intronic
1086480744 11:87235260-87235282 TGGAGAAGAGAGATGGAGAGAGG + Intronic
1086875240 11:92087921-92087943 GGGAGAGGAAAGATGGAGAGGGG - Intergenic
1087397675 11:97622287-97622309 CAGAGCTGACAGATGGACAGAGG - Intergenic
1087608648 11:100407516-100407538 GGGAACACAAAGATAGACAGTGG - Intergenic
1088096405 11:106105852-106105874 GGAGGAAGACAGAAGGACAGAGG - Intergenic
1089983337 11:122790339-122790361 GGGAGCAGAGTGAGGGAGAGGGG - Intronic
1090048602 11:123358242-123358264 GGGAGGAGAGAGACGGAGAGAGG + Intergenic
1090080499 11:123609304-123609326 GGGAGGAGGCAGAAGCACAGAGG - Intronic
1090362790 11:126185274-126185296 GAGAGACGACAGAGGGACAGAGG + Intergenic
1090374822 11:126281330-126281352 GGGGGAAGACAGATGCACGGAGG - Intergenic
1090468526 11:126957220-126957242 GGGAGCAGCCAGAGAGTCAGAGG - Intronic
1090585942 11:128213406-128213428 CAGAGCAGAGAGATGGTCAGTGG - Intergenic
1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG + Intronic
1090983557 11:131745954-131745976 GGCAGCAGAAAGAGGGACACAGG - Intronic
1090988876 11:131798245-131798267 AGGAGCAGACAGATGCCCAGGGG - Intronic
1091221504 11:133932237-133932259 GAGAGCAGACAGACAGACACAGG + Intronic
1091221535 11:133932490-133932512 GAGAGCAGACAGACAGACACAGG + Intronic
1091221565 11:133932679-133932701 GAGAGCAGACAGACAGACACAGG + Intronic
1091221613 11:133932985-133933007 GAGAGCAGACAGACAGACACAGG + Intronic
1091221619 11:133933020-133933042 GAGAGCAGACAGACAGACACAGG + Intronic
1091395247 12:150433-150455 GGGGGCAGCCACCTGGACAGTGG + Intronic
1091776503 12:3188383-3188405 GGAAGCAGACAGAGCGGCAGGGG + Intronic
1092173588 12:6388427-6388449 AGGAGCAGAAAGAAGGCCAGTGG - Exonic
1092255754 12:6926099-6926121 GGGAGCAGACTGACTGCCAGAGG + Intronic
1092766935 12:11861465-11861487 GGGCCCAGACAGATGCAAAGAGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093993273 12:25613959-25613981 GAGAGGAGACAGAAGGACAAAGG + Intronic
1094018705 12:25891478-25891500 GTGAGCACACAGGTGGACAAAGG - Intergenic
1095393711 12:41739947-41739969 GGGGGCAGACAGAGAGAGAGGGG - Intergenic
1096499368 12:52055717-52055739 GGGAGAAGGCAGGTGGACAAGGG + Intronic
1096777890 12:53974861-53974883 GGGAGCAGACAGGGGGCCCGAGG + Intronic
1097576996 12:61407075-61407097 GGGAGCAGATAAAAGGAGAGGGG + Intergenic
1098627935 12:72696466-72696488 GTGAAAAGACAGATGGGCAGAGG - Intergenic
1100324925 12:93531648-93531670 GGGAGAAGACACATGGAGAAGGG - Intergenic
1101485825 12:105158387-105158409 TGGAGCAGACAGATGTAATGTGG + Intronic
1101557538 12:105824388-105824410 GGGAGAAGGCAGAGGGGCAGTGG + Intergenic
1101751186 12:107583629-107583651 GGGGGCGCAGAGATGGACAGTGG - Intronic
1102208484 12:111106852-111106874 GGGAGAGGAAAGAAGGACAGGGG + Intronic
1102257217 12:111423132-111423154 GGGAGCAGAGAGAGGGAGATGGG + Intronic
1102693543 12:114780537-114780559 GGTAGCAGAGTGATGGAAAGAGG + Intergenic
1103013759 12:117478066-117478088 GGGAGCAGTCAGCGGGAGAGGGG + Intronic
1103949508 12:124543259-124543281 GGGAGCAGACAGGTGGCCCTGGG - Intronic
1104366436 12:128182203-128182225 GAGAGGAGAGAGATGAACAGAGG - Intergenic
1104427648 12:128691418-128691440 ATGCACAGACAGATGGACAGAGG - Intronic
1104985454 12:132594034-132594056 GGGAGCAGAGAGCAGGACGGCGG + Intergenic
1105317530 13:19280273-19280295 AGGACCAGACAGATTCACAGCGG + Intergenic
1107263578 13:38524681-38524703 GGGACCAGAAAGAAGGAGAGGGG - Intergenic
1107301626 13:38971999-38972021 GGGGGCAGGCATAAGGACAGAGG - Intronic
1107645313 13:42488529-42488551 GAGAGCAGACAGGTGGCCAGTGG + Intergenic
1107998633 13:45886711-45886733 GGAAGCAGACACATGCAAAGAGG + Intergenic
1109589806 13:64463182-64463204 GGGAGCAGACAGATGGACAGGGG - Intergenic
1109669746 13:65588706-65588728 AGGACCAGACAGATTCACAGCGG + Intergenic
1111757987 13:92422613-92422635 GGAAGAAGACAGTTGAACAGTGG - Intronic
1112383897 13:98919899-98919921 GAAAGCAGAAAGATGAACAGGGG - Intronic
1112427129 13:99312826-99312848 GGAAGCAGAGAGGAGGACAGTGG + Intronic
1112558754 13:100493173-100493195 GAGAGCACGCAGATGGGCAGGGG - Intronic
1113481698 13:110626230-110626252 GGGTGCAGTCAGATGGTGAGAGG + Intronic
1113572974 13:111371827-111371849 GGGAGGAGACAGAAGCACAGAGG + Intergenic
1113643304 13:111973689-111973711 AGGAGGAGAGAGATGGACAGAGG - Intergenic
1113647596 13:112010156-112010178 AGGAGCAGACAGCAGCACAGTGG + Intergenic
1114552664 14:23542325-23542347 GGGAGCAGACAGGAGGAGAAGGG + Intronic
1118693689 14:68363819-68363841 GGGAGCACACAGAAGCACAGTGG - Intronic
1118760258 14:68876686-68876708 GGGAGCAGGAAGAGGGACTGTGG - Intronic
1118810362 14:69268744-69268766 GGGAGCAGAAAGATGGGAAAAGG + Intronic
1119630600 14:76228691-76228713 GGGAGGAGACAGATGAGGAGTGG - Intronic
1120138309 14:80897686-80897708 AGCAGGAGAGAGATGGACAGGGG - Intronic
1120481793 14:85058607-85058629 GGAACCAGAAAGATGGGCAGAGG - Intergenic
1121231921 14:92364646-92364668 TGCAGCAGGCAGAGGGACAGAGG - Intronic
1121778948 14:96609417-96609439 GGGGGCAGCCAGTTGGGCAGGGG - Intergenic
1122198625 14:100108463-100108485 GGGAGCAGGCAGGAGGCCAGGGG - Intronic
1122736997 14:103848510-103848532 GAGAGCAGACAGGGGGACTGAGG + Intergenic
1124460228 15:29883150-29883172 GGAAGCAGACAGATTTCCAGTGG - Intronic
1124492825 15:30168564-30168586 CTGGGCAGACAGAAGGACAGTGG - Intergenic
1124750709 15:32369761-32369783 CTGGGCAGACAGAAGGACAGTGG + Intergenic
1124836954 15:33204599-33204621 GGCAGCAGAGAGGTGGACTGAGG + Intergenic
1125101812 15:35922391-35922413 ATGAGCAGACAGATGAAGAGAGG - Intergenic
1125546832 15:40512163-40512185 GGGAGCAGAGAGGAGGGCAGAGG - Intergenic
1126654122 15:50957248-50957270 GGGAGCTGACAGGGGGACTGGGG + Intronic
1127130004 15:55852614-55852636 GAGAGTAGACATAGGGACAGAGG - Intronic
1127429347 15:58887006-58887028 GGGAGCAGAGAGGGAGACAGAGG - Exonic
1128050119 15:64656752-64656774 GGGAGGAGAAAGAGGGAGAGAGG - Intronic
1128751986 15:70156383-70156405 GCGGGCAGACAGACAGACAGAGG - Intergenic
1128785685 15:70395236-70395258 GGGAACAGACAGAAGGACACAGG + Intergenic
1129034520 15:72641355-72641377 GGGAGGAGGCAGAGGGACAGAGG + Intergenic
1129139558 15:73584924-73584946 GGAACCAGACAGAGGGACAGTGG - Intronic
1129215362 15:74095861-74095883 GGGAGGAGGCAGAGGGACAGAGG - Intergenic
1129360255 15:75019951-75019973 GGGAGGAGGCAGAGGGACATAGG - Exonic
1129392264 15:75226346-75226368 GGGAGGAGGCAGATGGACAGAGG + Intergenic
1129472130 15:75761819-75761841 GGGAGGAGGCAGATGGACAGAGG - Intergenic
1129716736 15:77856637-77856659 GGGAGAAGGGAGAGGGACAGAGG + Intergenic
1129732505 15:77940190-77940212 GGGAGGAGGCAGAGGAACAGAGG - Intergenic
1129846612 15:78770694-78770716 GGGAGGAGACAGAGGGCCAGAGG + Intronic
1129846623 15:78770735-78770757 GGGAGGAGACAGAGAGAGAGGGG + Intronic
1130255299 15:82323259-82323281 GGGAGGAGACGGAGGGGCAGAGG - Intergenic
1130599674 15:85266747-85266769 GGGAGGAGACCGAGGGGCAGAGG + Intergenic
1131066546 15:89438462-89438484 GTGGGCAGACAGATGGGAAGAGG - Intergenic
1132720571 16:1313715-1313737 GTGAGGAGACAGATGTTCAGAGG - Intronic
1132768940 16:1550272-1550294 GGAAGCAGACAGATGCTCTGAGG + Intronic
1132841995 16:1982590-1982612 AGGAGCATACAGATGGAGGGTGG - Exonic
1133619190 16:7510112-7510134 GGGAGCAGTCAGATGTTGAGGGG + Intronic
1133718172 16:8469169-8469191 CAGAGCAGACACATGGAAAGAGG - Intergenic
1133796913 16:9053510-9053532 GGAACCAGCCAGGTGGACAGAGG - Intergenic
1134681790 16:16131558-16131580 GGGAGGGGACAGAGGGACACAGG + Intronic
1135796453 16:25447772-25447794 GAGAGAGGAGAGATGGACAGGGG + Intergenic
1136103414 16:28011644-28011666 AGGAGGAGGCAGATGGACATTGG - Intronic
1136296342 16:29305679-29305701 GGGAGCAGAAAGATTAAAAGGGG - Intergenic
1136674228 16:31885633-31885655 GTGAGGAGAGTGATGGACAGTGG + Intronic
1136695460 16:32076674-32076696 AGGACCAGACAGATTCACAGCGG + Intergenic
1136795956 16:33019919-33019941 AGGACCAGACAGATTCACAGCGG + Intergenic
1136873965 16:33834479-33834501 AGGACCAGACAGATTCACAGCGG - Intergenic
1138074835 16:54031878-54031900 ATGGGCAGACAGATGGAAAGAGG + Intronic
1138517165 16:57542556-57542578 GGGAGCAGAGAGAAGTGCAGTGG + Intronic
1139120004 16:64004125-64004147 GTGAACAGACAGACAGACAGTGG - Intergenic
1139949207 16:70661002-70661024 GGGGGCAGCCAGATGGAGGGAGG - Intergenic
1140793841 16:78416873-78416895 GGGAGGACACAGATTCACAGGGG + Intronic
1140887700 16:79259221-79259243 AGGAGCAGACAGAAGGCCAAGGG - Intergenic
1141040852 16:80671159-80671181 GGGAGCAGACAGGTGGGTATAGG + Intronic
1142057935 16:88011823-88011845 GGGAGCAGAAAGATTAAAAGGGG - Intronic
1203098214 16_KI270728v1_random:1281577-1281599 AGGACCAGACAGATTCACAGCGG + Intergenic
1142809599 17:2389139-2389161 TGTGGCAGACAGAAGGACAGTGG - Intronic
1142983377 17:3684107-3684129 GGGAGGAGACACAGGGACTGAGG - Intronic
1143325683 17:6096687-6096709 GGGAGCAGAGCGATGGGTAGAGG + Intronic
1144766826 17:17737701-17737723 TGCAGCAGACAGATGGAGGGGGG + Intronic
1144960495 17:19041714-19041736 GGCCCCAGACAGATGGACAGAGG + Intronic
1144974665 17:19132810-19132832 GGCCCCAGACAGATGGACAGAGG - Intronic
1146149903 17:30458524-30458546 GGGAGCAGGGAGGTGGGCAGGGG - Intronic
1146484589 17:33232799-33232821 GAGAGGAGAGAGATGGACACAGG + Intronic
1147580445 17:41624677-41624699 GGGAGCTGGCAGGTGGCCAGTGG - Intronic
1147672689 17:42185649-42185671 GGGAGCAGATAGACAGACAAGGG - Intergenic
1147911124 17:43856960-43856982 GGAGGCAGCCAGATGGGCAGAGG - Intronic
1148389011 17:47256676-47256698 GGGAGAAGAGAGATTGACTGAGG + Intronic
1149503772 17:57175684-57175706 GGGAGCAGACATGTGCACAGAGG + Intergenic
1150002863 17:61452301-61452323 GGGCGCAGACTGATTGACAGCGG + Intergenic
1150123399 17:62621391-62621413 GGGAGCTCAGAGAGGGACAGAGG - Intergenic
1150149553 17:62797993-62798015 GGCAGCAGGGAGATGGACATGGG + Intronic
1150444803 17:65220649-65220671 GGGAGCAGAAAGGTGAGCAGAGG - Intronic
1150907510 17:69353841-69353863 GGGAGCAGGCAGATGGGGAGAGG + Intergenic
1150931479 17:69589977-69589999 GGGAGCACACAGACAGATAGGGG + Intergenic
1151786849 17:76279280-76279302 GGGAGAGGACAGGTGGACACAGG + Intronic
1152650791 17:81491726-81491748 GGGAACAGAAAGAGGGAGAGAGG - Intergenic
1152846402 17:82602536-82602558 GGGAGTAGACAGCAGGTCAGAGG - Exonic
1153000067 18:446810-446832 GGGAGAAGGCAGATGGAAAATGG - Intronic
1153228822 18:2918158-2918180 GCTAGCAGACACAGGGACAGAGG + Exonic
1153322257 18:3784903-3784925 GGGAGCAGCAAGAAGGCCAGTGG - Intronic
1153332519 18:3888481-3888503 AGGAGCAGACTGATTGACAGAGG - Intronic
1153634744 18:7103936-7103958 GAGACCAGACAGACGGACAGAGG - Intronic
1154411154 18:14142965-14142987 GGCAGCTTACAGATGGGCAGAGG - Intergenic
1156005695 18:32438451-32438473 GGGAACAGTCAGTTTGACAGTGG - Intronic
1157203801 18:45681642-45681664 GTGAGCAGAGAGATGGAGAGAGG - Intronic
1157583839 18:48788629-48788651 GGGAACAGCCAGAGGCACAGTGG + Intronic
1157733396 18:50024380-50024402 GGTAGCAGAGAGAAGGAGAGAGG - Intronic
1157844674 18:50992217-50992239 GGGTGGGGACAGATGGTCAGGGG + Intronic
1157993489 18:52526282-52526304 GGGAGGAGACAGATGGCCAATGG + Intronic
1159262194 18:66028633-66028655 GGGAATTGACAGATGGACAAAGG + Intergenic
1160399905 18:78602584-78602606 GGGAGCACAAAGATGCACGGTGG - Intergenic
1161029442 19:2050956-2050978 GGGAGCAGACAAAGGGAGGGCGG + Intronic
1161303947 19:3556840-3556862 GGGCACAGACAGACAGACAGGGG + Intronic
1161847309 19:6719120-6719142 GGGAGAAGACAGAAGGGGAGGGG + Intronic
1161930441 19:7336239-7336261 GGGAGCAGAGAGATAGAGAGAGG + Intergenic
1162392070 19:10395776-10395798 GGGAGCTGAGGGATGGACGGGGG - Intronic
1162534349 19:11254055-11254077 GGGAACAGCAGGATGGACAGAGG - Intronic
1162887449 19:13706312-13706334 GGGAGGAAAGAGAAGGACAGAGG - Intergenic
1163319018 19:16561467-16561489 GGTAGCAGGCAGATGGGCGGAGG - Intronic
1164466144 19:28489217-28489239 AGGAGCAGACACAGAGACAGGGG + Intergenic
1164675393 19:30097167-30097189 GTCAGCAGGCAGATGGGCAGCGG - Intergenic
1165386197 19:35511946-35511968 GGGAGGAGGCAGATGGGAAGGGG - Intronic
1166206429 19:41272666-41272688 AGCAACATACAGATGGACAGTGG + Intronic
1166360976 19:42252942-42252964 GAGAGCAGGCACATGGAGAGAGG + Intronic
1166893815 19:46010587-46010609 GGGAGAAGTCAGATGGGCAGGGG + Intronic
1166929478 19:46293258-46293280 GGGAACTGACAGGTAGACAGTGG - Intergenic
1167278206 19:48551667-48551689 GGAAACAGACACAGGGACAGAGG - Intergenic
1167435179 19:49474924-49474946 AGGAGCGGGGAGATGGACAGAGG + Intronic
1167478070 19:49712448-49712470 GGGAGCAGACAAAAGGGGAGAGG + Intronic
1167687912 19:50968159-50968181 GGGAGCAGACAGAGGGATGGGGG - Intronic
1168272410 19:55257595-55257617 AGGAGGTGACAGATGGAGAGTGG - Intronic
1168338693 19:55611658-55611680 GAGAGCAGCCCGATGGATAGAGG + Intronic
1168407810 19:56120155-56120177 GGGAGCAGGGAGATGAACAAGGG - Intronic
925146773 2:1587561-1587583 GGGCGGGGACAGAGGGACAGAGG - Intergenic
925146829 2:1587749-1587771 GGGCGGGGACAGAGGGACAGAGG - Intergenic
925153940 2:1636036-1636058 GGGGGCAGACAGGGTGACAGTGG + Intronic
927045686 2:19275948-19275970 GAGAGCAGAAAGAAGGTCAGAGG - Intergenic
928124715 2:28607400-28607422 GGGAGCAGGCATGTGAACAGGGG - Intronic
928364649 2:30691718-30691740 GGGACCAGACAGCTGGTGAGGGG + Intergenic
928389076 2:30895273-30895295 GGGAACCGACACATGGACAGAGG + Intergenic
928404389 2:31003583-31003605 GGGAGGAGAGAGATGGGCAGTGG - Intronic
929184907 2:39083559-39083581 GGGAGGAGAAAGATGGGAAGAGG + Intronic
929414271 2:41731069-41731091 GGAAGCAGCCAGATGGGCACTGG - Intergenic
929590464 2:43142586-43142608 GGGAGGAGAGAGATGGACTCAGG - Intergenic
929616807 2:43316423-43316445 TGGATCAGTCAGAGGGACAGGGG + Intronic
929811133 2:45190270-45190292 GGAAGCAGACATAGGGACTGAGG - Intergenic
930262671 2:49165780-49165802 GGCAGCAGGGAGATGGACTGAGG + Intergenic
930675565 2:54197161-54197183 GGAAGCAGAATGATGGAGAGGGG + Intronic
932220535 2:69995681-69995703 GGGAGCAGGAAGAGGGACACAGG + Intergenic
932568158 2:72922398-72922420 TGGAATAGACAGATGGTCAGGGG - Intronic
932699122 2:73981503-73981525 TAGAGCAGACAGAGGGAGAGAGG - Intergenic
932875459 2:75446691-75446713 GGGAGGAGGCAGAAGGATAGGGG - Intergenic
934514471 2:94977577-94977599 GAGAGCTGACAGGGGGACAGAGG - Intergenic
934924483 2:98372410-98372432 GGGATCAGCCACATGGTCAGGGG + Intronic
934987712 2:98899816-98899838 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987729 2:98899877-98899899 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987736 2:98899908-98899930 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987743 2:98899939-98899961 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987749 2:98899970-98899992 GAGGGGACACAGATGGACAGAGG + Intronic
934987764 2:98900032-98900054 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987771 2:98900063-98900085 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987778 2:98900094-98900116 GAGGGGAGGCAGATGGACAGAGG + Intronic
935321040 2:101889553-101889575 TTGAGCAGATAGATGGCCAGGGG + Intronic
935643119 2:105309262-105309284 GGGATCAGAGAGCTGGAAAGAGG + Intronic
936242423 2:110799437-110799459 GAGAGCAGACAGGTGGCCAGGGG - Intronic
940220830 2:151349588-151349610 GGTAGCATAGAGATGGAAAGAGG + Intergenic
940582483 2:155600121-155600143 TGGACCAGACATATGGAAAGTGG + Intergenic
940878723 2:158924240-158924262 GGGAGCAGTCAGATGATAAGTGG - Intergenic
941824969 2:169884920-169884942 GGGATAAGATAGATGGAAAGAGG + Intronic
943336633 2:186623115-186623137 AGGAGCAGAGGAATGGACAGTGG - Intronic
943390141 2:187256168-187256190 AGGAGCAGAGAGATGGCTAGGGG - Intergenic
944183763 2:196926188-196926210 GGGAGGAGGCGGAGGGACAGCGG + Intronic
945039791 2:205733998-205734020 AGGAGGAGACAGAGGCACAGGGG - Intronic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
947531586 2:230912049-230912071 GGGAGCAGGGAGGTGGGCAGAGG - Intronic
947743202 2:232494362-232494384 GGGAGGAGACAGAGGGTCTGGGG + Intergenic
948118221 2:235509678-235509700 GGGTGCAAGCAGACGGACAGAGG - Intronic
948233049 2:236365778-236365800 GGGAGGACAAAGGTGGACAGAGG + Intronic
948592504 2:239060372-239060394 TGAATTAGACAGATGGACAGAGG - Intronic
1168962077 20:1876802-1876824 TGGAGCAGACGGAGGGAGAGGGG - Intergenic
1169143122 20:3237214-3237236 GGGTGAGGACAGAGGGACAGGGG + Intronic
1169263210 20:4152494-4152516 GGGAGCTGACCCCTGGACAGGGG + Intronic
1169390721 20:5188781-5188803 GGAAGCAGACACATGCAAAGAGG + Intronic
1169638494 20:7721627-7721649 GGGAGAAGAGAGAAGGAAAGAGG - Intergenic
1170701862 20:18711261-18711283 GAGAGGAGACAGCTGCACAGAGG - Intronic
1172292181 20:33784246-33784268 GGGGGGAGAGAGATGGAGAGAGG - Intronic
1172323439 20:34015973-34015995 GGTAGAAGACAGTGGGACAGGGG - Intronic
1173186105 20:40841442-40841464 GGGAGCAGACAAATCGGGAGTGG + Intergenic
1173530963 20:43769268-43769290 AGGTGCACACAGATGGCCAGAGG - Intergenic
1173791452 20:45830438-45830460 GGAAGTAGACAGATGAAGAGAGG - Intronic
1174269506 20:49356998-49357020 GGGATCAGAGGGAAGGACAGGGG + Intergenic
1174295031 20:49539727-49539749 GGCGGCAGACAGAGGGTCAGGGG + Intronic
1174421830 20:50404290-50404312 AAGAGGTGACAGATGGACAGAGG + Intergenic
1174454244 20:50638381-50638403 GGCTGCAGACTGATAGACAGAGG - Intronic
1174472594 20:50771664-50771686 GGCTGCAGACTGATAGACAGAGG + Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1175443078 20:59004315-59004337 AGGAGCAGACAGCTGGGGAGAGG + Intronic
1176172861 20:63703974-63703996 TGGAGCAGTCAGAGGGACTGTGG + Intronic
1178114575 21:29404374-29404396 GGGAGCACACAGAGGGGCAGAGG + Intronic
1178581114 21:33839423-33839445 GGGAGGAGCCAGATGGAGTGGGG + Intronic
1178851713 21:36217700-36217722 GGGAGCGGGCAGATGGGAAGAGG - Intronic
1178927076 21:36785156-36785178 GGGAGCCGAGAGAGGGAAAGAGG - Intronic
1179402068 21:41093730-41093752 GGGAGCAGCCAGGAGGGCAGAGG + Intergenic
1179623784 21:42635917-42635939 GGGAACAAATAGATGGACAATGG - Intergenic
1180569559 22:16702476-16702498 GGAGGCAGGCAGAGGGACAGAGG - Intergenic
1180957976 22:19749715-19749737 GGGAGGGGACAGGTGGCCAGGGG + Intergenic
1180965060 22:19783880-19783902 GGAAGCTGACAGAGTGACAGAGG + Exonic
1181936071 22:26439826-26439848 TGGAGGAGACAGAAGGACGGAGG - Intronic
1182442675 22:30373399-30373421 GGCAGCAGGCAGATGCACACCGG - Intronic
1182471899 22:30553958-30553980 GGGAACGGACATTTGGACAGGGG - Intergenic
1182862408 22:33571406-33571428 GGAGGCAGAGAGCTGGACAGTGG + Intronic
1183148953 22:36021974-36021996 ATGAGCAGACAGATGGAGTGAGG - Intronic
1183392990 22:37556421-37556443 GAGGGCAGATGGATGGACAGGGG + Intergenic
1183648081 22:39138377-39138399 GGGAGTAGGCATATGGCCAGTGG - Intronic
1183936921 22:41267896-41267918 GGGAGCACAGAGACTGACAGGGG - Intronic
1184280101 22:43432570-43432592 GGGAGGAGAGAGAGGGAAAGAGG + Intronic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
1184428017 22:44424449-44424471 CAGAGCAGAAAGATGGAGAGAGG - Intergenic
1185007245 22:48288180-48288202 TGGAGGGGACAGATGGCCAGAGG + Intergenic
949169257 3:979115-979137 GGATGCAGAGAGATGCACAGAGG + Intergenic
949385392 3:3496672-3496694 GAGAGGAGACAGATGGTCATGGG - Intergenic
949412036 3:3776361-3776383 AGTAGCAGAGAGCTGGACAGGGG + Intronic
949947412 3:9201507-9201529 GGGAGCAGGCAGAGGCACACAGG - Intronic
950050919 3:9988818-9988840 GGGAGGAGAAAGAAAGACAGTGG - Intronic
950491046 3:13305325-13305347 GGGGGCTGACAGATGAGCAGAGG - Intergenic
951716110 3:25648316-25648338 GGGAGCAGACAGATGGACAGAGG + Intronic
953319959 3:41962630-41962652 GGAAGGAAACAGAAGGACAGTGG - Intergenic
954195451 3:48994180-48994202 GGTAGCAGACCAATGGACAGAGG - Intronic
954361898 3:50126567-50126589 GAGGGAGGACAGATGGACAGCGG - Intergenic
954845645 3:53553335-53553357 GGAGGCAGACAGACGGGCAGCGG - Intronic
954946849 3:54433638-54433660 GGGAGAAGACAGACGGCCTGCGG + Intronic
955487986 3:59454107-59454129 GGCAGAAGAGAGATAGACAGAGG + Intergenic
956169256 3:66419778-66419800 GGGAGGAGACAGGTGGGGAGAGG - Intronic
956578383 3:70781457-70781479 GGGGTCAGAAAGATGGCCAGTGG + Intergenic
957985415 3:87568971-87568993 GGCAGCAGACAGAAGGAAAAAGG + Intergenic
959651639 3:108756437-108756459 AGGTGCAGGGAGATGGACAGGGG + Intronic
960165924 3:114401155-114401177 GGGAGGAGACAGAAGGAGAAAGG + Intronic
960435128 3:117617119-117617141 AGAAGAAGACAGATGGTCAGTGG + Intergenic
960822361 3:121748808-121748830 GGGAGCGGACAGTTTGAGAGTGG - Intronic
961382923 3:126507818-126507840 GGGGGCAGACAGAGGGGCTGAGG + Intronic
964579804 3:158220353-158220375 GAGTACAGACAGATGGACTGAGG - Intronic
965906411 3:173712503-173712525 GGGAGCACACAGGTAGTCAGTGG - Intronic
966010849 3:175074773-175074795 GGGAGTAGACTGATGATCAGTGG + Intronic
966095137 3:176190894-176190916 GGGAGCAGACAGATGAAGCAGGG + Intergenic
966213317 3:177475479-177475501 GGGAGCAGGCAGAGGAACAGAGG + Intergenic
966216875 3:177512991-177513013 GGGAGCAAAGAGAAAGACAGAGG + Intergenic
966427739 3:179798427-179798449 AGGAGGAGACAGAGGGATAGGGG - Exonic
967164732 3:186770490-186770512 GGCAGGAGACAGATGAACTGTGG - Intergenic
967461812 3:189756715-189756737 GGGAGGAGACAGAAGGAAAAGGG - Intronic
968108408 3:196020644-196020666 GGGAGCAGTCAGATCTCCAGTGG - Intergenic
968478184 4:822308-822330 GGGAGCAGAGGGAGAGACAGAGG - Intronic
968793877 4:2688856-2688878 AGGAGCAGCCAGATGGCTAGTGG + Intronic
969493194 4:7511581-7511603 GGGGGCAGAGAGATGGACGCTGG + Intronic
969724219 4:8909802-8909824 GGGGGCAGACAGAGGCACACAGG + Intergenic
970173109 4:13308700-13308722 TGCAGCACACAGAAGGACAGTGG + Intergenic
970571180 4:17384448-17384470 GGGAGCAGGCAGGTGCAGAGAGG - Intergenic
970995263 4:22260224-22260246 TGGACCAGACAGATGCACAGCGG + Intergenic
971148997 4:24011090-24011112 GGTAGCAGACAGGATGACAGTGG - Intergenic
974005469 4:56552088-56552110 GGGAGCAGAGTGAGGCACAGAGG + Intronic
974116386 4:57584644-57584666 GGAAGCAGACACATGCAAAGGGG + Intergenic
976510664 4:85905637-85905659 GGGAGAAGACTGATGCTCAGTGG - Intronic
977691244 4:99913997-99914019 GGAAGCAGACAGGTGCAAAGAGG + Intronic
977801163 4:101233911-101233933 AGCAGCAGACAGATGGTGAGAGG - Intronic
978756294 4:112306357-112306379 AGGACCAGACAGATTCACAGCGG - Intronic
978815536 4:112900675-112900697 GGAAGGAGAAAGATGGAAAGAGG - Intronic
979819112 4:125149005-125149027 AGGAGCAGACAGATTCACAGAGG - Intergenic
982079536 4:151775344-151775366 GGCAGCAGAAAGATGAAAAGGGG + Intergenic
982315153 4:154024253-154024275 GGGAGCATACAGATCGGCAGTGG - Intergenic
984121824 4:175754942-175754964 GGGAGTAGACAGAGGGAGAGAGG - Intronic
984807538 4:183765500-183765522 GGGAGCAGTCGGGAGGACAGAGG + Intergenic
985181064 4:187263660-187263682 GGGAGTAGACAACTGGACTGTGG + Intergenic
985991567 5:3566061-3566083 GGGCCCAGACAGATGGTGAGAGG - Intergenic
986782344 5:11078034-11078056 TAGAGCAGACAGTTGGACACAGG + Intronic
988514892 5:31895760-31895782 GGGAGCAGACAGAGGGAGGAAGG - Intronic
988642679 5:33058665-33058687 GGGAGCAGACAGTGGGAATGGGG + Intergenic
988800608 5:34693045-34693067 GGGCACAGACACATGCACAGAGG - Intronic
988852965 5:35197376-35197398 GGGAGCAGCCAGAAGGAAAGGGG - Intronic
989615312 5:43332483-43332505 GGGAGTAGAGACATGGAGAGAGG + Intergenic
990320275 5:54623160-54623182 GGGCCAAGACAGATGGCCAGAGG + Intergenic
990549157 5:56855176-56855198 GGGAGGAGAAAGAAGGAAAGAGG - Intronic
990699334 5:58459396-58459418 GGGAGCAGATAGAGGGAGAGAGG + Intronic
990722119 5:58708344-58708366 GAGAGCAGGCAGATGGGCAAGGG - Intronic
990802836 5:59624580-59624602 CTGAGCAGACTGATGCACAGAGG + Intronic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
991448816 5:66729952-66729974 GGGAGCAGCCTCATGAACAGTGG + Intronic
991449147 5:66733216-66733238 GGGAGGAGACAGGGAGACAGAGG - Intronic
991705797 5:69357157-69357179 GGGGGCAGTCTGATGGACACTGG + Intronic
992770240 5:80040873-80040895 GGGAGCAGACACATGGGAAGAGG + Intronic
992874849 5:81043815-81043837 AGGAACAGACAGATGGAGAAGGG - Intronic
992888689 5:81184359-81184381 GCGCGCAGACAGATGGATGGGGG + Intronic
993773588 5:91962794-91962816 GGGAGCATGCAGATGGGCAGGGG - Intergenic
994845954 5:104988646-104988668 AGGAGCAGAGAGACTGACAGGGG + Intergenic
995944419 5:117626021-117626043 GGGAGCTGAAAAATGGACACAGG - Intergenic
996847777 5:127919832-127919854 CAGAGCAGATAGAGGGACAGAGG - Intergenic
998145338 5:139724635-139724657 GGGGGCAGAGAGAAGGGCAGGGG + Intergenic
1001664629 5:173422106-173422128 GGAAGCAGAGAGATTGAGAGGGG - Intergenic
1002692466 5:181059749-181059771 GGCAGCGGGCAGATGGTCAGGGG - Exonic
1002953344 6:1837883-1837905 GGGAGCAGACAGGAGGACTAGGG + Intronic
1003115484 6:3281090-3281112 TGGAGCATCCAGATGGACAGTGG + Intronic
1003399893 6:5782711-5782733 GGCAGGAGACAGGTGCACAGGGG - Intergenic
1003593198 6:7453028-7453050 GGAAGCATGCAGATGGGCAGGGG - Intergenic
1004043411 6:12005037-12005059 GGGAGCAGAAAGAAGGGAAGAGG + Intergenic
1004463542 6:15862018-15862040 GCGAGTGGACAGGTGGACAGGGG + Intergenic
1006337103 6:33426572-33426594 GGGAAGAGACAGATGGAGAGAGG - Intronic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1006744874 6:36334492-36334514 GGGAGGAGAGAGCTGGACTGAGG - Intronic
1006801216 6:36760772-36760794 GCCAGCAGACAGCTGGACATAGG + Intronic
1007091576 6:39187986-39188008 GGGAGCAGAAAGAGGGCAAGAGG + Intergenic
1007686604 6:43670794-43670816 TGGAGCATCCAGATGGAGAGGGG + Exonic
1008197316 6:48539962-48539984 TGTAGCAAACAGATGTACAGAGG + Intergenic
1008224101 6:48890900-48890922 GGGAAGAGACAGATGGACATGGG + Intergenic
1009557846 6:65197450-65197472 GAGAGCAGAAAGGTGGTCAGTGG + Intronic
1011570619 6:88730439-88730461 GTGAGCACACAGTTGGACAAGGG - Intronic
1011793086 6:90919790-90919812 GGGCCCAGACAAATGGATAGGGG + Intergenic
1012110437 6:95224311-95224333 TGGAGAAGACAGATGCACACTGG + Intergenic
1012353317 6:98280507-98280529 GGAGAGAGACAGATGGACAGAGG - Intergenic
1012979049 6:105810818-105810840 GGGAGCAGAAAGAGGGAGTGAGG + Intergenic
1014262198 6:119231765-119231787 GGGAGAAGACAGAAGAGCAGTGG + Intronic
1014856070 6:126402328-126402350 AGGAGAAGAAAGATGGAGAGGGG - Intergenic
1016128808 6:140440154-140440176 GGGAGGAGAAAGAAGGAGAGAGG - Intergenic
1016272626 6:142306216-142306238 AGGAGTAGAGAGATGGAAAGTGG + Intronic
1016363782 6:143294279-143294301 GGAAGCAGCTAGATGTACAGGGG - Intronic
1018648732 6:165972954-165972976 GGGAGAAGAGAGAAGGAGAGAGG - Intronic
1019060481 6:169254072-169254094 GGGAGGAGCCAGACGGAGAGAGG + Intergenic
1019204299 6:170346245-170346267 GCGTGCAGGGAGATGGACAGTGG - Intronic
1019505526 7:1388639-1388661 GTGAGCAGCCAGCGGGACAGGGG - Intergenic
1019890320 7:3941160-3941182 GGGAGAGGAGAGAGGGACAGAGG - Intronic
1019940040 7:4282585-4282607 GGGAGCAGACACTTGGAGAGAGG - Intergenic
1020020794 7:4866982-4867004 GGAAGCAGACAGGTGCAAAGAGG - Intronic
1020211316 7:6159902-6159924 GGGCGCAGACAGCAGCACAGGGG - Intronic
1021726027 7:23548852-23548874 GGCATCATACAGATGGACACTGG + Intergenic
1022569951 7:31442536-31442558 GAGAGGAGACGGAGGGACAGGGG + Intergenic
1023118976 7:36890393-36890415 TTCAGCAGAGAGATGGACAGTGG - Intronic
1023724797 7:43131878-43131900 AGGAGGAGACAGAAGGACAAAGG - Intronic
1023856130 7:44185483-44185505 GAGAGGGGACAGATGGAGAGAGG - Intronic
1025856384 7:65283603-65283625 GGGACCAGATAGATTCACAGTGG + Intergenic
1026523515 7:71135696-71135718 GGCAGCAGACTGTTGGGCAGTGG - Intronic
1027549094 7:79568332-79568354 GAGAGAAGACAGAGGCACAGGGG + Intergenic
1028729606 7:94130739-94130761 CAGAGAAGACAGAGGGACAGAGG - Intergenic
1029121364 7:98270464-98270486 GGGACCGGACAGATGGCCAGGGG - Intronic
1029897513 7:104000077-104000099 GGGAGGAGAAGGATGGAGAGTGG - Intergenic
1029950952 7:104585088-104585110 GGGAGTAGGGAGAAGGACAGAGG - Intronic
1029968224 7:104762878-104762900 GGCAGCAAGCACATGGACAGAGG + Intronic
1030058509 7:105603813-105603835 AGGGGCAGAGAGATGGACAGAGG - Intergenic
1030553669 7:110996360-110996382 GGGAGCAGAGAGAACGAGAGGGG + Intronic
1030679004 7:112414485-112414507 GGGAGCAGACACATGGCCACTGG + Intergenic
1030820643 7:114087222-114087244 GGAAGGAGAGAGATGGAAAGGGG + Intronic
1031521036 7:122766095-122766117 GGGAGCAGGCACATGCAAAGAGG + Intronic
1032684081 7:134213039-134213061 GTCAGCAGACTGATGGAGAGGGG + Intronic
1032955581 7:136968207-136968229 GGGAACAGAGAGATGGTCAAGGG - Intronic
1034393388 7:150802298-150802320 GGGAGCTGCCATCTGGACAGGGG + Exonic
1034887569 7:154809726-154809748 GGGAGCAGACAGAAGAGGAGAGG + Intronic
1035366573 7:158352274-158352296 GGGAGCAGACAGGAGGGGAGTGG - Intronic
1036723165 8:11196895-11196917 AGGAGCAGACAGGAGGGCAGGGG + Intronic
1036769259 8:11567410-11567432 GGGGGAAGAGAGATGGAGAGAGG + Intergenic
1037743533 8:21626000-21626022 GGAGGCAGCCAGACGGACAGAGG + Intergenic
1037753473 8:21697130-21697152 GGGAGGGGACAGAGGGAGAGGGG + Intronic
1038217579 8:25576905-25576927 GGAAGCAGACAGAAAGACAGTGG - Intergenic
1039348213 8:36731692-36731714 GGGTGCAAACACATGGACACAGG + Intergenic
1039991999 8:42496449-42496471 GAGAGCAGAGAGATGAATAGGGG + Intronic
1041180046 8:55237866-55237888 GGGAGAAGACAGATGGTGACAGG - Intronic
1041341981 8:56855820-56855842 GGGAGCAGATACATGCACACTGG + Intergenic
1041488718 8:58408724-58408746 GGGAGGAGACAGATGTAGAATGG - Intergenic
1041513374 8:58675139-58675161 GAGAGAGGACAGATAGACAGAGG - Intergenic
1041696710 8:60743345-60743367 GCTAGCAGGGAGATGGACAGAGG + Intronic
1042379225 8:68093767-68093789 GGGAGTAGGCACATGCACAGTGG - Intronic
1043510939 8:80949589-80949611 TTGTGCAGGCAGATGGACAGGGG + Intergenic
1045065203 8:98437986-98438008 GGGAGCTGACAGAGGCCCAGAGG + Intronic
1045492199 8:102678648-102678670 GGGAGAAGACAGGGGAACAGGGG + Intergenic
1045975947 8:108131094-108131116 GGGGACAGACTGATGGGCAGAGG + Intergenic
1046305158 8:112356584-112356606 GGGAGGAGACACATGGGAAGTGG - Intronic
1049227871 8:141466326-141466348 GGGGGCAGACAGGAGGGCAGAGG + Intergenic
1049390549 8:142367495-142367517 GAAAGCAGACAGATGGACGCCGG + Intronic
1049656039 8:143798020-143798042 GGGAGCAGAGAGATGGAGGCCGG + Intronic
1049750286 8:144279831-144279853 GAGAGGGGACAGCTGGACAGGGG + Intronic
1052132159 9:24861320-24861342 AGGACCAGACAGATTCACAGCGG + Intergenic
1052576940 9:30303010-30303032 GGGAGCAGAATGATGAACAGTGG + Intergenic
1053005536 9:34601900-34601922 AGAGGCAGAGAGATGGACAGAGG + Intergenic
1055656305 9:78453219-78453241 GGATGCAGAGACATGGACAGAGG + Intergenic
1056233595 9:84570619-84570641 CTGAGCAAACAGATGGCCAGAGG - Intergenic
1056269519 9:84933317-84933339 GGGAGCACACCAAAGGACAGAGG - Intronic
1057195638 9:93114561-93114583 GGGTGCACACAGATGGACAGGGG - Intergenic
1057437270 9:95053218-95053240 GGAAGCAGAAAAATGGACAGAGG + Intronic
1057519183 9:95747705-95747727 GGGAGCAGGGAGATCAACAGGGG - Intergenic
1057551526 9:96054120-96054142 GGGGGCTGGCAGGTGGACAGTGG + Intergenic
1057828967 9:98392806-98392828 ATGAGTAGACAGATGGACAGTGG - Intronic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1058115568 9:101080691-101080713 GGGAACTGAGAGATGGAAAGGGG + Intronic
1058311883 9:103514557-103514579 GGGAGCATACAAAAGGGCAGAGG + Intergenic
1058947893 9:109875906-109875928 GGGAGCTGGCAGCTGGACAAAGG - Intronic
1060016361 9:120089748-120089770 GGAAGCAGACATATGTAAAGAGG - Intergenic
1060062909 9:120476736-120476758 GTGTACAGACACATGGACAGAGG + Intronic
1060250395 9:121982381-121982403 GGGAGGTGACATATGGACAGGGG + Intronic
1060391623 9:123282433-123282455 GGGAGCAGAAAGAAGAAAAGAGG + Intergenic
1060540772 9:124428801-124428823 GGCAGCGGGCAGATTGACAGCGG - Intergenic
1061279230 9:129587540-129587562 GGGAGAAGACAGCTGTACAGTGG + Intergenic
1061623148 9:131824619-131824641 GGCAGCAGACACCGGGACAGAGG - Intergenic
1061913605 9:133737891-133737913 GGGATCAGACAGATGGGTGGGGG + Intronic
1062158318 9:135066397-135066419 GGGAGGAGACACATGCACAGGGG + Intergenic
1062185555 9:135216358-135216380 GGGTGTGGACAGGTGGACAGTGG - Intergenic
1062380253 9:136283674-136283696 GGGTGCAGCCAGAGGGGCAGAGG - Intronic
1187231031 X:17423501-17423523 CCGAGCAGACAGAGGGCCAGAGG - Intronic
1187291206 X:17955139-17955161 GGGGGCAGACAGGGGGACAAAGG + Intergenic
1187500952 X:19838294-19838316 GGAAGCAGCCAGAGGGACAGTGG + Intronic
1189284452 X:39841439-39841461 GGGAGGAGAGAGAGGGAGAGTGG + Intergenic
1189487052 X:41442295-41442317 GGGAGCAGACAGAGGTCCCGGGG + Intergenic
1189487954 X:41447146-41447168 GGGGCCAGGCAGATGGAGAGAGG + Intergenic
1191196386 X:57728089-57728111 AGGACCAGACAGATTCACAGCGG - Intergenic
1192442457 X:71184827-71184849 GAGAGCAGACAGATGGTCCAGGG + Intergenic
1193059859 X:77194095-77194117 AGGACCAGACAGATTCACAGTGG - Intergenic
1193937807 X:87643441-87643463 AGGACCAGACAGATTCACAGTGG + Intronic
1194858739 X:98967766-98967788 ATGAGCAGGCAGATGGAGAGTGG - Intergenic
1195752711 X:108174353-108174375 GGGATCAGAGAGGTGGGCAGTGG + Intronic
1197816275 X:130501834-130501856 GGGAGAAGACAGATGGAAGAAGG - Intergenic
1198336210 X:135669143-135669165 GGGAGAAGGCAGCTGGAAAGGGG - Intergenic
1198427023 X:136530715-136530737 GGGAGCAGGAAGAAGAACAGAGG - Intergenic
1198932811 X:141879150-141879172 GGCAGCAGGCACAGGGACAGGGG - Intronic
1199019992 X:142868173-142868195 GAGAGCATGCAGATGGACTGGGG + Intergenic
1199318452 X:146409558-146409580 GGGAGAAGATGGAGGGACAGTGG + Intergenic
1200215351 X:154365819-154365841 GTGAGGAGAGAGATGGAGAGGGG + Intronic
1200367608 X:155684006-155684028 GGGGGCCGACAGGTGGCCAGGGG + Intergenic